Tài liệu Báo cáo khoa học: Role of cleavage and shedding in human thyrotropin receptor function and trafficking pdf

Role of cleavage and shedding in human thyrotropin receptor function
and trafficking
Myle
`
ne Quellari
1
, Agne
`
s Desroches
1
, Isabelle Beau
1
, Emmanuelle Beaudeux
1
and Micheline Misrahi
1,2
1
INSERM E120, Re
´
cepteurs, Signalisations et Physiopathologie Thyroı
¨
dienne et de la Reproduction, and
2
Laboratoire
d’Hormonologie et Biologie Mole
´
culaire, Ho
ˆ
pital Bice
ˆ
tre, IFR Bice

ˆ
tre, Le Kremlin Bice
ˆ
tre, France
The thyrotropin receptor (TSHR) undergoes a cleavage at
the cell membrane, leading to a heterodimer, comprising an
a extracellular and a b-transmembrane and intracellular
subunits, held together by disulfide bonds. Moreover, part of
the a-subunit of the receptor is shed from thyroid and
transfected L cells. To understand the role of cleavage and
shedding, we constructed deletion mutants starting,
respectively, at the most N-terminal (S314), and C-terminal
(L378) cleavage sites previously mapped, corresponding to
free b1orb2-subunits without further modification of
receptor structure. Functional studies performed in COS-7
cells showed that both mutants display an increased basal
activation of the cAMP pathway when compared with the
wild-type receptor. By contrast, deletion of almost the entire
extracellular domain of the receptor (TM409 mutant) totally
impairs receptor function, thus confirming a role of the
juxtamembrane extracellular region in receptor function.
The b1 mutant receptor exhibited an increased internalizat-
ion when compared with the hormone-activated holo-
receptor. Furthermore, no recycling was observed in the case
of the b1 mutant receptor. These observations strongly argue
for a different conformation between the receptor activated
by cleavage and shedding on the one hand, and the receptor
activated by the ligand on the other hand. Cleavage and
shedding of a receptor already activated by a transmem-
brane activating mutation M453T further increase its

activity, showing that the extracellular domain still exerts a
negative effect in the M453T holoreceptor. An increased
internalization of the M453T receptor was observed when
compared with the wild-type receptor, which was increased
further in the corresponding truncated b1-M453T receptor.
Thus cleavage and shedding yield TSHR activation but also
increase internalization of the free b-subunits of the receptor,
the latter mechanism limiting simultaneously excessive
receptor signaling. The combined effects may be responsible
for the limited basal constitutive activation of the cAMP
pathway that is detected for the TSHR.
Keywords: thyrotropin receptor; cleavage; shedding; con-
stitutive activity; traffic.
The thyrotropin receptor (TSHR) plays a key role in
thyroid growth and function [1–3]. This receptor is also the
target of stimulating or blocking autoantibodies in patients
with autoimmune diseases [4,5]. The TSHR belongs to a
particular subgroup of G protein-coupled receptors, inclu-
ding the FSH and LH receptors [6]. They are characterized
by the presence of a seven transmembrane domain and a
large extracellular domain involved in high affinity hormone
binding. These three receptors are mainly coupled to G
s
,
leading to the activation of the adenylate cyclase pathway.
However, unlike the gonadotropin receptors, the TSHR
transduces a signal via adenylate cyclase even in the absence
of ligand, thus having a weak constitutive activity [7].
The TSHR undergoes a unique post-translational mat-
uration among G protein-coupled receptors. In human

thyroid membranes, intramolecular cleavage occurring at
the cell surface generates two subunits: an approxi-
mately 53 kDa a extracellular subunit, and a wide approxi-
mately 33–42 kDa b-transmembrane and intracellular
subunit (called A- and B-subunits, according to the
terminology of Rees-Smith et al. [4,8]), held together by
disulfide bridges [9]. A similar maturation is also observed in
an L cell line stably transfected with the human TSHR
cDNA [10]. In addition, the extracellular domain of the
receptor is shed from the cell surface of thyroid and
transfected L cells [11]. The shedding is an enzymatically
catalyzed process, where the disulfide bonds reduction is
performed by cell-surface associated protein disulfide iso-
merase [12]. Other studies suggested that cleavage was
required for the formation of TSHR dimers and higher
order complexes [13]. PDI activity may also account for
disulfide bonding of TSHR oligomers.
Immunopurification and microsequencing of the b-sub-
units in thyroid membranes and transfected L cells led to the
identification of the cleavage sites of the TSHR. In fact,
multiple cleavage sites exist [14,15]. They are unrelated and
located in a specific extracellular region of the receptor (E3)
that displays no homology with the LH and FSH receptors
[15–17]. In transfected L cells and in thyroid membranes, the
Correspondence to M. Misrahi, Inserm E120, Baˆ timent Gregory
Pincus, Hoˆ pital Biceˆ tre, 94275, Le Kremlin Biceˆ tre, France.
Fax: + 33 1 45213822, Tel.: + 33 1 45212746/49591828,
E-mail:
Abbreviations: ABTS, 2,2¢-azine-di(ethylbenzthiazoline sulfonate);
bTSH, bovine TSH; FSH, follicle stimulating hormone; GPCR,

G protein-coupled receptor; LH, luteinizing hormone; TSH,
thyrotropin hormone; TSHR, thyroid stimulating hormone receptor.
(Received 25 March 2003, revised 7 June 2003,
accepted 12 June 2003)
Eur. J. Biochem. 270, 3486–3497 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03718.x
most N-terminal site mapped is upstream Ser314 and the
most C-terminal site detected is upstream Leu378 [15]. The
cleavage reaction is sequential and leads to the processive
digestion of the specific extracellular region of the TSHR.
The enzyme involved in the maturation of the TSHR shares
similarities with the ADAM (A Disintegrin and Metallo-
protease) family of metalloproteases [12,18].
The cleavage and shedding of the human TSHR may be
of physiological importance because the precise quantifica-
tion of each subunit in thyroid membranes demonstrated an
approximately 2.5 to 3-fold excess of b-overa-subunits [9].
This observation led us to postulate that the a-subunit
might be shed from cell membranes and released into the
extracellular space or bloodstream. Soluble forms of the
TSHR have been described in human thyroid homogenates
[19], or proposed in human blood [20,21]. Accumulation of
the a-subunit has also been detected in the extracellular
matrix [22].
There have been several difficulties in understanding the
functional role of receptor cleavage and shedding. Some
mutations or small deletions of individual or groups of
amino acids did not prevent receptor cleavage, due to the
multiplicity of the cleavage sites [23–26]. In addition, the
TSHR is expressed in transfected cells in multiple processed
and unprocessed forms [10,17]. Monomeric precursors also

accumulate in transfected cells [10].
Furthermore, the construction of mutant receptors
deleted from various parts of the extracellular domain led
to contradictory results: in a first study, one mutant was
found to be nonfunctional [27]. More recently, other
mutants were shown to display a constitutive activity
[28,29]. The latter result led to the proposition of an
inhibitory role of the ectodomain on the transmembrane
domain [29]. However, because of the lack of adequate
immunological tools to trace the receptor, these results were
obtained with modified tagged mutant receptors.
Moreover, the intracellular traffic of the TSHR has
been described [30], but the trafficking of the remaining
b-subunits is still unknown. Such trafficking influences the
number of molecules present at the cell surface.
To understand the role of cleavage and shedding, we
constructed deletion mutants, starting at the most N- or
C-terminal cleavage sites that we had previously mapped
in the divergent E3 region of the receptor [15]. We
studied the function and trafficking of such truncated
receptors, mimicking cleaved and shed receptors. More-
over, we re-evaluated the function of a mutant receptor
lacking almost the entire extracellular domain of the
TSHR, including the highly conserved region close to the
membrane [28].
We also studied a TSHR already constitutively activated
by a transmembrane point mutation [31], to know whether
cleavage and shedding would modify its function.
Experimental procedures
Materials

DMEM,
L
-glutamine and gentamycin were from Gibco
BRL (Invitrogen Corporation, Paisley, UK); fetal bovine
serum was from Biochrom. Bovine thyrotropin hormone
(bTSH; 2 IUÆmg
)1
), 3-iso-butyl-1-methylxanthine (IBMX),
gelatin, BSA (bovine serum albumin; fraction V) and
monensin were obtained from Sigma. 2,2¢-Azine-di(ethyl-
benzthiazoline sulfonate) (ABTS) was obtained from Per-
bio. Superfect transfection reagent was from Qiagen.
[
125
I]Streptavidin, cAMP-RIA assay kit, peroxidase-conju-
gated sheep anti-(mouse IgG) Ig and [
125
I]Streptavidin
(specific activity 20–50 lCiÆlg
)1
) were from Amersham
Pharmacia. Alexa488-labeled anti-mouse IgG was from
Molecular Probes (Netherlands).
Anti-TSHR monoclonal Igs
Monoclonal Igs T3-365 and R5T-34 have been described
previously [9,15]. Those Igs were raised against fragments of
the TSHR expressed in Escherichia coli. The T3-365 Ig is
raised against an epitope localized in the intracellular
domain of the TSHR [9], and the R5T-34 Ig recognizes an
epitope localized between amino acids 357 and 369 [15].

Expression vectors encoding deletion mutants of TSHR
The vector encoding the human wild-type TSH receptor
cDNA [pSG5-hTSHR] has previously been described [10].
Polymerase chain reaction was used to generate a deletion
from position +65 to position +940 (+1 being the first
base of the initiation codon), yielding a deletion of amino
acids 22–313 in the TSHR, to obtain the b1mutant
receptor. The N-terminus of this mutant receptor starts at
Ser314, after cleavage of the signal peptide. The four
following oligonucleotides, O1 to O4, were used in a
polymerase-chain reaction to generate a 348 base-pair
fragment (position ) 97–1126, +1 being the first base of
the initiation codon). O1: TGG GCA ACG TGC TGG
TTA T (position +973); O2: GTC CCT GGA CCC GCC
TAG ACA CTT ACG GAA CTT ATC GG (position
+1118); O3: CAG GGA CCT GGG CGG ATC TGT
GAA TGC CTT GAA TAG CC (position +2010); O4:
CTCGAGTTTTTGGGGGGTCCTTC(position
+2175). This fragment was digested with EcoRI (position
)26) and SacI (position +1105), purified and cloned into
the pSG5-hTSHR vector previously digested with the same
enzymes, yielding the pSG5-b1 expression vector.
To construct the expression vector encoding the b2
mutant receptor, starting at residue Leu378, an oligonucleo-
tide encoding amino acids 7–21 and 378–380 was cloned
into the pSG5-b1 expression vector, digested with PstI
(position +2301) and HindIII (position +1136).
In the same way, for generating the expression vector
encoding the TM409 mutant receptor, starting at residue
Glu409, an oligonucleotide encoding amino acids 7–21 and

409–412 was cloned into the pSG5-b1 expression vector,
digested with PstIandBbsI (position +1232).
The same strategy was used to construct the deletion
mutants containing the Met453Thr mutation, starting from
the pSG5-hTSHR-M453T vector, previously described [31].
All the constructs were verified by double-strand DNA
sequencing.
Cell culture and transfection
COS-7 cells were maintained in DMEM with
L
-glutamine
supplemented with 10% fetal bovine serum and 8 lgÆmL
)1
Ó FEBS 2003 Role of cleavage and shedding in TSHR function (Eur. J. Biochem. 270) 3487
gentamycin at 37 °C in a humidified 5% CO
2
atmosphere.
L
cells stably expressing the wild-type and mutant receptors
were maintained in DMEM supplemented with 10% fetal
bovine serum,
L
-glutamine and 200 lgÆmL
)1
G418, as
described [10].
For transient transfection, COS-7 cells were seeded in
six-well plates and grown overnight in DMEM supple-
mented with 10% fetal bovine serum. They were trans-
fected with the Superfect reagent according to the

manufacturer’s instructions. Two days after the transfec-
tion, cells were assayed for cAMP determination or
R5T-34 monoclonal Ig binding experiments. Transfection
efficiencies were verified by immunocytochemistry, using
the T3-365 monoclonal Ig [9], directed against an intracel-
lular epitope of the receptor.
Western blot analysis
COS-7 cells were grown on 10-mm dishes and transfected
as described above. Forty-eight hours later, membrane
extracts were prepared as described [15]. The extracts were
loaded on a 10% SDS/PAGE and Western blot analysis
were performed as described [15] using the monoclonal Ig
T3-365 (5 lgÆmL
)1
) directed against the intracellular
domain of the TSHR. This Ig recognizes all mutant
receptors, including TM409, devoid of almost all extracel-
lular sequences.
Cellular ELISA
COS-7 cells were plated on six-well plates and transfected
with the expression vectors encoding the wild-type, b1, b2
and TM409 receptors as described above. Two days after
transfection, the cells were fixed for 15 min in 3%
paraformaldehyde in NaCl/P
i
. After washing, the alde-
hyde groups were quenched with 50 m
M
NH
4

Cl in NaCl/
P
i
for 20 min. After 1 h saturation and permeabilization
with NaCl/P
i
, 1% BSA, 0,1% saponin, the cells were
incubated for 2 h with the T3-365 monoclonal Ig
(5 lgÆmL
)1
in NaCl/P
i
, 1% BSA, 0,01% saponin). The
cells were then washed with NaCl/P
i
,1%BSA,0,1%
Tween20 and incubated for 1 h with peroxidase-conju-
gated sheep anti-(mouse IgG) Ig (dilution 1 : 1000). After
washing with NaCl/P
i
,400lL ABTS was added into each
well and incubated for 15 min under dark. Absorbances
were read at 450 nm [28].
cAMP assay
COS-7 cells transfected with the expression vectors
encoding the wild-type or the truncated receptors were
washed twice with DMEM medium containing 20 m
M
Hepes, pH 7.4, and gelatin 1 mgÆmL
)1

at 37 °C. Each
dish was then incubated for 1 h at 37 °Cwiththesame
medium containing IBMX (0.5 m
M
) and 0–100 IUÆL
)1
of
bTSH. The incubation was stopped by aspiration of the
medium and addition of 400 lLÆwell
)1
of 1
M
perchloric
acid. The cells debris were then collected by centrifugation
at 15 000 g for 5 min at 4 °C. The resulting supernatants
were neutralized with 0.72
M
KOH and 0.6
M
KHCO
3
.
cAMP accumulation was measured by radioimmunoassay
[22].
Immunofluorescence and confocal microscopy
Indirect immunofluorescence was performed on COS-7
cells expressing the wild-type TSHR and the TM409
mutant receptors, grown on glass culture chambers
(Nalge Nunc International), as described [9]. The cells
were fixed for 15 min in 3% paraformaldehyde in NaCl/

P
i
. After washing, the aldehyde groups were quenched
with 50 m
M
NH
4
Cl in NaCl/P
i
for20min.After1hof
saturation and permeabilization with NaCl/P
i
,1%BSA,
0.1% saponin, cells were incubated for 2 h with the
monoclonal Ig T3-365 [9] (5 lgÆmL
)1
in NaCl/P
i
,1%
BSA, 0.01% saponin). The cells were then washed with
NaCl/P
i
, 1% BSA, 0.1% Tween20 and incubated for 1 h
with a 1 : 400 dilution of Alexa488-labeled antimouse
IgG. After washing, the cells were mounted with Fluor-
escent Mounting Medium. They were examined with a
Zeiss LSM-510 confocal scanning laser microscope
equipped with a 25 mW Argon laser, using a Plan
Apochromat 63 · objective (NA 1.40, oil immersion).
Green fluorescence was observed with long pass 505 nm

emission filter, under 488 nm laser illumination. The
pinhole is set at 1.0 Airy unit. Stacks of images were
collected every 0.4 lm along the z-axis. Projections of
z median optical slices were projected for each receptor.
Moreover, Differential Interference Contrast (DIC, or
Nomarski) was used to visualize individual cells [32].
Quantification of receptor–Ig complexes at the cell
surface
COS-7 cells were seeded in six-well plates and transfected as
described above. Two days after, cells were washed with
DMEM supplemented with 0.1% BSA and 20 m
M
Hepes
buffer, pH 7.4 (incubation medium) and incubated at room
temperature for 15 min, then cooled for 10 min at 4 °Cin
the same cold incubation medium. Cells were then incuba-
ted with 0.25 mL of incubation medium containing
2 lgÆmL
)1
of biotinylated R5T-34 monoclonal Ig as
described [30] at 4 °C for 30 min. Next, after removal of
the unbound Ig, cells were incubated with 0.4 mL of cold
incubation medium containing [
125
I]Streptavidin at
2ngÆmL
)1
at 4 °C for 30 min. After four washes with cold
NaCl/P
i

, cells were trypsinized, collected, and the cell-
associated radioactivity, corresponding to receptor-Ig com-
plexes present at the cell surface, was measured using a
c-counter [30]. Experiments were performed at least three
times in duplicate.
Normalization of cAMP accumulation to cell-surface
expression
Basal cAMP accumulation was normalized to cell surface
expression for wild-type, b1, M453T and b1-M453T
receptors. For that purpose, the receptor-dependent
cAMP accumulation (in nmolÆL
)1
) was divided by the
radioactivity measured (in c.p.m.), corresponding to cell
surface receptor-biotinylated Ig complexes, revealed by
[
125
I]Streptavidin: (cAMP in receptor-transfected cells –
cAMP in control pSG5-transfected cells)/(binding of
receptor-transfected cells – binding of the control pSG5-
transfected cells). The values (relative constitutive activities)
3488 M. Quellari et al. (Eur. J. Biochem. 270) Ó FEBS 2003
were then normalized to the value of the specific consti-
tutive activity of the wild-type TSHR, arbitrarily set to 1
[29,33].
Internalization and recycling of receptor-Ig complexes
L cell lines stably expressing the wild-type and the b1, the
M453T and the b1-M453T receptors were obtained using
the calcium phosphate precipitation method and main-
tained as described [10]. Internalization of receptor-Ig

complexes was measured as described [30]. Briefly, cells
were seeded in six-well plates, and grown overnight. Cells
were washed with incubation medium (DMEM supple-
mented with 0.1% BSA and 20 m
M
Hepes buffer, pH 7.4)
and incubated at room temperature for 15 min, then
cooled 10 min at 4 °C in cold incubation medium. They
were then incubated with 0.25 mL of incubation medium
containing 2 lgÆmL
)1
of biotinylated R5T-34 monoclonal
Ig [30] at 4 °C for 30 min. In some cases, monensin 40 l
M
was added to the incubation medium. Next, after removal
of the unbound Ig, cells were washed three times with
cold incubation medium, once with prewarmed incubation
medium and incubated at 37 °C for various periods of
times. Cells were incubated with 0.4 mL of cold incuba-
tion medium containing [
125
I]Streptavidin at 2 ngÆmL
)1
at
4 °C for 30 min. After four washes with cold NaCl/P
i
,
cells were trypsinized, collected, and the cell-associated
radioactivity was measured using a c-counter [30].
Experiments were performed at least three times in

duplicate.
Statistics
Statistical significance was assessed by the Mann–Whitney
non-parametric test. Results are expressed as means ± SD.
Results
Generation of truncated mutants corresponding either
to b-subunits of the TSHR, or to a receptor deleted
of almost the entire extracellular domain
To understand the role of receptor cleavage and shedding,
we constructed two deletion mutants, corresponding either
to the longest b1 (starting at Ser314) or to the shortest b2
(starting at Leu378) subunit of the TSHR (Fig. 1A).
Fig. 1. Schematic representation of the trun-
cated mutant receptors. (A) Top panel, human
TSHR. The seven transmembrane segments
(TM) are shown in gray and the signal peptide
is colored in black. The percentage of identity
of the different extracellular regions of the
TSHR to the corresponding regions of the
human LH receptor are indicated above.
The E3 region (residues 289–385) is the most
divergent region and E5 the most conserved
one (residues 403–416). The black arrow
indicates the localization of the constitutive
mutation Met453Thr (M453T) in the second
transmembrane segment of the TSHR [31].
The truncated mutant receptors b1, b2,
TM409 starting, respectively, at Ser314,
Leu378 and Glu409 are schematized. Note
that the N-terminus of the b1andb2mutant

receptors originate in the divergent E3 region,
whereas the TM409 mutant receptor is deleted
of both E3 and most of the E5 regions. I,
intracellular domain. (B) Lower panel: West-
ern blot analysis of the receptor mutants
expressedinCOS-7cells.COS-7cellswere
transiently transfected with cDNA encoding
the truncated b1, b2, or TM409 mutant
receptors. Forty-eight hours after transfection,
total cell membrane extracts were prepared
(see Experimental procedures) and run on a
10% polyacrylamide gel. Western blot analy-
ses were performed using the T3-365 mono-
clonal Ig, which recognizes receptor
endodomain. Molecular mass standards, in
kilodaltons (kDa), are indicated on the left.
Lane 1, b1 receptor; lane 2, b2 receptor; lane 3,
TM409 receptor.
Ó FEBS 2003 Role of cleavage and shedding in TSHR function (Eur. J. Biochem. 270) 3489
We studied also a TM409 mutant receptor (starting at
residue Glu409), deleted of 98% of the extracellular region
of the TSHR (Fig. 1A). It lacks the E5 region highly
conserved in gonadotropin and TSH receptors (approxi-
mately 85% of homology with the corresponding part of the
LH receptor). This conserved region is present in the b1and
in the b2 mutant receptors, which contain, respectively, 102
and 38 amino acids of the extracellular domain of the
receptor (Fig. 1A).
Western blot analysis of receptors expressed in COS-7
cells were performed using a monoclonal Ig directed against

the intracellular domain of the receptor. Figure 1B shows
that the truncated receptors are expressed as single mole-
cular weights species, with respective apparent molecular
weights of approximately 52, 40 and 36 kDa.
Effect of deletions corresponding to cleavage and
shedding comparative to a deletion of almost
the whole extracellular domain of the receptor
on its basal activity
COS-7 cells transfected with expression vectors encoding
either the wild-type or the truncated receptors were
incubated with various concentrations of bTSH (0–
10 IUÆL
)1
), and the basal or hormone-induced cAMP levels
were measured (Fig. 2A). Transfection efficiencies were
verified by immunocytochemistry, using the T3-365 mono-
clonal Ig. In addition, total receptor expression was verified
using a cellular ELISA ([28] and see Methods) on per-
meabilized cells. Figure 2B shows a similar total expression
of the wild-type and the truncated b1, b2 and TM409
receptors.
As shown in Fig. 2A, the b1andb2 mutant receptors
displayed a similar approximately 2.5-fold higher total basal
(not normalized) accumulation of cAMP (P <0.01)when
compared with the wild-type receptor. This experiment was
repeated at least three times with similar results.
In contrast, the basal cAMP levels detected in transfected
cells expressing the TM409 mutant receptor were signifi-
cantly lower when compared with cells expressing the wild-
type receptor (P < 0.05) and not significantly different

from the values detected in cells transfected with the pSG5
vector alone. Thus, deletion of almost the entire ectodomain
of the TSHR in the TM409 mutant receptor suppressed the
Fig. 2. cAMP accumulation in COS-7 cells expressing the wild-type or
the truncated mutant receptors. (A) COS-7 cells were transiently
transfected either with the vector alone (pSG5) or with expression
vectors encoding the wild-type (WT) or the truncated b1, b2, and
TM409 receptors. Later (48 h), they were incubated (black bars) or not
(white bars). One hour, 10 IUÆL
)1
of bTSH, and cAMP accumulation
was measured. The data presented are expressed as raw values
(intracellular cAMP accumulation in nmolÆL
)1
), and represent the
mean ± SD of triplicate wells from a representative experiment of
three independent experiments. The following P-values were calculated
for total basal cAMP accumulation, when compared with the wild-
type receptor: b1 receptor, P <0.01;b2 receptor, P <0.05;TM409
receptor, P < 0.05. (B) Cellular ELISA was performed to compare
total cellular expression of the different constructs. Briefly, COS-7 cells
were transiently transfected either with the vector alone (pSG5) or the
wild-type, b1, b2, and TM 409 mutant receptors. Forty-eight hours
later, they were fixed, permeabilized and incubated with the T3-365
monoclonal Ig that recognizes an intracellular epitope of the TSHR.
After incubation with a peroxidase-conjugated sheep anti-(mouse
IgG), then with ABTS, OD was read at 450 nm. (C) Dose–response to
TSH of the wild-type, b1, b2 and TM409 receptors. COS-7 cells were
transiently transfected either with the pSG5 vector alone (·)orwith
expression vectors encoding the wild-type (WT, j) or the truncated b1

(h), b2(r), and TM409 (s) receptors. Forty-eight hours later, they
were incubated for 1 h with 0–100 IUÆL
)1
of bTSH, and cAMP
accumulation was measured. The data presented are expressed as raw
values (intracellular cAMP accumulation in nmolÆL
)1
), and represent
the mean ± SD of triplicate wells from a representative experiment.
3490 M. Quellari et al. (Eur. J. Biochem. 270) Ó FEBS 2003
basal constitutive activity detected for the wild-type
receptor.
In all cases, incubation of cells transfected with expression
vectors encoding the truncated b1, b2orTM409mutants
with bTSH (0.1, 1, 10 or 100 IUÆL
)1
), did not enhance the
accumulation of cAMP (Fig. 2C), contrary to the wild-type
receptor.
Cell-surface expression of the TM409 mutant receptor
As the TM409 mutant exhibited a complete loss in receptor
function, we also verified the cell surface expression of this
truncated receptor, comparatively to the wild-type receptor.
For that purpose, we performed indirect immunofluores-
cence using a T3-365 monoclonal Ig directed against the
intracellular domain of the receptor. Cell surface expression
was observed using confocal microscopy and the Nomarski
differential interference contrast. As shown in Fig. 3A (top
panel), in COS-7 cells expressing the wild-type receptor,
staining is observed at the cell surface at the leading edge of

lamellipodia, as previously described [22]. An intracellular
staining of the cells is also observed, probably correspond-
ing to the precursor protein that has been shown to
accumulate in the endoplasmic reticulum [10]. For cells
expressing the TM409 receptor, staining was also observed
at the leading edge of lamellipodia, showing that receptor
molecules are indeed present at the cell surface (Fig. 3A,
lower panel). However, receptors also accumulate inside the
cell, showing that some TM409 receptor molecules are also
trapped intracellularly.
DIC (Fig. 3B) analysis merged with the fluorescence
(Fig. 3C) allowed confirmation of cell surface expression of
thewild-typeandtheTM409receptors.
Specific basal cAMP-stimulating activity
of the wild-type and the b1 mutant receptors
To precisely quantify the enhancement in receptor activity,
we compared the cell surface expression of the wild-type and
the b1 mutant receptors. For this purpose, we used in both
cases the same biotinylated R5T-34 anti-TSHR monoclonal
Ig, as described [30]. Indeed, this Ig has previously been used
to study the intracellular traffic of the wild-type TSHR, by
monitoring the disappearance of cell surface associated
receptor-Ig complexes. This Ig recognizes an epitope
localized between amino acids 357 and 369 [15], in the E3
specific region of the receptor. It does not interfere with
receptor function and trafficking ([30], and data not shown).
Measurement of the R5T-34 monoclonal Ig binding is thus
a convenient tool with which to trace and quantify the cell
surface expression of the receptors. To quantify the cell
surface expression of the b1 mutant receptor, comparatively

to the wild-type receptor, COS-7 cells were transfected with
each expression vector and incubated at 4 °Cwiththe
Fig. 3. Confocal microscopy of COS-7 cells expressing either the wild-type or the TM409 receptors. Transfected cells were fixed, permeabilized,
incubated with the T3-365 monoclonal Ig that recognizes an intracellular epitope of the TSHR, and indirect immunofluorescence was performed
(see Experimental procedures). Top panel, wild-type TSHR (WT); lower panel, TM409 receptor. (A) Confocal microscopy study; (B) Nomarski
optics was used to study cell morphology; (C) fluorescence image was overlaid on Nomarski image to generate merged image.
Ó FEBS 2003 Role of cleavage and shedding in TSHR function (Eur. J. Biochem. 270) 3491
biotinylated R5T-34 anti-TSHR Ig during 30 min. After
washing the cells, the concentration of receptor-Ig com-
plexes at the cell surface was quantified by measuring the
binding of [
125
I]Streptavidin [30]. No Ig binding was
observed in cells transfected with the vector alone (Fig. 4B).
As shown in Fig. 4B, quantification of cell surface
expression of COS-7 cells expressing the b1 mutant receptor
revealed an approximate threefold decrease in cell surface
expression when compared with the wild-type receptor.
Therefore, the increase in the specific constitutive activity of
the b1 receptor, after normalization to cell surface expres-
sion, is at least approximately eightfold (mean of three
independent experiments, including the data presented in
Fig. 2A, see also Fig. 4C).
Increased basal internalization of the b1
mutant receptor
A decreased cell surface expression of the b1mutant
receptor was observed when compared with the wild-type
receptor (Fig. 4B). We wondered whether shedding of the
ectodomain would modify the trafficking of the receptor.
Therefore, we studied the comparative internalization of the

wild-type and of the b1 receptors, using the R5T-34 anti-
TSHR monoclonal Ig, as previously described [30].
L cell lines expressing the wild-type or the b1mutant
receptors were incubated at 4 °C with the Ig in the presence
or in the absence of bTSH. After washing the unbound Ig, the
cells were incubated for different periods of times (0–60 min)
at 37 °C. The concentration of the biotinylated Ig remaining
on the cell surface was then quantified by measuring the
binding of [
125
I]Streptavidin. In the absence of bTSH, a very
weak internalization of the TSHR is detected (approximately
10%) ([30] and data not shown). In the presence of bTSH,
approximately 30% of the wild-type receptor molecules are
internalized after 15 min ([30] and Fig. 5). As previously
described [30], the majority (approximately 90%) of receptor
molecules were recycled back to the cell surface after 30 min.
Incubation with monensin confirmed that the recovery of
cell surface receptors was the result of receptor recycling.
For the b1 mutant receptor, there was a marked
constitutive internalization of the receptor. Indeed approxi-
mately 45% of the receptor molecules were internalized
after 15 min, in the absence of hormone. Furthermore, no
recycling of the b1 mutant receptor was detected even after
incubation for 60 min at 37 °C. Addition of bTSH or
monensin did not modify the intracellular traffic of the b1
mutant receptor (data not shown). The traffic of the b1
mutant receptor was similar to the traffic observed for the
wild-type TSHR in the presence of bTSH and monensin
(Fig. 5).

Effect of cleavage and shedding on a constitutively
activated receptor
Natural point mutations of the TSHR have been described
in familial hyperthyroidism or toxic adenomas [7,34,35].
These mutations are mainly located in the transmembrane
domain of the receptor and lead to a constitutive activation
of the receptor.
We evaluated the functional consequences of receptor
shedding in a mutant harboring a constitutive natural
Fig. 4. Specific constitutive activity of the wild-type and the truncated b1
receptors. (A) Total basal cAMP accumulation was measured in
COS-7 cells transfected with the control pSG5 expression vector or
vectors encoding the wild-type (WT) and the b1 mutant receptors. The
data are expressed as raw values (intracellular cAMP accumulation in
nmolÆL
)1
)andrepresentthemean±SDoftriplicatewellsfroma
representative experiment of three independent experiments. (B)
Quantification of receptor-bound Ig complexes was performed using
R5T-34 monoclonal Ig as described [30]. Briefly, transfected cells were
incubated at 4 °C with the biotinylated R5T-34 Ig. The receptor-Ig
complexes present at the cell surface were quantified using
[
125
I]Streptavidin. The data, expressed in percentage of cell surface
expression, represent the mean ± SD of triplicate wells from a rep-
resentative experiment of three independent experiments. (C) Relative
specific constitutive activity of the wild-type TSHR (WT) (arbitrarily
setto1)andoftheb1 mutant receptor: normalization of cAMP
accumulation to cell-surface expression was performed (see Experi-

mental procedures). Presented data are the mean ± SD of three
independent experiments.
3492 M. Quellari et al. (Eur. J. Biochem. 270) Ó FEBS 2003
transmembrane mutation M453T (M453T-TSHR) [31]. To
discover whether the deletion of the ectodomain would
cause an additional increase in receptor function, we
constructed two supplementary mutant receptors b1-
M453T and b2-M453T, corresponding, respectively, to
shed M453T-TSHR after cleavage at the most N- or
C-terminal sites (Fig. 1). We also constructed a TM409-
M453T mutant deleted of almost the entire extracellular
domain of the receptor.
To study comparative receptor activity, COS-7 cells were
transfected with expression vectors encoding the wild-type
or the mutant receptors. As shown in Fig. 6, the M453T
mutant receptor exhibited an approximately sevenfold
increase in basal cAMP accumulation, when compared
with the wild-type receptor, as described previously [31].
COS-7 cells expressing the truncated b1-M453T and b2-
M453T mutant receptors displayed a similar approximately
twofold higher total basal accumulation of cAMP
(P < 0.01 and P <0.05 for b1-M453T and b2-M453T,
respectively) when compared with the wild-type receptor
(Fig. 6). However COS-7 cells expressing the truncated
TM409-M453T exhibited cAMP accumulation that did not
differ significantly from cells transfected with the pSG5
vector alone.
In all cases, incubation of COS-7 cells expressing the
truncated b1, b2 or TM409-M453T mutant receptors with
bTSH (10 IUÆL

)1
) did not enhance the accumulation of
cAMP (Fig. 6).
When the cell surface expression of the wild-type, the
M453T and the b1-M453T truncated receptors was studied
using the R5T-34 anti-TSHR monoclonal Ig, a diminished
expression of the M453T receptor at the cell membrane of
approximately 1.7-fold when compared with the wild-type
receptor was observed (Fig. 7B). Its normalized constitutive
activity is thus increased at least approximately eightfold
(mean of three independent experiments), when compared
with the wild-type receptor. Likewise, the expression of the
truncated b1-M453T mutant receptor was strongly reduced
by 7.7-fold (Fig. 7B), and thus the specific constitutive
activity is increased by at least approximately fourfold,
when compared with the M453T receptor (Fig. 7C).
Increased basal internalization of the M453T receptor,
further enhanced by deletion of its ectodomain
We also studied the trafficking of the constitutive M453T
receptor, which also exhibited a diminished cell surface
expression. Therefore, we established
L
-cell lines expressing
either the M453T holoreceptor or the truncated b1-M453T
mutant receptor.
As shown in Fig. 8, in the absence of hormone, the
constitutive M453T receptor exhibited an increased basal
internalization when compared with the wild-type receptor,
with approximately 40% of receptor molecules being
internalized after 20 min at 37 °C, and approximately

50% after 60 min. Addition of bTSH did not significantly
enhance the internalization of the M453T mutant receptor
(data not shown). However, no recycling was detected in the
absence or in the presence of TSH, even after longer time
Fig. 6. cAMP accumulation in COS-7 cells expressing a constitutively
activated M453T receptor and the corresponding truncated M453T
mutant receptors. COS-7 cells were transiently transfected either with
the vector alone (pSG5) or with expression vectors encoding the wild-
type (WT), the M453T, and the truncated b1-M453T, b2-M453T,
TM409-M453T mutant receptors. Forty-eight hours later, they were
incubated (black bars) or not (white bars) 1 h with 10 IUÆL
)1
of bTSH,
and cAMP accumulation was measured. The data presented are
expressed as raw values (intracellular cAMP accumulation in
nmolÆL
)1
)andrepresentthemean±SDoftriplicatewellsfroma
representative experiment of three independent experiments. The fol-
lowing P-values were calculated for basal cAMP accumulation, when
compared with the wild-type receptor: M453T receptor, P <0.01;b1-
M453T receptor, P <0.01;b2-M453T receptor, P < 0.05; TM409-
M453T receptor, P < 0.05].
Fig. 5. Internalization of the wild-type and the truncated b1 mutant
receptors. L cells stably transfected with expression vectors encoding
either the wild-type or the truncated b1(j) receptors were incubated
with biotinylated R5T-34 monoclonal Ig. For cells expressing the wild-
type receptor, bTSH (10 IUÆL
)1
)(s) or bTSH + monensin (40 l

M
)
(m) were also added to the incubation medium. After removal of
unbound Ig, cells were incubated for the indicated times at 37 °C.
Surface-bound Ig was quantified as described [30] by measuring the
binding of [
125
I]Streptavidin. Specific binding at each point was nor-
malized with reference to specific binding before the incubation at
37 °C (0-min point) to derive the fraction of initial total receptor-Ig
complexes remaining at the cell surface. Bars, SD of duplicate points.
The assay shown is representative of an experiment repeated at least
three times.
Ó FEBS 2003 Role of cleavage and shedding in TSHR function (Eur. J. Biochem. 270) 3493
periods up to 120 min. In keeping with this observation,
incubation with monensin did not modify the trafficking of
the receptor (Fig. 8).
Deletion of the ectodomain of the receptor (b1-M453T
mutant receptor) led to a supplementary increase in the
basal internalization, approximately 50% of receptor mole-
cules being internalized after 15 min, and approximately
70% after 60 min (Fig. 8). No receptor recycling was
observed. bTSH and monensin had no effect on the
intracellular traffic of the mutant receptor (data not shown).
Discussion
In this study, we focused on the role of TSHR cleavage and
shedding, by constructing mutant receptors corresponding
to the longest (b1) and shortest (b2) b-subunits that we had
previously mapped in thyroid and L cells [15]. Altogether,
our results show that mutants corresponding to cleaved and

shed receptors (at the most N- or C-terminal sites) display
an increased constitutive activation of the corresponding
b-subunits of the TSHR. By contrast, a mutant receptor
lacking almost the entire extracellular domain of the TSHR
(TM409 mutant) including the highly conserved region
close to the membrane, exhibited a complete loss in receptor
function. Thus we extend previous studies which support a
role for the extracellular domain in the stabilization of an
inactive form of the unliganded receptor [29]. Indeed, only
cleavage in the E3 domain of the receptor, followed by
receptor shedding, can enhance receptor activity. Recently,
Chen et al. reported that TSHR cleavage, by itself, was
insufficient to enhance ligand-independent constitutive
activity [36]. The complete loss of the extracellular domain
yields a complete loss in receptor function. This observation
is in agreement with previous data, which highlighted a role
for the conserved E5 region, close to the transmembrane
domain, in TSH or LH receptor function [37–39]. It was
proposed that this invariant sequence in the glycoprotein
hormone receptors is required for proper folding, trafficking
and ligand-mediated signaling but not for ligand binding
[37,40]. The complete loss in the constitutive activity of the
Fig. 8. Internalization of the wild-type, M453T and truncated
b1-M453T mutant receptors. L cells stably transfected with expression
vectors encoding either the wild-type (s), the M453T receptor (j)or
the b1-M453T (d) receptors were incubated with biotinylated R5T-34
monoclonal Ig. For cells expressing the M453T receptor, monensin
(40 l
M
) was also added to the incubation medium (m). After removal

of unbound Ig, cells were incubated for the indicated times at 37 °C.
Surface-bound Ig was quantified as described ([30] and see Fig. 7) by
measuring the binding of [
125
I]Streptavidin. Bars, SD of duplicate
points. The assay shown is representative of an experiment repeated at
least three times.
Fig. 7. Specific constitutive activity of the wild-type, M453T and
b1-M453T receptors. (A) Total basal cAMP accumulation was meas-
ured in COS-7 cells transfected with the control pSG5 expression
vector or vectors encoding the wild-type (WT), M453T and b1-M453T
receptors. The data are expressed as raw values (intracellular cAMP
accumulation in nmolÆL
)1
)andrepresentthemean±SDoftriplicate
wells from a representative experiment of three independent experi-
ments. (B) Quantification of receptor-bound Ig complexes was per-
formed using R5T-34 monoclonal Ig as described [30], and see Fig. 4.
The data, expressed in percentage of cell surface expression, represent
the mean ± SD of triplicate wells from a representative experiment of
three independent experiments. (C) Relative specific constitutive
activity of wild-type (WT) (arbitrarily set to 1), M453T and b1-M453T
receptors: normalization of cAMP production to cell-surface expres-
sion was performed (see Experimental procedures). Presented data are
the mean ± SD of three independent experiments.
3494 M. Quellari et al. (Eur. J. Biochem. 270) Ó FEBS 2003
M453T receptor, when this region is deleted (TM409-
M453T receptor), also strongly supports a role for this
juxtamembrane region in receptor function and cell surface
targeting. We could detect the presence of the TM409

truncated receptor at the cell surface by confocal micros-
copy. However some mutant receptor molecules also
accumulate inside the cell.
We could not reproduce the results obtained by Zhang
et al. [28] with a mutant receptor E409, similar to our
TM409 mutant, but also including a hemagglutinin (HA)
tag sequence. This group detected a basal activity three
times higher (not normalized) when compared with the
wild-type TSHR. Vlaeminck-Guillem et al. [29] have also
constructed truncated mutants devoid of almost the entire
extracellular domain of the receptor, and all including a
rhodopsine tag localized at the N-terminus to improve and
quantify cell surface expression. However, the addition of
this tag led to a marked increase in the apparent molecular
weight of the TSHR (approximately 40 kDa), due to the
introduction of a supplementary glycosylation site [29].
Modification of the structure of the receptor might be
responsible for the increased activity detected for such
truncated receptors. The same group has found that a
truncated mutant containing five amino acids of the
extracellular domain and devoid of any tag was not
functional [27], while a mutant containing four amino acids
of the ectodomain and including a rhodopsine tag was
found constitutively activated [29]. In agreement with our
results, previous mutations or deletions within the E5
highly conserved region yielded a loss in receptor activity
[37,38].
Deletion of receptor ectodomain yielded a diminished
expression of the b1 receptor at the cell surface. We thus
studied b1 receptor trafficking. While the unliganded

wild-type TSHR exhibited a very limited basal internal-
ization [30], deletion of the ectodomain in the b1 receptor
led to a marked increased basal internalization of the
receptor. Thus, the extracellular domain of the TSHR
negatively modulates receptor internalization probably
through a conformational change transmitted to the
b-subunit of the receptor. Deletion of the ectodomain, or
addition of TSH, relieves constrained conformations and
increases internalization. As the b1 mutant is constitu-
tively activated, this observation suggests a link between
the conformations necessary for receptor activation and
for internalization. A similar situation has been described
for other G protein-coupled receptors [41]. However, no
recycling was observed for the b1 receptor. Its intracel-
lular traffic is very similar to the one of the wild-type
receptor activated by TSH, but in the presence of
monensin, which inhibits the recycling. This observation
strongly argues for a different conformation between the
receptor activated by cleavage and shedding on the one
hand, and the receptor activated by the ligand on the
other hand. This may be due to different post-transla-
tional maturation of the receptors, leading to different
conformations of the sequence(s) implicated in the
recycling of the receptor.
The TSHR can also be activated by natural constitutive
point mutations found mainly in the transmembrane
domain of the receptor [7,34,35]. The current hypothesis
maintains that constitutively activated receptors release the
conformational constraints of the GPCR inactive state that
normally keep the ligand-free receptor silent. Therefore, we

wondered whether shedding of the ectodomain of receptors
already activated by such a mutation, M453T [31], would
lead to a supplementary activation of the corresponding
b-subunits.
Accordingly, cleavage and shedding of the M453T
mutant receptor further increase its activity. Our results
show that the extracellular domain still exerted a negative
effect on the receptor already constitutively activated
by a transmembrane point mutation. This inhibition
may be released in part by the hormone, as TSH still
up-regulates to some extent the activity of the M453T
receptor, or by receptor shedding. Deletion of the
ectodomain of other constitutively active mutants (muta-
tion D633A located in the sixth transmembrane segment,
or A623I in the third intracellular loop of the receptor)
did not yield a supplementary increase in receptor activity
[29].
Some constitutively activated GPCRs have been shown
to be constitutively internalized [41–43]. Therefore, we
studied the intracellular trafficking of receptors constitu-
tively activated by a transmembrane point mutation.
Accordingly, the activated M453T receptor exhibited a
marked enhanced constitutive internalization when com-
pared with the wild-type receptor. The underlying
molecular mechanism that drives the rapid internalization
of a constitutive receptor is not understood, but a link
between the active conformation and the conformation
necessary for receptor internalization has been already
proposed [41]. For the LH receptor, the increased
internalization has been proposed to be linked to receptor

phosphorylation and/or interaction with arrestins, or due
to an easier clustering of the activated receptors in coated
pits [44].
It has to be noted that in the case of the M453T mutant
receptor, contrary to the wild-type receptor, no recycling
was observed. This was confirmed by the use of monensin,
which did not modify the trafficking of this mutated
receptor.
These observations strongly suggest a difference in the
conformation of the M453T receptor when compared with
the hormone-activated receptor.
Deletion of the ectodomain of the M453T receptor,
mimicking receptor shedding, led to a supplementary
increase in receptor internalization, indicating probably a
supplementary change in receptor conformation. It has been
proposed that each function of the receptor (G protein
coupling, internalization, recycling) is not triggered by only
one well-defined conformation, but by a continuum of
independent conformations [41,45].
In conclusion, cleavage and shedding yield TSHR
activation but also increase receptor downregulation
through an increased internalization of the b-subunits
of the receptor, the latter mechanism limiting simulta-
neously excessive receptor signaling. The combined effects
may be responsible for the limited basal constitutive
activation of the cAMP pathway that is detected for the
TSHR.
Further studies are necessary to discover whether the
shedding may be regulated [46], which might be a novel way
to modulate receptor activity.

Ó FEBS 2003 Role of cleavage and shedding in TSHR function (Eur. J. Biochem. 270) 3495
Acknowledgments
This work was supported by the INSERM (Institut National de la
Sante
´
et de la Recherche Me
´
dicale), the Fondation pour la Recherche
Me
´
dicale Franc¸ aise, the Association pour la Recherche sur le Cancer
and the University Paris XI. M.Q. is a recipient of a grant from the
Ministe
`
re de l’Education Nationale, de la Recherche et de la
Technologie.
We thank Marie-The
´
re
`
se Groyer-Picard for excellent technical
assistance, C. Pichon for producing monoclonal antibodies, L. Outin
for graphic assistance (Service commun de photographie, IFR 93),
Vale
´
rie Nicolas for confocal microscopy (Service de microscopie
confocale, IFR75) and S. Guerroui for statistical analysis.
References
1. Vassart, G. & Dumont, J.E. (1992) The thyrotropin receptor and
the regulation of thyrocyte function and growth. Endocrinol. Rev.

13, 596–611.
2. Misrahi, M. & Milgrom, E. (1997) The TSH receptor. In Phar-
macotherapeutics of the Thyroid Gland (Weetman, A.P. & Gross-
man, A., eds), Vol. 128, pp. 33–73. Springer-Verlag, Berlin.
3. Rapoport, B., Chazenbalk, G.D., Jaume, J.C. & McLachlan, S.M.
(1998) The thyrotropin (TSH) receptor: interaction with TSH and
autoantibodies. Endocrinol. Rev. 19, 673–716.
4. Rees-Smith, B., McLachlan, S.M. & Furmaniak, J. (1988) Auto-
antibodies to the thyrotropin receptor. Endocrinol. Rev. 9,
106–121.
5. McGregor, A.M. (1990) Autoantibodies to the TSH receptor in
patients with autoimmune thyroid disease. Clin. Endocrinol. 33,
683–685.
6. Ascoli, M., Fanelli, F. & Segaloff, D.L. (2002) The lutropin/
choriogonadotropin receptor, a 2002 perspective. Endocrinol. Rev.
23, 141–174.
7. Vassart, G., Parma, J., Van Sande, J. & Dumont, J.E. (1994) The
thyrotropin receptor and the regulation of thyrocyte function and
growth: update 1994. Endocrinol. Rev. 3, 77–80.
8. Rees-Smith, B. & Furmaniak, J. (1990) Structural analysis of the
TSH receptor. Horm. Metab. Res. Suppl. 23, 28–32.
9. Loosfelt, H., Pichon, C., Jolivet, A., Misrahi, M., Caillou, B.,
Jamous, M., Vannier, B. & Milgrom, E. (1992) Two-subunit
structure of the human thyrotropin receptor. Proc. Natl Acad. Sci.
USA 59, 3765–3769.
10. Misrahi,M.,Ghinea,N.,Sar,S.,Saunier,B.,Jolivet,A.,Loosfelt,
H., Cerutti, M., Devauchelle, G. & Milgrom, E. (1994) Processing
of the precursors of the human thyroid-stimulating hormone
receptor in various eukaryotic cells (human thyrocytes, transfected
L cells and baculovirus-infected insect cells). Eur. J. Biochem. 222,

711–719.
11.Couet,J.,Sar,S.,Jolivet,A.,Hai,M T.V.,Milgrom,E.&
Misrahi, M. (1996) Shedding of human thyrotropin receptor
ectodomain. J. Biol. Chem. 271, 4545–4552.
12. Coue
¨
t,J.,deBernard,S.,Loosfelt,H.,Saunier,B.,Milgrom,E.&
Misrahi, M. (1996) Cell surface protein disulfide-isomerase is
involved in the shedding of human thyrotropin receptor ecto-
domain. Biochemistry 35, 14800–14805.
13. Latif, R., Graves, P. & Davies, T.F. (2001) Oligomerization of the
human thyrotropin receptor: fluorescent protein-tagged hTSHR
reveals post-translational complexes. J. Biol. Chem. 276, 45217–
45224.
14. Chazenbalk, G.D., Tanaka, K., Nagayama, Y., Kakinuma, A.,
Jaume, J.C., McLachlan, S.M. & Rapoport, B. (1997) Evidence
that the thyrotropin receptor ectodomain contains not one, but
two, cleavage sites. Endocrinology 138, 2893–2899.
15. de Bernard, S., Misrahi, M., Huet, J.C., Beau, I., Desroches, A.,
Loosfelt, H., Pichon, C., Pernollet, J.C. & Milgrom, E. (1999)
Sequential cleavage and excision of a segment of the thyrotropin
receptor ectodomain. J. Biol. Chem. 274, 101–107.
16. Graves, P., Pritsker, A. & Davies, T.F. (1999) Post-translational
processing of the natural human thyrotropin receptor: demon-
stration of more than two cleavage sites. J. Clin. Endocrinol.
Metab. 84, 2177–2181.
17. Tanaka, K., Chazenbalk, G.D., McLachlan, S.M. & Rapoport, B.
(1999) Subunit structure of thyrotropin receptors expressed on
the cell surface. J. Biol. Chem. 274, 33979–33984.
18. Blobel, C.P. (2000) Remarkable roles of proteolysis on and

beyond the cell surface. Curr. Opin. Cell Biol. 12, 606–612.
19. Davies Jones, E. & Rees-Smith, B. (1984) A water-soluble frag-
ment of the thyroid-stimulating hormone receptor which binds
both thyroid-stimulating hormone and thyroid-stimulating hor-
mone receptor antibodies. J. Endocrinol. 100, 113–118.
20. Murakami, M., Miyashita, K., Yamada, M., Iriuchijima, T. &
Mori, M. (1992) Characterization of human thyrotropin receptor-
related peptide-like immunoreactivity in peripheral blood of
Graves’ disease. Biochem. Biophys. Res. Commun. 186, 1074–1080.
21. Hunt, N., Willey, K.P., Jahner, D., Ivell, R., Northemann, W.,
Castel, M.A. & Leidenberger, F. (1992) Multiple forms of thyroid
stimulating hormone receptor associated with Graves’ disease.
Exp. Clin. Endocrinol. 100, 22–27.
22. Ghinea, N., Baratti-Elbaz, C., de Jesus-Lucas, A. & Milgrom, E.
(2002) TSH receptor interaction with the extracellular matrix: role
on constitutive activity and sensitivity to hormonal stimulation.
Mol. Endocrinol. 16, 912–923.
23. Kakinuma, A., Chazenbalk, G.D., Tanaka, K., Nagayama, Y.,
McLachlan, S.M. & Rapoport, B. (1997) An N-linked glycosyla-
tion motif from the noncleaving luteinizing hormone receptor
substituted for the homologous region (Gly367 to Glu369) of the
thyrotropin receptor prevents cleavage at its second, downstream
site. J. Biol. Chem. 272, 28296–28300.
24. Tanaka, K., Chazenbalk, G.D., McLachlan, S.M. & Rapoport, B.
(1998) Thyrotropin receptor cleavage at site 1 does not involve a
specific amino acid motif but instead depends on the presence of
the unique, 50 amino acid insertion. J. Biol. Chem. 273, 1959–
1963.
25. Tanaka, K., Chazenbalk, G.D., McLachlan, S.M. & Rapoport, B.
(1999) Thyrotropin receptor cleavage at site 1 involves two dis-

continuous segments at each end of the unique 50-amino acid
insertion. J. Biol. Chem. 274, 2093–2096.
26. Chazenbalk, G.D., Tanaka, K., McLachlan, S.M. & Rapoport, B.
(1999) On the functional importance of thyrotropin receptor
intramolecular cleavage. Endocrinology 140, 4516–4520.
27. Paschke, R., Parmentier, M. & Vassart, G. (1994) Importance of
the extracellular domain of the human thyrotrophin receptor for
activation of cyclic AMP production. J. Mol. Endocrinol. 13,
199–207.
28. Zhang,M.,Tong,K.P.,Fremont,V.,Chen,J.,Narayan,P.,Puett,
D., Weintraub, B.D. & Szkudlinski, M.W. (2000) The extra-
cellular domain suppresses constitutive activity of the transmem-
brane domain of the human TSH receptor: implications for
hormone–receptor interaction and antagonist design. Endocrino-
logy 141, 3514–3517.
29.Vlaeminck-Guillem,V.,Ho,S.C.,Rodien,P.,Vassart,G.&
Costagliola, S. (2002) Activation of the cAMP pathway by the
TSH receptor involves switching of the ectodomain from a teth-
ered inverse agonist to an agonist. Mol. Endocrinol. 16, 736–746.
30. Baratti-Elbaz, C., Ghinea, N., Lahuna, O., Loosfelt, H., Pichon,
C. & Milgrom, E. (1999) Internalization and recycling pathways of
the thyrotropin receptor. Mol. Endocrinol. 13, 1751–1765.
31.deRoux,N.,Polak,M.,Couet,J.,Leger,J.,Czernichow,P.,
Milgrom, E. & Misrahi, M. (1996) A neomutation of the thyroid-
stimulating hormone receptor in a severe neonatal hyperthyroid-
ism. J. Clin. Endocrinol. Metab. 81, 2023–2026.
3496 M. Quellari et al. (Eur. J. Biochem. 270) Ó FEBS 2003
32. Lee, A., Chow, D., Haus, B., Tseng, W., Evans, D., Fleiszig, S.,
Chandy, G. & Machen, T. (1999) Airway epithelial tight junctions
and binding and cytotoxicity of Pseudomonas aeruginosa. Am. J.

Physiol. 277, 204–217.
33. Nishi, S., Nakabayashi, K., Kobilka, B. & Hsueh, A.J.W. (2002)
The ectodomain of the luteinizing hormone receptor interacts with
exoloop 2 to constrain the transmembrane region. J. Biol. Chem.
277, 3958–3964.
34. Wonerow, P., Neumann, S., Gudermann, T. & Paschke, R. (2001)
Thyrotropin receptor mutations as a tool to understand thyro-
tropin receptor action. J. Mol. Med. 79, 707–721.
35. Farid, N.R., Kascur, V. & Balazs, C. (2000) The human thyro-
tropin receptor is highly mutable: a review of gain-of-function
mutations. Eur. J. Endocrinol. 143, 25–30.
36. Chen, C.R., Chazenbalk, G.D., McLachlan, S.M. & Rapoport, B.
(2003) Targeted restoration of cleavage in a noncleaving thyro-
tropin receptor demonstrates that cleavage is insufficient to
enhance ligand-independent activity. Endocrinology 144, 1324–
1330.
37. deRoux,N.,Misrahi,M.,Brauner,R.,Houang,M.,Carel,J.C.,
Boumedienne, A., Toublanc, J.E. & Milgrom, E. (1996) Four
families with loss of function mutations of the thyrotropin
receptor. J. Clin. Endocrinol. Metab. 81, 4229–4235.
38. Alvarez, C.A., Narayan, P., Huang, J. & Puett, D. (1999) Char-
acterization of a region of the lutropin receptor extracellular
domain near transmembrane helix 1 that is important in ligand-
mediated signaling. Endocrinology 140, 1775–1782.
39. Szkudlinski, M.W., Fremont, V., Ronin, C. & Weintraub, B.D.
(2002) Thyroid-stimulating hormone and thyroid-stimulating
hormone receptor structure-function relationships. Physiol. Rev.
82, 473–502.
40. Sangkuhl, K., Schulz, A., Schultz, G. & Schoneberg, T. (2002)
Structural requirements for mutational lutropin/choriogonado-

tropin receptor activation. J. Biol. Chem. 277, 47748–47755.
41. Parnot, C., Miserey-Lenkei, S., Bardin, S., Corvol, P. & Clauser,
E. (2002) Lessons from constitutively active mutants of G protein-
coupled receptors. Trends Endocrinol. Metab. 13, 336–343.
42.Whistler,J.L.,Gerber,B.O.,Meng,E.C.,Baranski,T.J.,von
Zastrow, M. & Bourne, H.R. (2002) Constitutive activation and
endocytosis of the complement factor receptor: evidence for
multiple activated conformations of a G protein-coupled receptor.
Traffic 12, 866–877.
43. Miserey-Lenkei, S., Parnot, C., Bardin, S., Corvol, P. & Clauser,
E. (2001) Constitutive internalization of constitutively active
angiotensin II AT
1A
receptor mutants is blocked by inverse
agonists. J. Biol. Chem. 277, 5891–5901.
44. Bradbury, F.A. & Menon, K.M.J. (1999) Evidence that con-
stitutively active luteinizing hormone/human chorionic gonado-
tropin receptors are rapidly internalized. Biochemistry 38, 8703–
8712.
45. Thomas, W.G., Qian, H., Chang, C S. & Karnik, S. (2000)
Agonist-induced phosphorylation of the angiotensin II (AT1A)
receptor requires generation of a conformation that is distinct
from the inositol phosphate-signaling state. J. Biol. Chem. 275,
2893–2900.
46. Turano,C.,Coppari,S.,Altieri,F.&Ferraro,A.(2002)Proteins
of the PDI family: unpredicted non-ER locations and functions.
J. Cell. Physiol. 193, 154–163.
Ó FEBS 2003 Role of cleavage and shedding in TSHR function (Eur. J. Biochem. 270) 3497