Tải bản đầy đủ (.docx) (83 trang)

BÁO cáo KHOÁ LUẬN tốt NGHIỆP đề tài NGHIÊN cứu THIẾT lập DÒNG cá NGỰA vằn KNOCKOUT GENE NRF2 PHỤC vụ NGHIÊN cứu OXY hóa

Bạn đang xem bản rút gọn của tài liệu. Xem và tải ngay bản đầy đủ của tài liệu tại đây (3.22 MB, 83 trang )

BỘ GIÁO DỤC VÀ ĐÀO TẠO
TRƯỜNG ĐẠI HỌC VĂN HIẾN
KHOA KỸ THUẬT – CƠNG NGHỆ

BÁO CÁO KHỐ LUẬN
TỐT NGHIỆP

ĐỀ TÀI: NGHIÊN CỨU THIẾT LẬP DÒNG CÁ NGỰA VẰN
KNOCKOUT GENE NRF2 PHỤC VỤ NGHIÊN CỨU OXY HĨA

TP. HỒ CHÍ MINH – 2022
Chương 1 – Tổng quan

TIEU LUAN MOI download : skknchat123@gmail.com


BỘ GIÁO DỤC VÀ ĐÀO TẠO
TRƯỜNG ĐẠI HỌC VĂN HIẾN
KHOA KỸ THUẬT – CƠNG NGHỆ

BÁO CÁO KHỐ LUẬN
TỐT NGHIỆP

ĐỀ TÀI: NGHIÊN CỨU THIẾT LẬP DÒNG CÁ NGỰA VẰN
KNOCKOUT GENE NRF2 PHỤC VỤ NGHIÊN CỨU OXY HĨA

TP. HỒ CHÍ MINH – 2022
Chương 1 – Tổng quan

TIEU LUAN MOI download : skknchat123@gmail.com



i

LỜI CẢM ƠN

Lời đầu tiên, xin trân trọng cảm ơn hai Thầy và Cô đã hướng dẫn em là TS.
Nguyễn, thầy cơ đã tận tình hướng dẫn em trong q trình học tập cũng như trong việc
hồn thành thực tập tốt nghiệp.
Xin chân thành cảm ơn các Thầy, Cô thuộc khoa Kỹ Thuật – Công Nghệ trường
Đại Học Văn Hiến đã tận tình giảng dạy cho em trong thời gian học tập.
Xin cảm ơn Trung tâm Công nghệ Sinh học Thành phố Hồ Chí Minh đã tạo điều
kiện giúp em hồn thành học phần khố luận tốt nghiệp thật tốt.
Tuy vậy, do thời gian có hạn, cũng như cịn nhiều hạn chế về kiến thức và kinh
nghiệm nên sẽ không tránh khỏi những sai sót trong q trình hồn thành báo cáo. Vì
vậy, em rất mong nhận được sự đóng góp ý kiến của TS. Nguyễn để em khắc phục các
thiếu sót của mình và hồn thiện báo cáo khố luận này hơn.
Em xin chân thành cảm ơn!
Tp. Hồ Chí Minh, ngày 26 tháng 4 năm 2022
Sinh viên thực hiện

Nguyễn Văn A

TIEU LUAN MOI download : skknchat123@gmail.com


ii

LỜI CAM ĐOAN

Tơi cam đoan đây là cơng trình nghiên cứu của riêng tôi, do tôi tự thưc hiên, không sao

chép, vay mượn từ các cơng trình nghiên cứu khoa học khác. Đảm bảo mọi tài liệu tham
khảo đều được trích dẫn, ghi chú đầy đủ.
Tp.Hồ Chí Minh, ngày 26 tháng 04 năm 2022
Sinh viên thực hiện

Nguyễn Văn A

TIEU LUAN MOI download : skknchat123@gmail.com


iii

NHẬN XÉT CỦA GIẢNG VIÊN HƯỚNG DẪN

.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................
.............................................................................................................................................

Tp.Hồ Chí Minh, ngày 26 tháng 04 năm
2022
Giảng viên hướng dẫn

TS. Nguyễn


TIEU LUAN MOI download : skknchat123@gmail.com


MỤC LỤC

PHẦN MỞ ĐẦU...............................................................................................................
1. Tính cấp thiết của đề tài........................................................................................
2. Đối tượng nghiên cứu.............................................................................................
3. Nhiệm vụ nghiên cứu.............................................................................................
4. Phương pháp nghiên cứu.......................................................................................
5. Các kết quả đạt được của đề tài............................................................................
6. Kết cấu của khoá luận tốt nghiệp..........................................................................
CHƯƠNG 1 - TỔNG QUAN...........................................................................................

1.1Giới thiệu về kỹ thuật knockout gene................................

1.2Tổng quan về hệ thống CRISPER-Cas9............................
1.3. Định nghĩa về hệ thống keap1-nrf2....................................................................
1.3.1

Lịch sử tiền khám phá Nrf2

1.3.2


Khám phá Nrf2: một phân t

1.3.3

Lịch sử khám phá KEAP1: B

1.3.4 Tổng quan về chức năng của hệ thống phân tử KEAP1-NRF2..................
1.3.5 Cơ chế bảo tồn của hệ thống KEAP1-NRF2 giữa các lồi động vật có
xương sống...............................................................................................................
1.3.6 Cơ chế điều hoà hoạt động của hệ thống KEAP1-NRF2.............................
1.3.7 Chức năng của hệ thống KEAP1-NRF2 cân bằng oxy hoá khử và bảo vệ tế
bào............................................................................................................................

1.4Ứng dụng trị liệu của hệ thống KEAP1-NRF2.................

1.5Hệ thống KEAP1-NRF2 ở cá ngựa vằn.............................

1.6Khả năng thành cơng..........................................................

1.7Tính mới, tính thời sự.........................................................

1.8Ý nghĩa khoa học và sự cần thiết vấn đề cần nghiên cứu

1.9Giới thiệu chung về cá ngựa vằn........................................
1.9.1

Giới thiệu chung...................

1.9.2


Lịch sử phân bố tự nhiên.....

1.9.3

Đặc tính sinh học cơ bản......

1.9.4

Bộ gen cá ngựa vằn...............

CHƯƠNG 2 VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU.................................

2.1Thời gian và địa điểm nghiên cứu......................................


TIEU LUAN MOI download : skknchat123@gmail.com


v

2.2 Vật liệu và hoá chất nghiên cứu.......................................................................... 25
2.3 Phương pháp nghiên cứu..................................................................................... 27
2.3.1 Phương pháp chuẩn bị chuỗi RNA hướng dẫn đơn -single guilde RNA
(sgRNA) và Cas9 mRNA........................................................................................ 27
Vị trí sgRNA Nrf2..................................................................................................... 27
2.3.2

Loại bỏ gen bằng CRISPR-Cas 9 và Phương pháp vi tiêm........................32


Cá ngựa vằn hoang dại AB được sử dụng cho sinh sản để tiến hành loại bỏ gen......32
Đầu tiên chuẩn hóa 10 nmol của 100 bases Alt-R CRISR-Cas9 sgRNA Nrf2 bằng
cách thêm 100 µL nuclease free duplex buffer (IDT) để có nồng độ cuối là 100 µM.
32
Tiếp theo pha loãng Alt-R S.p HiFi Cas9 Nuclease V3, 100 µg (10 µg/µL) (10 µg/µL
Alt-R S.p HiFi Cas9 Nuclease V3 0.5 µL; Cas9 working protein buffer (20 mM
HEPES; 150 mM KCl 7.5 pH) 9.5 µL, để đạt nồng độ cuối 0.5 µg/µL Alt-R S.p HiFi
Cas9 Nuclease V3).................................................................................................... 32
2.4 Xác định kiểu gen................................................................................................. 33
2.4.1 Cắt đuôi cá, tách DNA................................................................................... 34
2.4.2. Chạy PCR mẫu cá F1 Nrf2........................................................................... 36
2.5 GIẢI TRÌNH TỰ.................................................................................................. 41
2.5.1 Tinh sạch mẫu................................................................................................ 41
CHƯƠNG 3KẾT QUẢ VÀ THẢO LUẬN................................................................... 47
3.1 Vi tiêm tạo cá knockout gen................................................................................. 47
3.2 Giải trình tự cá knockout gen keap1b................................................................. 49
3.3 Kết luận.................................................................................................................... 53
TÀI LIỆU THAM KHẢO............................................................................................. 54

TIEU LUAN MOI download : skknchat123@gmail.com


vi

DANH MỤC CÁC BẢNG BIỂU, LƯU ĐỒ, HÌNH
Danh mục hình
Hình 1.1. Spacer, protospacer và PAM. Protospacer là DNA đích; PAM tiếp giáp với
DNA sợi đôi được nhắm mục tiêu. Phần đệm (Spacer) là một phần của RNA dẫn đường
gắn kết với protospacer.......................................................................................................................... 15
Hình 1.2. Chỉnh sửa gen CRISPR-Cas9. Hình thành RNP (bước 1) có thể xảy ra bên

trong tế bào hoặc phịng thí nghiệm. Đầu tiên, CRISPR RNA (crRNA) và CRISPR RNA
chuyển hóa (tracrRNA) kết hợp với nhau, tạo thành RNA dẫn đường (gRNA) hoàn chỉnh.
Tiếp theo, gRNA liên kết với enzyme Cas, tạo thành ribonucleoprotein (RNP). Nếu quá
trình hình thành RNP được thực hiện trên phịng thí nghiệm, thì RNP sau đó phải được
chuyển đến các tế bào. Trong bước 2, gRNA hướng RNP đến mục tiêu bên trong tế bào.
Sau đó mục tiêu được phân tách (bước 3)...................................................................................... 16
Hình 1.3. Các kết quả có thể xảy ra sau khi phân tách DNA bộ gen. Các con đường sửa chữa DNA của tế
bào chẳng hạn như nối kết cuối khơng tương đồng (NHEJ) có thể dẫn đến xóa (deletion), thay đổi trình
tự (changed sequences) và chèn nhỏ (small insertion)................................................................................... 17

Hình 1.4. Sửa chữa theo hướng tương đồng (HDR) có thể kết hợp các trình tự mới vào
DNA bộ gen. Các trình tự nhỏ có thể được thay đổi cho các mục đích chỉnh sửa hoặc sửa
đổi gen (trái), và các trình tự lớn như tồn bộ gen có thể được thêm vào một cách ngẫu
nhiên (phải)..................................................................................................................................................... 18
Hình 1.5. Các dạng gRNA khác nhau được sử dụng để loại bỏ gen. Trong nghiên cứu
này, chúng tôi lựa chọn dạng sgRNA (bao gồm crRNA và tracrRNA). sgRNA có tính bền
và khơng cần ủ nhiệt trước khi chuyển vào phôi cá ngựa vằn..................................................... 20
Hình 1.6. Vị trí PAM và gRNA Cas9. Vị trí PAM nằm trên chuỗi DNA khơng nằm trong
mục tiêu trình tự loại bỏ gen. RNA dẫn đường liên kết với sợi mục tiêu. RNA dẫn đường
trong hình này là RNA dẫn đường hai phần, bao gồm crRNA và tracrRNA......................... 21
Hình 1.7. So sánh hai phần gRNA (A) và sgRNA (B). Cả hai loại gRNA đều có thể được
thêm vào Cas9 để tạo thành Ribonucleoprotein (RNP), sau đó có thể được phân phối đến
các tế bào.......................................................................................................................................................... 22
Hình 1.8. Cơ chế phân tử của hệ thống KEAP1-NRF2 kích hoạt gen mục tiêu NRF2
trong điều kiện căng thẳng........................................................................................................................ 25

TIEU LUAN MOI download : skknchat123@gmail.com


vii


Hình 1.9. Một bản tóm tắt về dư lượng cystein của Keap1. Việc bảo tồn từng cystein
được chỉ định như sau: O: được bảo tồn; ∆: Không được bảo tồn nhưng cysteine tồn tại
ba axit amin; X: không bảo tồn. Các cystein cảm biến được tô màu đỏ, xanh lá cây và
xanh dương. Mm: chuột; Hs: người; Ol: cá medaka; và Dr: cá ngựa vằn............................26
Hình 1.10. Mã Cysteine của phản ứng dựa trên KEAP1 đối với các rối loạn oxy hóa khử
khác nhau. Ba gốc cystein chính, Cys151, Cys273 và Cys288, của KEAP1 chịu trách
nhiệm chính cho các phản ứng đối với nhiều loại electrophile. OA-NO2, axit béo nitro;
4HNE, 4-hydroxynonel............................................................................................................................ 27
Hình 1.11. Các điểm mạnh khi sử dụng mơ hình cá ngựa vằn trong nghiên cứu sinh học
phân tử............................................................................................................................................................ 31
Hình 1.12. Cá ngựa vằn đực và cái..................................................................................................... 34
Hình 1.13. Sự tương quan giữa bộ gen người, gà, chuột và cá ngựa vằn
...........................
Hình 2.1. Hệ thống ni cá và bàn làm việc, thí nghiệm của phịng Cơng nghệ Sinh học
Thủy sản, Trung tâm Cơng nghệ Sinh học TP. Hồ Chí Minh.................................................... 36
Hình 2.2. Vị trí được thế kế ở vị trí Neh2 domain (exon 2) của bộ gen cá ngựa vằn. Biểu
đồ được tạo bằng phần mềm Snapgen 2.3.2..................................................................................... 39
Hình 2.3. Trang web (http://chopchop.cbu.uib.no) hỗ trợ thiết kế vị trí các chuỗi RNA
hướng dẫn đơn (sgRNA) của gen Nrf2 ở cá ngựa vằn. Cụ thể, nhập tên gen (trong nghiên
cứu này là gen nfe2l2a) vào mục “Target”, bấm chọn Danio rerio (danRer11/GEC11) ở
mục “In”. Tiếp theo chọn CRISPR/Cas9 ở mục “Using” và knockout ở mục “For”. Cuối
cùng bấm vào nút giữa cuối cùng “Find Target Sites”................................................................. 40
Hình 2.4. Vị trí sgRNA nfe2l2a (Nrf2) cá ngựa vằn được thiết kế từ
http://chopchop.cbu.uib.no/.
Rank: 1 với trình tự mục tiêu: TGGATCTGATCGATATCCTGTGG được lựa chọn
(trình tự PAM được gạch chân)............................................................................................................. 41
Hình 2.5. Lựa chọn cặp mồi để phát hiện indel sau khi knockout gen Nrf2 bằng
CRISPR-Cas9 ở cá ngựa vằn. Cặp mồi thiết kế sẵn có từ trang web
http://chopchop.cbu.uib.no sau khi thiết kế sgRNA keap1b.



TIEU LUAN MOI download : skknchat123@gmail.com


viii

Cụ thể cặp mồi đầu tiên Nrf2.hma.f1: 5’- ctaGTGTGTGATGCCTGACCTC và
Nrf2.hma.r1: 5’- CAGTGTcttctcctgctcctg được lựa chọn.......................................................... 41
Hình 2.6. sgRNA Nrf2 của cá ngựa vằn được tổng hợp từ cơng ty IDT..............................42
Hình 2.7. Thiết lập bể cho đẻ cá ngựa vằn dòng cá AB. A: Bể có thể tích 1.5 lít nước. Bể
đẻ được bố trí 3 cá cái và 2 cá đực. B: Trứng cá ngựa vằn dòng AB sau khi đẻ được thu
để trong đĩa petri sẵn sàng phục vụ vi tiêm. Trứng màu trắng đục là trứng không thụ tinh.
Trứng màu trong suốt là trứng phát triển tốt.................................................................................... 43
Hình 2.8. Đĩa petri bên trái chứa 50 µL Ben zocaine (chất gây mê) với 50 mL nước. Đĩa
petri bên phải chứa nước sạch................................................................................................................ 45
Hình 2.9. Các dụng cụ cần chuẩn bị để tiến hành cắt đi cá.................................................. 46
Hình 2.10. Thao tác bỏ đuôi cá đã cắt vào ống eppendorf chứa TNEST............................. 47
Hình 2.11. Tiến hành bỏ mẫu vào để chạy PCR............................................................................. 49
Hình 2.12. Bơm mẫu vào các giếng trong gel................................................................................ 51
Hình 2.13. Quá trình chạy điện di....................................................................................................... 52
Hình 2.14. Kết quả sau khi chạy điện di........................................................................................... 53
Hình 2.15. Cách pha Exo SAPit để tinh sạch sản phẩm PCR................................................... 53
Hình 2.16. Hố chất EXP SAPit.......................................................................................................... 54
Hình 2.17 Spindown mẫu....................................................................................................................... 55
Hình 2.18. Quá trình ly tâm mẫu......................................................................................................... 56
Hình 2.19. Bỏ mẫu vào máy để chuẩn bị sấy khơ......................................................................... 57
Hình 2.20. Bỏ vào máy tác dụng nhiệt.............................................................................................. 57
Hình 2.21. Máy giải trình tự gen 3500XL - hãng Applied Biosystems của Trung tâm
Công nghệ sinh học Thành phố Hồ Chí Minh................................................................................. 58

Hình 3.1. Điện di kiểm tra hiệu quả sau khi vi tiêm sgRNA Nrf2 vào phôi cá ngựa vằn
giai đoạn F0 (4 ngày sau khi vi tiêm).................................................................................................. 59

TIEU LUAN MOI download : skknchat123@gmail.com


ix

Hình 3.2. Kết quả chạy PCR xác định cá ngựa vằn knockout gen Nrf2 ở thế hệ F1 (được
lai từ cá F0 và cá hoang dại). Kết quả có 03 dòng (Cá 2; 4 và cá 5) được knockout gen
Nrf2 thành cơng được tạo ra................................................................................................................... 60
Hình 3.3. Giải trình tự xác định cá ngựa vằn knocout gen keap1b ở thế hệ F1. Kết quả có
02 dịng được knockout gen keap1a thành cơng. Dịng 1 (mẫu 3 có 4 bp deleted); dịng 2
(mẫu 7 15 bp deleted)................................................................................................................................ 61
Hình 3.4. cặp mồi nrf2-seq-f5 chạy điện di và cặp mồi nrf2-seq-f1 chạy giải trình tự. .62
Hình 3.5. Kết quả sau khi giải trình tự............................................................................................... 62
Hình 3.6. Cá F1 được cho lai tạo dịng cá ổn định ở thế hệ hệ F2 knockout gen Nrf2...63
Hình 3.7. Giàn cá chuyển gen Nrf2 của Trung tâm Cơng nghệ sinh học Thành phố Hồ
Chí Minh........................................................................................................................................................ 64
Hình 3.8. Cá được chia ra đực, cái rõ rang...................................................................................... 64
Danh mục bảng biểu
Bảng 2.1: Các hóa chất - nguyên liệu được sử dụng trong nghiên cứu................................. 37
Bảng 2.2: Các dụng cụ được sử dụng trong nghiên cứu............................................................. 38
Bảng 2.3: Các thiết bị được sử dụng trong nghiên cứu............................................................... 38
Bảng 2.4: Trình tự các cặp mồi (Oligonucleotide)........................................................................ 44
Bảng 2.5: các thành phần của môi trường TNES, dùng để chiết xuất DNA....................... 45
Bảng 2.6: Các thành phần để chạy PCR........................................................................................... 48
Bảng 2.7: Chu trình chạy PCR............................................................................................................. 49
Bảng 2.8: Thành phần các chất để đổ gel......................................................................................... 50


TIEU LUAN MOI download : skknchat123@gmail.com


x

DANH MỤC CÁC TỪ VIẾT TẮT – THUẬT NGỮ ANH – VIỆT

TIEU LUAN MOI download : skknchat123@gmail.com


Trang 1
NGHIÊN CỨU THIẾT LẬP DÒNG CÁ NGỰA VẰN KNOCKOUT GENE NRF2 PHỤC VỤ NGHIÊN CỨU OXY HĨA

1.

PHẦN MỞ ĐẦU
Tính cấp thiết của đề tài

Stress oxy hóa gây ra thiệt hại cho nhiều thành phần tế bào, chẳng hạn như DNA,
protein và lipid, và có liên quan đến các tình trạng bệnh lý khác nhau của con người, bao
gồm ung thư, thối hóa thần kinh và các bệnh viêm (Endo et al. 2020) Một số protein như
superoxide dismutase (SOD), catalase, glutathione peroxidase (Gpx), peroxiredoxin
(Prdx), và các phân tử thiol nhỏ glutathione (GSH) và thioredoxin (Txn), tham gia trực
tiếp vào việc loại bỏ stress oxy hóa.
Những khám phá gần đây về hệ thống chống oxy hóa tế bào đã làm nảy sinh khái
niệm mới về “chất chống oxy hóa gián tiếp”, hoạt động thông qua việc tăng cường khả
năng chống oxy hóa tế bào bằng cách tăng cường biểu hiện gen do yếu tố phiên mã Nrf2
(Takaya et al. 2012; Nguyen et al. 2020). Nrf2 là một yếu tố phiên mã dị loại hóa với các
protein Maf nhỏ và liên kết với yếu tố phản ứng chống oxy hóa (ARE) trong vùng điều
hịa của các gen mục tiêu của nó (Itoh et al. 1997). Một loạt các gen bảo vệ tế bào mã hóa

các enzym giải độc giai đoạn 2 và các protein chống oxy hóa, chẳng hạn như glutathione
S-transferase (GST), NAD(P)H: quinone oxidoreductase và glutamate-cysteine ligase,
được cảm ứng bởi Nrf2 (Okawa et al. 2006). Trong điều kiện cơ bản, Nrf2 liên tục bị
phân hủy thông qua con đường ubiquitin-proteasome theo cách phụ thuộc Keap1. Khi
tiếp xúc với electrophin hoặc căng thẳng oxy hóa, Nrf2 thốt khỏi sự phân hủy protein,
tích tụ trong nhân và kích hoạt phiên mã các gen mục tiêu của nó.
Trước đây, phịng thí nghiệm của giáo sư Makoto Kobayashi đã phân lập các gen tương
đồng của cá ngựa vằn của Nrf2 và gen điều hòa Keap1 của nó (nrf2, keap1a và keap1b) và
chứng minh rằng sự cảm ứng của các gen bảo vệ tế bào bởi hệ thống Keap1-Nrf2 được bảo
tồn ở các động vật có xương sống (Tian et al. 2018). Bằng cách sử dụng hệ thống cá ngựa
vằn này, chúng tôi đã cung cấp những hiểu biết mới về các chức năng của Nrf2 (Kobayashi
et al. 2002, 2009; Nakajima et al. 2011), ví dụ sự phân lập của một số dòng cá ngựa vằn đột
biến biểu hiện phản ứng suy giảm với các hợp chất kích hoạt Nrf2, và chứng minh sự biểu
hiện cụ thể ở mô của Nrf2 và các gen mục tiêu của nó.

Tuy nhiên, vai trị sinh lý của Nrf2 ở cá ngựa vằn vẫn chưa rõ ràng và cần được làm
sáng tỏ để hiểu các chức năng của Nrf2 từ quan điểm tiến hóa. Trong nghiên cứu
“Nghiên cứu thiết lập dòng cá ngựa vằn knockout gene nrf2 phục vụ nghiên cứu oxy
hóa” này, tơi đã loại bỏ gen Nrf2 để xác định đặc điểm cá ngựa vằn bằng phương pháp
CRISPR-Cas9 (Ota et al. 2014). Kết quả của chúng tôi cho thấy cá ngựa vằn loại bỏ gen
Nrf2 có thể sống được và có khả năng sinh sản. Đây sẽ là mơ hình lý tưởng để sử dụng
phân tích các đặc điểm oxy hóa trong tương lai

TIEU LUAN MOI download : skknchat123@gmail.com


Trang 2
NGHIÊN CỨU THIẾT LẬP DÒNG CÁ NGỰA VẰN KNOCKOUT GENE NRF2 PHỤC VỤ NGHIÊN CỨU OXY HĨA

Mục đích nghiên cứu

-

Mục tiêu của nghiên cứu này là làm rõ vai trò sinh lý của Nrf2 khi bị mất chức

năng. Nhiều nghiên cứu Nrf2 dựa trên các tế bào nuôi cấy liên quan đến cảm cảm biến
căng thẳng đã được báo cáo bao gồm chúng tôi. Đầu tiên, chúng tôi sẽ tạo ra các dòng
cá loại bỏ gen Nrf2, và kiểm tra đặc tính di truyền ở các thế hệ sau từ F0 đến F2. Thứ
hai, chúng tôi sẽ làm sáng tỏ chức năng sinh lý của cá ngựa vằn bị loại bỏ gen Nrf2.
Tuy nhiên, trong khuôn khổ đề tài sinh viên, thời gian ngắn. Nên tôi xin thực hiện
mục đích nghiên cứu đầu tiên là tạo được dịng cá ngựa vằn loại bỏ gen Nrf2 đến thế
hệ F2.
2. Đối tượng nghiên cứu
- Cá ngựa vằn AB hoang dại từ trường Đại học Tsukuba, Nhật Bản.
3. Nhiệm vụ nghiên cứu
-

Loại bỏ được gen Nrf2 để xác định đặc điểm cá ngựa vằn bằng phương

pháp CRISPR-Cas9.
4. Phương pháp nghiên cứu
-

Loại bỏ gen Nrf2 ở cá ngựa vằn bằng phương pháp CRISPR-Cas9 và vi

tiêm CRISPR-Cas9 vào phôi cá ngựa vằn giai đoạn một tế bào.
5.

Các kết quả đạt được của đề tài

Loại bỏ được gen Nrf2 ở cá ngựa vằn mà cá thể vẫn có khả năng sống tiếp và

sinh sản
6.

Kết cấu của khoá luận tốt

nghiệp Khoá luận tốt nghiệp này gồm 4
chương:
-

Chương 1 - Tổng quan

-

Chương 2 - Cơ sở khoa học của đề tài nghiên cứu

-

Chương 3 - Vật liệu và phương pháp nghiên cứu

-

Chương 4 – Kết quả và thảo luận


TIEU LUAN MOI download : skknchat123@gmail.com


Trang 3
NGHIÊN CỨU THIẾT LẬP DÒNG CÁ NGỰA VẰN KNOCKOUT GENE NRF2 PHỤC VỤ NGHIÊN CỨU OXY HÓA


CHƯƠNG 1 - TỔNG QUAN
1.1 Giới thiệu về kỹ thuật knockout gene
Knockout gene là một kỹ thuật di truyền trong đó một trong các gen của sinh vật
không hoạt động được. Knockout được thực hiện thông qua sự kết hợp của nhiều kỹ
thuật, bắt đầu trong ống nghiệm với plasmid, nhiễm sắc thể nhân tạo của vi khuẩn hoặc
cấu trúc DNA khác, và tiến hành nuôi cấy tế bào. Các tế bào riêng lẻ được chuyển gen
với cấu trúc DNA. Thông thường, mục đích là tạo ra động vật chuyển gen có gen bị thay
đổi. Có thể thay thế 1 đoạn gen khác vào vị trí loại bỏ thay vì loại bỏ hồn tồn đoạn
gen đó.
1.2

Tổng quan về hệ thống CRISPER-Cas9

Một số lượng chưa từng có của thơng tin bộ gen bây giờ đã có sẵn của mơ hình
sinh vật khác nhau bao gồm cả thực vật và động vật. Tuy nhiên, các chức năng sinh
học và phát triển liên quan đến các gen riêng lẻ nằm trong các bộ gen này không phải
lúc nào cũng được hiểu rõ. Sự phát triển của các nuclease ở các vị trí đặc trưng nhân
tạo như các zinc‐finger nucleases (ZFNs) và transcription activator‐like effector
nucleases (TALENs) đã cho phép điều tra các kiểu hình của các gen bị mất chức năng
liên quan. Cả ZFNs và TALENs đều bao gồm một tên miền DNA ‐ Binding (tên
miền zinc‐finger hoặc TALE) và tên miền xúc tác FOK I nuclease.
Các DNA sợi đơn bị phá vỡ (Double strand breaks (DSBs)) được gây ra bởi ZFNs
hoặc TALENs tại locus bộ gen được lựa chọn mục tiêu trước đó có thể được sửa chữa
bởi tái tổ hợp các gen tương đồng hoặc khơng tương đồng. Việc sữa chữa thường gây
ta q trình chèn và/hoặc xóa (indel) các đột biến vào các vị trí của DSBs, dẫn đến
đột biến lệch khung đọc (frameshift mutation) mà dẫn đến sự phá vỡ chức năng gen.
Nhìn chung, cả hai phương pháp ZFNs và TALENs đều được chứng minh là công cụ
mạnh mẽ để chỉnh sửa bộ gen. Tuy nhiên, quy trình của các phương pháp này rất
phức tạp trong việc thiết kế và đưa vào sử dụng trong thực tế. Do đó tính ứng dụng
của các phương pháp này chưa cao, đặc biệt đối với các ứng dụng lâm sàng (Kotani et

al. 2015).

Chương 1 – Tổng quan

TIEU LUAN MOI download : skknchat123@gmail.com


Trang 4
NGHIÊN CỨU THIẾT LẬP DÒNG CÁ NGỰA VẰN KNOCKOUT GENE NRF2 PHỤC VỤ NGHIÊN CỨU OXY HĨA

Hình 1.1. Spacer, protospacer và PAM. Protospacer là DNA đích;
PAM tiếp giáp với DNA sợi đôi được nhắm mục tiêu. Phần đệm
(Spacer) là một phần của RNA dẫn đường gắn kết với protospacer.
Nguồn: https://www.idtdna.com/
Gần đây, hệ thống CRISPR-Cas9 đã nổi lên như một mảng công nghệ chỉnh sửa
bộ gen mới (Jinek et al. 2012). CRISPR được viết tắt từ những chữ cái đầu của cụm từ
Clustered Regularly Interspaced Short Palindromic Repeats. Tên gọi này được sử dụng ở
thời điểm khi các nhà sinh học chưa biết rõ nguồn gốc và tại sao lại có mặt các đoạn trình
tự riêng rẽ xen giữa các đoạn trình tự giống hệt nhau. Ở thời điểm đó CRISPRs được
miêu tả như là đoạn DNA nhân sơ chứa các đoạn ngắn có trình tự base giống nhau được
lặp lại. Trong một đoạn trình tự xi ngược lặp đi lặp lại, khi đọc theo hướng xi hay
ngược thì đều có được trình tự nucleotide giống hệt nhau. Nằm cạnh mỗi trình tự xi
ngược là các đoạn DNA đệm có độ dài duy nhất mà sau này được phát hiện là có nguồn
gốc từ DNA ngoại lai (thể thực khuẩn hoặc plasmid). Ngồi các đoạn trình tự xi ngược
ngắn và vùng đệm DNA, cịn có cụm nhỏ (cluster) các gen cas (hệ đi kèm với CRISPR)
nằm bên cạnh các trình tự CRISPR. Hệ thống CRISPR/Cas là một hệ thống miễn dịch
thích ứng được tìm thấy trong vi khuẩn và vi khuẩn cổ, và nó bảo vệ các bộ gen của các
sinh vật chống lại virus xâm lược và plasmid (Wiedenheft et al. 2012). Một số nhóm đã
chứng minh rằng loại II CRISPR/Cas9, CRISPR/Cas9, đặc biệt hữu ích cho các thay đổi
Chương 1 – Tổng quan



TIEU LUAN MOI download : skknchat123@gmail.com


Trang 5
NGHIÊN CỨU THIẾT LẬP DÒNG CÁ NGỰA VẰN KNOCKOUT GENE NRF2 PHỤC VỤ NGHIÊN CỨU OXY HÓA

bộ gen được nhắm mục tiêu trong các tế bào động vật có vú (Cong et al. 2013; Mali et al.
2013) và các sinh vật mơ hình khác nhau bao gồm cá ngựa vằn (Hwang et al. 2013),
chuột (Li et al. 2013b), và chuột nhắt (Li et al. 2013a, b).

Hình 1.2. Chỉnh sửa gen CRISPR-Cas9. Hình thành RNP (bước 1) có thể
xảy ra bên trong tế bào hoặc phịng thí nghiệm. Đầu tiên, CRISPR RNA
(crRNA) và CRISPR RNA chuyển hóa (tracrRNA) kết hợp với nhau, tạo
thành RNA dẫn đường (gRNA) hoàn chỉnh. Tiếp theo, gRNA liên kết với
enzyme Cas, tạo thành ribonucleoprotein (RNP). Nếu q trình hình
thành RNP được thực hiện trên phịng thí nghiệm, thì RNP sau đó phải
được chuyển đến các tế bào. Trong bước 2, gRNA hướng RNP đến mục
tiêu bên trong tế bào. Sau đó mục tiêu được phân tách (bước 3). Nguồn:
https://www.idtdna.com/
Trong hệ thống này, các chuỗi gen được nhắm mục tiêu nằm liền kề với một trình
tự tiền vùng đệm (protospacer adjacent motif- PAM) mà được ghi nhận bởi RNA hướng
dẫn (gRNA)- chứa các trình tự bổ sung cho các vị trí đích và được phân cắt bởi
Chương 1 – Tổng quan


TIEU LUAN MOI download : skknchat123@gmail.com



Trang 6
NGHIÊN CỨU THIẾT LẬP DÒNG CÁ NGỰA VẰN KNOCKOUT GENE NRF2 PHỤC VỤ NGHIÊN CỨU OXY HÓA

một phức hợp của gRNA và nuclease Cas9. Các đột biến indel tiếp theo gây ra bởi các
nuclease Cas9 góp phần vào sự gián đoạn gen. Trong thực tế, sự gián đoạn gen duy
nhất gây ra bởi CRISPR/Cas9 ở cá ngựa vằn đã được báo cáo bởi một số nhóm (Jao et
al. 2013; Hwang et al. 2013; Chang et al. 2013; Hruscha et al. 2013; Sung et al. 2014;
Bannikov và Lavrov 2017).

Hình 1.3. Các kết quả có thể xảy ra sau khi phân tách DNA bộ gen. Các con
đường sửa chữa DNA của tế bào chẳng hạn như nối kết cuối không tương đồng (NHEJ) có
thể dẫn đến xóa (deletion), thay đổi trình tự (changed sequences) và chèn nhỏ (small

insertion). Nguồn: https://www.idtdna.com/

Trình tự CRISPR lần đầu tiên được tìm ra vào năm 1987 do các nghiên cứu của
Yoshizumi Ishino và cộng sự tại trường Đại học Osaka, Nhật Bản. Điều này thúc đẩy các
nhà khoa học tập trung nghiên cứu chức năng đặc biệt của chúng trong hệ miễn dịch của

vi khuẩn trong những năm gần đây. Vào năm 2012, hai nhóm nghiên cứu độc lập của
Tiến sĩ Emmanuelle Charpentier tại trường đại học Umea và Tiến sĩ Jennifer Doudna tại
trường đại học California, Berkeley đã cùng khám phá ra cơ chế hoạt động của enzyme
Cas và CRISPR.
Tiến sĩ Craig Mello, người được trao giải thưởng Nobel về Sinh lý học và Y học năm
2006 về cơng trình nghiên cứu RNAi (RNA interference), đã có những lời bình luận về
Chương 1 – Tổng quan

TIEU LUAN MOI download : skknchat123@gmail.com



Trang 7
NGHIÊN CỨU THIẾT LẬP DÒNG CÁ NGỰA VẰN KNOCKOUT GENE NRF2 PHỤC VỤ NGHIÊN CỨU OXY HÓA

tương lai hứa hẹn của phương pháp này như sau: “CRISPR/Cas có ý nghĩa vơ cùng to
lớn, khả năng của nó vơ cùng mạnh mẽ, bời vì chúng ta về cơ bản có thể thay đổi bộ gen
theo bất cứ điều gì chúng ta muốn”. Mello nhấn mạnh rằng phương pháp này có thể
được sử dụng rộng rãi từ các ứng dụng cho nông nghiệp đến các ứng dụng liệu pháp gen
trong điều trị các bệnh lý trên người. Phương pháp này thật sự là một thành công của
nghiên cứu khoa học cơ bản, đây cũng là một đột phá to lớn có tác động mạnh mẽ đối
với di truyền học phân tử.

Hình 1.4. Sửa chữa theo hướng tương đồng (HDR) có thể kết hợp các
trình tự mới vào DNA bộ gen. Các trình tự nhỏ có thể được thay đổi
cho các mục đích chỉnh sửa hoặc sửa đổi gen (trái), và các trình tự lớn
như tồn bộ gen có thể được thêm vào một cách ngẫu nhiên (phải).
Nguồn: https://www.idtdna.com/
gRNA (RNA hướng dẫn) là một phân tử RNA tổng hợp ngắn được sử dụng trong
chỉnh sửa bộ gen dựa trên hệ thống CRISPR, một trong những loại công cụ chỉnh sửa bộ
gen đặc biệt cao. gRNA bao gồm chuỗi nucleotide dài ̴ 20 bp liên kết với trình tự DNA
mục tiêu của bộ gen. Trình tự này được gọi là trình tự miếng đệm. Phân tử gRNA
Chương 1 – Tổng quan


×