Báo cáo khoa học: Conservation of the egg envelope digestion mechanism of hatching enzyme in euteleostean fishes pot

Conservation of the egg envelope digestion mechanism
of hatching enzyme in euteleostean fishes
Mari Kawaguchi
1,2
, Shigeki Yasumasu
3
, Akio Shimizu
4
, Kaori Sano
5
, Ichiro Iuchi
3
and
Mutsumi Nishida
1
1 Atmosphere and Ocean Research Institute, The University of Tokyo, Chiba, Japan
2 Research Fellow of the Japan Society for the Promotion of Science (JSPS), Tokyo, Japan
3 Department of Materials and Life Sciences, Faculty of Science and Technology, Sophia University, Tokyo, Japan
4 National Research Institute of Fisheries Science, Fisheries Research Agency, Yokohama, Japan
5 Graduate Program of Biological Science, Graduate School of Science and Technology, Sophia University, Tokyo, Japan
Introduction
Molecular bases of formation, hardening (conversion)
and breakdown of teleostean egg envelope have been
comprehensively studied in medaka Oryzias latipes as
a model animal [1–3]. The egg envelope (chorion)
consists of a major thick inner layer and an extremely
thin outer layer. The inner layer is constructed of
fibrous macromolecules comprising two groups of sub-
unit proteins: ZI-1,2 and ZI-3 [4]. ZI-1,2 are heteroge-
neous glycoproteins derived from the precursor
proteins, choriogenin H (ChgH) and choriogenin H

Keywords
chorion; egg envelope; euteleostean fish;
Fundulus heteroclitus; hatching enzyme;
ZP domain
Correspondence
M. Nishida, Atmosphere and Ocean
Research Institute, The University of Tokyo,
5-1-5 Kashiwanoha, Kashiwa,
Chiba 277-8564, Japan
Fax: +81 4 7136 6211
Tel: +81 4 7136 6210
E-mail:
Database
The nucleotide sequence data reported in this
paper are available in the EMBL ⁄ GenBank ⁄
DDBJ databases under the accession
numbers AB533328 to AB533330
(Received 6 July 2010, revised 1 October
2010, accepted 6 October 2010)
doi:10.1111/j.1742-4658.2010.07907.x
We purified two hatching enzymes, namely high choriolytic enzyme (HCE;
EC 3.4.24.67) and low choriolytic enzyme (LCE; EC 3.4.24.66), from the
hatching liquid of Fundulus heteroclitus, which were named Fundulus HCE
(FHCE) and Fundulus LCE (FLCE). FHCE swelled the inner layer of egg
envelope, and FLCE completely digested the FHCE-swollen envelope. In
addition, we cloned three Fundulus cDNAs orthologous to cDNAs for the
medaka precursors of egg envelope subunit proteins (i.e. choriogenins H, H
minor and L) from the female liver. Cleavage sites of FHCE and FLCE on
egg envelope subunit proteins were determined by comparing the N-termi-
nal amino acid sequences of digests with the sequences deduced from the

cDNAs for egg envelope subunit proteins. FHCE and FLCE cleaved differ-
ent sites of the subunit proteins. FHCE efficiently cleaved the Pro-X-Y
repeat regions into tripeptides to dodecapeptides to swell the envelope,
whereas FLCE cleaved the inside of the zona pellucida domain, the core
structure of egg envelope subunit protein, to completely digest the FHCE-
swollen envelope. A comparison showed that the positions of hatching
enzyme cleavage sites on egg envelope subunit proteins were strictly con-
served between Fundulus and medaka. Finally, we extended such a compar-
ison to three other euteleosts (i.e. three-spined stickleback, spotted halibut
and rainbow trout) and found that the egg envelope digestion mechanism
was well conserved among them. During evolution, the egg envelope diges-
tion by HCE and LCE orthologs was established in the lineage of eu-
teleosts, and the mechanism is suggested to be conserved.
Abbreviations
ChgH, choriogenin H; ChgHm, choriogenin H minor; ChgL, choriogenin L; FE, fertilized egg envelope; FHCE, Fundulus HCE; FhChgH,
F. heteroclitus ChgH; FhChgHm, F. heteroclitus ChgHm; FhChgL, F. heteroclitus ChgL; FhZPB, F. heteroclitus ZPB; FhZPC, F. heteroclitus
ZPC; FLCE, Fundulus LCE; HCE, high choriolytic enzyme; LCE, low choriolytic enzyme; TFA, trifluoroacetic acid; UFE, unfertilized egg
envelope; ZP, zona pellucida.
FEBS Journal 277 (2010) 4973–4987 ª 2010 The Authors Journal compilation ª 2010 FEBS 4973
minor (ChgHm), which are synthesized in the liver of
spawning female, transported through the blood, pro-
cessed at their C-terminal processing sites, and assem-
bled around the egg [5,6]. ZI-3 is a homogeneous
glycoprotein derived from another precursor, chorioge-
nin L (ChgL) [7]. All of the subunit proteins contain a
zona pellucida (ZP) domain that is the common struc-
ture in all vertebrate egg envelope proteins [8]. ChgH
and ChgHm of medaka (precursors of ZI-1,2) are clas-
sified into ZPB, whereas ChgL (precursor of ZI-3) are
classified into ZPC [9].

The unfertilized egg envelope is soft or fragile. After
fertilization, the envelope becomes hard and protects
the embryo from the mechanical and chemical stresses
of the environment. Egg envelope hardening in
medaka has been suggested to be a result of the forma-
tion of e-(c-glutamyl) lysine cross-links between sub-
unit proteins of the envelope, mainly between inner
layer subunit proteins [10]. At the time of hatching of
the embryo, the inner layer is digested by hatching
enzyme [1]. The outer layer that remains undigested is
ruptured by movement of the embryo. The breakdown
of the inner layer by the enzyme is responsible for
embryo hatching.
Medaka hatching enzyme is composed of two asta-
cin family metalloproteases: high choriolytic enzyme
(HCE; choriolysin H; EC 3.4.24.67) and low choriolyt-
ic enzyme (LCE; choriolysisn L; EC 3.4.24.66) [11,12].
At the time of hatching, the two enzymes act coopera-
tively on envelope: HCE swells the inner layer of enve-
lope and LCE completely digests or solubilizes the
HCE-swollen part of the inner layer. A previous study
has revealed that HCE and LCE cleave different sites
on the egg envelope subunit proteins in addition to
one common site [13].
Recently, cDNAs for Fundulus heteroclitus orthologs
of HCE and LCE (Fundulus HCE, FHCE; Fundulus
LCE, FLCE) were cloned, and their gene expression
during development was observed by northern blotting
as well as whole-mount in situ hybridization [14]. Their
gene structures and expression patterns conserved

those of medaka. In the previous study, we separately
purified two isoforms of FHCE (FHCE1 and FHCE2).
By contrast, FLCE was not fully purified. In vitro egg
envelope digestion revealed that both the purified
FHCE1 and FHCE2 swell the egg envelope, and the
partially purified FLCE-fraction has the solubilizing
activity of the FHCE1 ⁄ 2-swollen egg envelope. There-
fore, it has been predicted that the mode of their
proteolytic action toward the envelope is conserved
between Fundulus and medaka.
In the present study, we first purified FLCE as a
major band by SDS ⁄PAGE. Next, we cloned Fundulus
cDNA orthologs for egg envelope protein precursors,
ChgH, ChgHm and ChgL. The cleavage sites of
FHCE1 ⁄ 2 or FLCE on the egg envelope proteins were
determined, and the amino acid sequences around the
sites were compared with those of medaka. Finally, we
extended the comparison to three other euteleosts:
three-spined stickleback, spotted halibut and rainbow
trout.
Results
Purification of FLCE from Fundulus hatching
liquid
The purity of the previously obtained FLCE-fraction
was not sufficient to determine FLCE-cleavage sites on
egg envelope protein. Therefore, we developed a new
purification method. As shown in Fig. 1A, the Toyo-
pearl HW-50S column chromatography of ammonium
sulfate precipitate from hatching liquid revealed two
proteolytically active peaks (fractions I and II). As

shown in a previous study [14], fractions I and II con-
tained FLCE and FHCE1 ⁄ 2, respectively. We employed
fraction I for further purification procedures.
Fraction I was applied to an S-Sepharose column,
and adsorbed proteins were eluted once with 50 mm
Tris-buffer containing 0.4 m NaCl. The eluate, named
fraction IS, was applied to a Source 15S column. Most
of the proteins were adsorbed and fractionated mainly
into three peaks, named IS-a, IS-b and IS-c (Fig. 1B).
When caseinolytic specific activity was examined, the
highest activity was observed in IS-c (Fig. 1C).
MALDI-TOF-MS analysis of IS-c showed a major
peak of m ⁄ z at 23800.9 and the value was well concor-
dant with the molecular weight calculated from FLCE
cDNA (MW = 23805.65). SDS⁄ PAGE showed that
the densities of IS-a, IS-b and IS-c bands at 23 kDa
were comparable with the specific activities of the
respective fractions (Fig. 1C). To confirm LCE activity
for fraction IS-c, the envelopes swollen either by
FHCE1 or by FHCE2 were incubated with IS-c and
observed by microscopy. The swollen envelopes were
efficiently solubilized by IS-c (data not shown). Thus,
we concluded that the 23 kDa band in fraction IS-c is
FLCE.
Figure 1D shows the SDS ⁄ PAGE patterns of purified
FHCE1, FHCE2 and FLCE. The electrophoretic mobil-
ity of FLCE was slightly higher than those of FHCE1
and FHCE2, and clearly different from them. The
caseinolytic specific activities of FHCE1, FHCE2
and FLCE were estimated as 16.0, 12.6 and 14.4

DA
280
min
)1
Æmg protein
)1
, respectively, which were
similar to each other and approximately one half of
Egg envelope digestion mechanism M. Kawaguchi et al.
4974 FEBS Journal 277 (2010) 4973–4987 ª 2010 The Authors Journal compilation ª 2010 FEBS
those of medaka HCE (30.2 DA
280
min
)1
Æmg protein
)1
)
and medaka LCE (24.5 DA
280
min
)1
Æmg protein
)1
).
Fundulus orthologs of choriogenin H, H minor
and L
In medaka, it has been reported that choriogenins,
which are precursors of egg envelope subunit proteins,
are synthesized in the liver under the influence of estro-
gen [15]. RNAs extracted from the spawning female

liver of Fundulus were used as a template of RT-PCR
and, finally, three kinds of full-length choriogenin
cDNAs were cloned. According to the phylogenetic
analysis, the three Fundulus cDNAs were separately
located in the ChgH, ChgHm and ChgL clades
(Fig. 2), and therefore named FhChgH (F. heteroclitus
ChgH), FhChgHm (F. heteroclitus ChgHm) and
FhChgL (F. heteroclitus ChgL) cDNAs, respectively.
Amino acid sequences deduced from FhChgH,
FhChgHm and FhChgL cDNAs are shown in Fig. 3,
together with medaka orthologs OlChgH, OlChgHm
and OlChgL. All of them possessed a hydrophobic
signal peptide at their N-termini. The cleavage site of
signal peptidase was deduced to be at Ala26 ⁄ Gln27 for
FhChgH, Ala22 ⁄Gln23 for FhChgHm and Ala22 ⁄
Gln23 for FhChgL, according to signalp 3.0 software
(http: ⁄⁄www.cbs.dtu.dk ⁄ services ⁄ SignalP ⁄ ). FhChgH,
FhChgHm and FhChgL all had a ZP domain. The tre-
foil domain was found at the N-terminal side of the ZP
domain of FhChgH and FhChgHm. The consensus
motif for the processing site, such as Arg-Lys-X-fl-Arg,
was found near the C-termini of FhChgHm and
FhChgL. In medaka, the C-terminal regions from those
sites are excised before the assembly of water-soluble
precursors into the water-insoluble egg envelope [16].
The site of FhChgH was Arg-Lys-Gly-Lys. Therefore,
each processing site is predicted to be at Gly564 ⁄ Lys565
for FhChgH, Lys423 ⁄ Arg424 for FhChgHm and
Val400 ⁄Arg401 for FhChgL. One of the characteristics
of OlChgH and OlChgHm is the presence of Pro-X-Y

repeat sequences in their N-terminal regions [5,6]. Such
Fig. 1. Purification of Fundulus hatching enzyme. (A) Toyopearl HW-50S column chromatogram of hatching liquid. Solid line, A
280
; dashed
line, caseinolytic activity indicated by A
280
. (B) Elution pattern of fraction IS, which was obtained from fraction I via an S-Sepharose column,
by cation exchange HPLC with a linear gradient of 0–400 m
M NaCl. (C) Caseinolytic specific activity (DA
280
min
)1
Æmg protein
)1
) of fractions
IS-a, IS-b and IS-c, as well as their SDS ⁄ PAGE patterns detected by silver staining. (D) SDS ⁄ PAGE patterns of purified FHCE1, FHCE2 and
FLCE (fraction IS-c), detected by silver staining. Numbers on the left refer to the size (kDa) of the molecular markers.
Fig. 2. A phylogenetic tree of the ZP domain of choriogenins. The
tree was constructed by the maximum likelihood method using the
nucleotide sequences. Numbers at the nodes represent bootstrap
values (shown as percentages). Accession numbers: F. heteroclitus
(FhChgH, AB533328; FhChgHm, AB533329; FhChgL, AB533330);
O. latipes (OlChgH, D89609; OlChgHm, AB025967; OlChgL,
D38630); Oryzias javanicus (OjChgH, AY913759; OjChgL, AY913760);
Oryzias dancena (OdChgH, EF392363; OdChgL, EF392364); Oryzias
sinensis (OsChgL, AY758411); Cyprinodon variegatus (zona radiata-2
CvZR2, AY598615; zona radiata-3 CvZR3, AY598616).
M. Kawaguchi et al. Egg envelope digestion mechanism
FEBS Journal 277 (2010) 4973–4987 ª 2010 The Authors Journal compilation ª 2010 FEBS 4975
Egg envelope digestion mechanism M. Kawaguchi et al.

4976 FEBS Journal 277 (2010) 4973–4987 ª 2010 The Authors Journal compilation ª 2010 FEBS
regions were also found in FhChgH and FhChgHm,
and their repetitive units were YPQQPQ(T ⁄ K ⁄ Q)PS
and YP(K ⁄ N)PQTPPSKPQ for FhChgH and YPSKP-
QQPQQPQ and YPQQPQQPQ for FhChgHm (Fig. 3).
Expression of choriogenin genes
Choriogenin gene expression was observed by northern
blotting (Fig. 4). Each FhChgH, FhChgHm and
FhChgL probe was hybridized with two transcripts,
and the sizes were approximately 2 and 5 kb
(FhChgH), 1.6 and 5 kb (FhChgHm) and 1.4 and 5 kb
(FhChgL). The sizes of the smaller bands hybridized
with all of the probe (Fig. 4, asterisks) were similar to
those of cloned cDNAs: 2037 bp for FhChgH, 1518 bp
for FhChgHm and 1428 bp for FhChgL. Therefore, the
smaller bands represented choriogenin genes. Each of
the larger bands, obtained from the three probes, was
assumed to be the choriogenin gene-related RNAs,
such as pre-mRNA for choriogenin genes. When com-
paring the choriogenin gene signals, strongest expres-
sion was found in the FhChgL gene, followed by the
FhChgH gene. This relationship was similar to that of
medaka (i.e. strongest in the OlChgL gene, followed
by the OlChgH gene) (Fig. 4). Thus, the relative
expression level of choriogenin genes was conserved
between Fundulus and medaka.
Cleavage sites of hatching enzyme on unfertilized
egg envelope
One of the goals of the present study was to deter-
mine the cleavage sites of hatching enzyme on egg

envelope proteins. The natural substrate of hatching
enzyme is fertilized egg envelope (FE), as described
in the Introduction. FE was digested or solubilized
only by the combined action of two enzymes, and
not by any one of the two enzymes, nor by SDS.
Alternatively, unfertilized egg envelope (UFE) was
digested by one of the enzymes FHCE1 ⁄ 2 or FLCE,
and was solubilized by SDS. Therefore, UFE was
first used as a substrate to determine the cleavage
sites.
When UFE isolated from Fundulus was solubilized
by SDS and applied onto SDS ⁄ PAGE, two major
bands were found at molecular masses of 60 and
48 kDa (Fig. 5B). This pattern was similar to that of
medaka UFE [4,13]. The 60 and 48 kDa bands are
regarded as Fundulus homologs of ZI-1,2 (ZPB groups
of medaka) and ZI-3 (a ZPC group of medaka),
respectively, and were designated as FhZPB (F. hetero-
clitus ZPB) and FhZPC (F. heteroclitus ZPC), respec-
tively. FhZPB is considered to be a group of egg
envelope subunit proteins derived from their precur-
sors FhChgH and FhChgHm, and FhZPC is an egg
envelope subunit protein derived from its precursor
FhChgL.
Digests of Fundulus UFE by FHCE1 and those by
FHCE2 showed the same SDS ⁄ PAGE pattern (data not
shown), and were observed at 46, 36 and 32 kDa
(Fig. 5B). An N-terminal amino acid sequence obtained
from the 46 kDa digest was NQQQLQTFK and was
found from Asn41 of FhChgL (Table 1). The sequence

Fig. 3. Alignment of amino acid sequences of choriogenin H (A), H minor (B) and L (C) of Fundulus (FhChgH, FhChgHm and FhChgL) and
medaka (OlChgH, OlChgHm and OlChgL). Identical residues are indicated by asterisks below the sequences, and dashes represent gaps.
The trefoil domain and ZP domain are shown within dark and light gray boxes, respectively. Conserved cysteine residues are highlighted in
white with a black background. Conserved cysteine residues 1–8 of ZP proteins and additional conserved cysteine residues a and b of ZPB
proteins are labeled. The black arrowheads and black diamonds are HCE and LCE cleavage sites determined using unfertilized egg enve-
lopes, respectively. The white diamonds represent the cleavage sites determined using hatching liquid. The names of the cleavage sites are
shown to the left of the marks. Four types of dashed ⁄ dotted lines above the sequences indicate the four types of repeating units found in
the Pro-X-Y repeat region of FhChgH and FhChgHm. White and black triangles indicate putative signal sequence cleavage sites and process-
ing sites, respectively. Italicized, underlined letters indicate the consensus C-terminal processing site, Arg-Lys-X-fl-Arg.
Fig. 4. Northern blot analysis of Fundulus or medaka choriogenin
gene expression. Gene names are shown at the top. Bands show-
ing choriogenin genes are indicated by asterisks. Numbers on the
left refer to the size (base) of the molecular markers. Gel images of
28S and 18S rRNA are shown at the bottom.
M. Kawaguchi et al. Egg envelope digestion mechanism
FEBS Journal 277 (2010) 4973–4987 ª 2010 The Authors Journal compilation ª 2010 FEBS 4977
of the 36 kDa digest, APGVPT, was found from Ala230
residing near the N-terminal side of the trefoil domain
of FhChgH (Table 1). Two bands were observed at
32 kDa. However, only a single sequence was obtained
from such two bands, and the sequence, TPTET, was
found from Thr77 residing at the N-terminal of the
trefoil domain of FhChgHm (Table 1). The FHCE1 ⁄ 2
cleavage sites on FhChgH and FhChgL thus determined
were located at positions similar to those of the cleavage
sites of medaka HCE (Fig. 3) [13].
The digests by the mixture of FHCE1 ⁄ 2 and FLCE
were observed at 60, 46, 38, 32 and 17 kDa (Fig. 5B).
The 60 kDa band was that of undigested FhZPB, and
the 46 and 32 kDa bands were those of FHCE1 ⁄2-

digests. We could determine two FLCE sites that were
not found in FHCE1 ⁄ 2 sites. An amino acid sequence
obtained from the 38 kDa digest was YPVPAATVA
and matched the sequence from Tyr74 of FhChgL
(Table 1). The N-terminal sequence of the 17 kDa pro-
duct was a mixture of two products. By comparison
Fig. 5. The egg envelope digestion pattern of hatching enzyme. (A) Schematic presentation of the egg envelope digestion processes by
FHCE1 ⁄ 2 and FLCE, together with the respective morphological changes of the fertilized egg envelope of Fundulus. FhZPB is the Fundulus
ZPB ortholog derived from FhChgH and FhChgHm, and FhZPC is the Fundulus ZPC ortholog derived from FhChgL. Black, dark gray and light
gray boxes indicate the Pro-X-Y repeat region, trefoil domain and ZP domain, respectively. Arrowheads indicate the cleavage sites of
FHCE1 ⁄ 2 or FLCE. The length between the two arrows in the images indicates the thickness of the egg envelope. Scale bar = 0.1 mm.
(B) SDS ⁄ PAGE pattern of envelopes isolated from Fundulus unfertilized egg (as a control), digests of the envelope by FHCE2, the digests by
the mixture of the FHCE1 ⁄ 2 and FLCE, and the digests in Fundulus hatching liquid. Numbers on the left refer to the size of the molecular
markers (kDa).
Table 1. Cleavage sites of hatching enzymes on egg envelope determined after the incubation of unfertilized egg envelope with FHCE1,
FHCE2 or the mixture of FHCE1 ⁄ 2 and FLCE. The sites found at natural hatching were determined using hatching liquid.
Enzyme Size (kDa) N-terminal sequence Choriogenin Site Site name
FHCE1 ⁄ FHCE2 46 NQQQLQTFK FhChgL Q40 ⁄ N41 FhZPC1
36 APGVPT FhChgH E229 ⁄ A230 FhZPB1
32 TPTET FhChgHm Q76 ⁄ T77 FhZPB3
FHCE ⁄ FLCE 38 YPVPAATVA FhChgL R73 ⁄ Y74 FhZPC2
32 TPTETFHTxDVPAPF FhChgHm Q76 ⁄ T77 FhZPB3
17 NPPPAVAELGPIRVA FhChgH D394 ⁄ N395 FhZPB2
APGVPTPKSxDVEVA FhChgH E229 ⁄ A230 FhZPB1
Hatching liquid 35 YPVPAATVAV FhChgL R73 ⁄ Y74 FhZPC2
PVPAATVAVE FhChgL Y74 ⁄ P75
32 TPTETFHTxD FhChgHm Q76 ⁄ T77 FhZPB3
25 TSQAAVIVE FhChgL R167 ⁄ T168 FhZPC3
18 NPPPAVAELG FhChgH D394 ⁄ N395 FhZPB2
16 VPTPKSxDVE FhChgH G232 ⁄ V233

Egg envelope digestion mechanism M. Kawaguchi et al.
4978 FEBS Journal 277 (2010) 4973–4987 ª 2010 The Authors Journal compilation ª 2010 FEBS
with the amino acid sequence deduced from cDNA, they
were predicted to be the sequences from Asn395 residing
inside of the ZP domain of FhChgH (NPPPAVAELG-
PIRVA) and from Ala230 located near the N-terminal
side of the trefoil domain of FhChgH (AP-
GVPTPKSxDVEVA) (Table 1). The latter sequence
corresponded to that of the 36 kDa digest in FHCE1 ⁄ 2-
digests. Therefore, the 36 kDa digest could be further
cleaved by FLCE and divided into two 17 kDa digests.
The positions of two FLCE cleavage sites thus deter-
mined were well concordant with LCE sites of medaka
(Fig. 3) [13].
To clarify hatching enzyme cleavage sites in natural
hatching, we finally determined the N-terminal
sequence of the digests of FE contained in hatching
liquid. As shown in Fig. 5B, the SDS ⁄ PAGE pattern
of Fundulus hatching liquid was somewhat different
from that of FHCE ⁄FLCE-digests of UFE (i.e. the
digests of UFE by the mixture of FHCE1 ⁄2 and
FLCE). However, the cleavage sites determined using
major digests in hatching liquid were essentially con-
cordant with those of UFE as summarized in Table 1.
(a) The sequence of the 35 kDa digest was a mixture
of YPVPAATVAV and PVPAATVAVE. The former
sequence corresponded to that of the digest cleaved at
the site FhZPC2 of UFE, and the latter was that
cleaved at one amino acid residue from C-terminal side
of the FhZPC2 site (Table 1). (b) The sequence of the

32 kDa digest was TPTETFHTxD, which corresponds
to that of the digest cleaved at the site FhZPB3 of
UFE (Table 1). (c) Two bands were found at 18 and
16 kDa. The sequence of the 18 kDa digest was
NPPPAVAELG found from Asn395 in FhChgH, and
the cleavage site Asp394 ⁄ Asn395 matched with the
FLCE cleavage site, FhZPB2, determined with UFE
(Table 1). The sequence of the 16 kDa digest was
VPTPKSxDVE found from Val233 in FhChgH. This
site was located at three amino acid residues from
C-terminal side of the FHCE1 ⁄ 2 cleavage site,
FhZPB1, determined with UFE. Discrepancy between
digests of UFE and those of FE in hatching liquid,
such as minor differences with respect to electropho-
retic mobility and cleavage sites, might result from the
structural difference between UFE and FE, probably
as a result of the existence of e-(c-glutamyl)-lysine
cross-links in FE. (d) The 25 kDa band was observed
in the hatching liquid but not in the FHCE ⁄FLCE-
digests of UFE. The N-terminal sequence of the digest
was TSQAAVIVE and was located inside of
ZP-domain of FhChgL. In natural hatching, a part of
the 35 kDa digest was further digested and degraded
into the 25 kDa digest. The SDS ⁄ PAGE patterns of
the digests of isolated FE by purified FHCE1 ⁄ 2 and
FLCE were the same as that of the hatching liquid
(data not shown). Thus, the results obtained show that
the hatching enzyme cleavage sites determined with FE
reflect well those determined with UFE.
Next, FHCE1 ⁄ 2 cleavage sites that are present in the

Pro-X-Y repeat region were determined. The HCE-
inducing swelling of FE in medaka releases water-
soluble peptides that are excised from the Pro-X-Y
repeat region [10]. The previous study showed that this
region was broken into small peptides that can not be
detected by SDS ⁄ PAGE. Therefore, after UFE was
digested with FHCE1 alone, the supernatant was
applied to the reverse phase HPLC system. Seven major
peaks were obtained and subjected to N-terminal
sequencing and MALDI-TOF-MS. We obtained
sequences such as YPQQPQ, YPSKPQ, YPNPQ, YP-
KPQ and YPRPQ, suggesting that FHCE1 cleaved the
sites locating the tyrosine residue at the P1¢ site and the
proline residue at the P2¢ site [17,18]. To further study
the FHCE1 cleavage sites, all the peaks eluted with
chromatography were subjected to MALDI-TOF-MS.
As shown in Fig. 6A,B, all of the monoisotopic molecu-
lar weights thus determined matched the molecular
weights calculated from either FhChgH and FhChgHm
cDNA. In addition, the results obtained were confirmed
using a recombinant protein of the Pro-X-Y repeat
region of FhChgH, called rec.FhChgH_ProXY. After
rec.FhChgH_ProXY was digested by FHCE1 ⁄ 2, the
digests were fractionated by reverse phase column chro-
matography, and analyzed by MALDI-TOF-MS. The
result obtained was consistent with the FHCE1-cleavage
pattern of the Pro-X-Y repeat region of FhChgH
obtained from UFE (Fig. 6C). This clearly indicates
that the Pro-X-Y repeat region was broken into small
pieces, the size of which was three, four, five, six, nine or

12 amino acids in length. FHCE1 ⁄ 2 cleaved a bond
between Gln and Tyr of the Pro-X-Y region or between
Ser and Tyr, and occasionally also cleaved a bond
between Ser and Lys or between Gln and Thr.
Estimation of the egg envelope digestion
efficiency of FHCE1 ⁄ 2 and FLCE
The substrate preferences of FHCE1 ⁄ 2 and FLCE
were quantitatively estimated using synthetic peptides.
The peptide sequences were designed from three
FHCE1 ⁄2 cleavage sites (FhZPB1, FhZPB3 and
FhZPC1); two FLCE sites (FhZPB2 and FhZPC2);
and one site (FhZPC3) determined using hatching
liquid. The names of the synthetic peptides correspond
to those of the sites (Table 2). In addition, six peptides
were designed from the Pro-X-Y repeat region. Four
of them (PSYP, PQYP, PQTP and PSKP) were
M. Kawaguchi et al. Egg envelope digestion mechanism
FEBS Journal 277 (2010) 4973–4987 ª 2010 The Authors Journal compilation ª 2010 FEBS 4979
designed from FHCE1 ⁄ 2 sites. As a control, two
(PQQP and PQKP) were designed from the sites that
were not cleaved by any type of hatching enzymes. As
shown in Table 2, FLCE showed high activity toward
the peptides for the FLCE sites (FhZPB2 and
FhZPC2) but no activity toward all of the peptides
designed from the Pro-X-Y repeat region, or low activ-
ity toward FHCE1 ⁄2 sites. Therefore, FLCE is con-
firmed to specifically cleave the N-terminal side of the
ZP domain of FhZPC and the center of ZP domain of
FhZPB. In addition, FLCE showed high specific activ-
ity toward the peptide deduced from hatching liquid

(FhZPC3) but FHCE1 ⁄ 2 had no activity toward the
peptide, suggesting that FLCE specifically cleaves the
FhZPC3 site on FE, but that FHCE1 ⁄ 2 do not.
FHCE1 ⁄ 2 showed high specific activity toward two
peptides designed from the Pro-X-Y repeat region,
PQYP and PSYP, confirming that the tyrosine residue
at the P1¢ site is preferred by FHCE1 ⁄ 2. Therefore,
FHCE1 ⁄ 2 have a high specific activity for digesting the
center of Pro-Gln ⁄ Ser-Tyr-Pro sequence in the Pro-X-Y
repeat. However, no activity of FHCE1 ⁄ 2 toward PSKP
and PQTP peptides was observed, suggesting that a
bond between Ser and Lys or between Gln and Thr in
UFE and in rec.FhChgH_ProXY is not so efficiently
cleaved by FHCE1 ⁄ 2. In addition, FHCE1 ⁄ 2 showed
no activity or only low activity toward the peptides
designed from FHCE1 ⁄ 2 cleavage sites (FhZPB1,
FhZPB3 and FhZPC1). This difference in substrate
Fig. 6. FHCE1 ⁄ 2 cleavage sites found in the Pro-X-Y repeat region.
The cleavage sites in FhChgH (A) and FhChgHm (B) were deter-
mined using the unfertilized egg envelope and recombinant protein,
rec.FhChgH_ProXY (C). Black arrowheads indicate FHCE1 ⁄ 2 cleav-
age sites. FhZPB1 and FhZPB3 shown next to the white arrow-
heads indicate FHCE1 ⁄ 2 cleavage sites, as described in Fig. 3.
Values under the lines indicate observed monoisotopic masses
together with their calculated monoisotopic masses (given in paren-
theses). rec.FhChgH_ProXY possesses additional methionine and
histidine residues at the N- and C-terminus, respectively.
Table 2. Specific activity of FHCE1, FHCE2 and FLCE estimated
using synthetic peptide substrates. The cleavage site on each pep-
tide is indicated by an arrow. ND, not detected.

Substrate Sequence
Specific activity
(nmolÆ30 min
)1
Ælg protein
)1
)
FHCE1 FHCE2 FLCE
FHCE1 ⁄ 2 cleavage sites
FhZPB1 PSKRPEflAPGVP 1.40 0.95 0.56
FhZPB3 YPSKPQflTPTET 0.66 0.35 2.71
FhZPC1 QSPPTQflNQQQL ND ND ND
FLCE cleavage sites
FhZPB2 EVLPLDflNPPPA 0.98 1.07 8.66
FhZPC2 VPFELRflYPVPA 0.05 0.05 10.3
Cleavage site deduced from hatching liquid
FhZPC3 SVPVVRflTSQAA ND ND 19.5
Pro-X-Y region
PSYP QTPSflYPQQ 13.7 11.6 ND
PQYP SKPQflYPNP 23.2 16.0 ND
PQTP PNPQTPPS ND ND ND
PSKP TPPSKPQY ND ND ND
PQQP SYPQQPQT ND ND ND
PQKP QQPQKPSY ND ND ND
Egg envelope digestion mechanism M. Kawaguchi et al.
4980 FEBS Journal 277 (2010) 4973–4987 ª 2010 The Authors Journal compilation ª 2010 FEBS
preference may be a result of structural differences of
the substrate, such as the macromolecular egg envelope
and small peptides, and FHCE1 ⁄ 2 are able to cleave
these sites only when egg envelope was used as

substrate.
Conservation of the egg envelope digestion
mechanism of hatching enzymes in euteleosts
LCE cleavage sites
The present study suggests that the egg envelope diges-
tion mechanism of hatching enzymes is conserved
between two euteleosts, Fundulus and medaka. To
extend the comparison from lower to higher euteleosts,
we collected the hatching liquid of several fishes and
determined the N-terminal amino acid sequences of
their digests. Figure 7A shows the tricine-SDS ⁄ PAGE
patterns of hatching liquid obtained from higher
euteleosts, such as Fundulus, medaka, three-spined
stickleback and spotted halibut, as well as the lower
euteleost, rainbow trout.
First, we focused on the three digests in Fundulus
hatching liquid, indicated by *1, *2a and *3a in
Fig. 7A. When the N-terminal sequences of the bands
in hatching liquid of four fishes were compared with
those of Fundulus, the respective bands were revealed
to correspond well with those of the digests of Fundu-
lus. (a) The 35 kDa digest of Fundulus was generated
by cleavage at FhZPC2. The site was found in the
35 kDa product of medaka and spotted halibut or in
the 27 kDa of rainbow trout (Fig. 7A, *1). (b) A part
of the 35 kDa digest of Fundulus was cleaved at the
site FhZPC3 to generate the C-terminal 27 kDa and
N-terminal 9 kDa digests (Fig. 7A, *2a and *2b). The
bands corresponding to them were observed at the 27
and 10 kDa digests of medaka and three-spined stickle-

back or at the 27 and 9 kDa digests of spotted halibut,
except rainbow trout. In three-spined stickleback, no
bands around 35 kDa were observed, suggesting that
this 35 kDa product is completely digested into the 27
and 10 kDa bands. These results suggest that cleavage
efficiency at the site corresponding to FhZPC3 site is
different from species to species. (c) The 18 kDa digest,
as well as the 16 kDa digest, of Fundulus was generated
by cleavage at the site FhZPB2. The site was found in
the 17 kDa products in medaka, in the 14 kDa prod-
ucts in three-spined stickleback and in the 18 kDa
products in spotted halibut and rainbow trout (Fig. 7A,
*3a). Alignment of the sequences around the three
cleavage sites (Fig. 7B,D) suggests that the position of
each cleavage site is well conserved in higher euteleosts,
and two of three sites also coincide with each other in
lower euteleosts.
In addition to the digests described above, the
35 kDa digest was observed in rainbow trout hatching
liquid (Fig. 7A, *4). The sequence analysis revealed
Fig. 7. The conservation of the egg envelope digestion mechanism of hatching enzyme in euteleosts. (A) Tricine-SDS ⁄ PAGE pattern of
hatching liquid for Fundulus, medaka, three-spined stickleback, spotted halibut and rainbow trout. The bands comparable to each other are
indicated by *1 to *4. (C) The regions of products *1 to *3 are indicated in the schematic presentation of ZPB and ZPC, together with the
cleavage sites of HCE and LCE. Arrowheads in gray and black indicate cleavage sites of HCE and LCE, respectively. Partial amino acid
sequence alignment around the LCE cleavage sites on ZPB and ZPC is shown in (B) and (D), respectively. The names of the cleavage sites
of Fundulus LCE are shown next to the arrowheads.
M. Kawaguchi et al. Egg envelope digestion mechanism
FEBS Journal 277 (2010) 4973–4987 ª 2010 The Authors Journal compilation ª 2010 FEBS 4981
that the 35 kDa product was derived from VEPb, one
of two precursors of rainbow trout ZPB. The cleavage

site deduced from the 35 kDa digest of rainbow trout
corresponded well with that of the 32 kDa digest
of Fundulus, the digest of FhZPB derived from
FhChgHm. At present, the digests derived from two
kinds of ZPBs were only detected in rainbow trout
and Fundulus hatching liquids, whereas the digests
derived from only ChgH orthologs were detected
in the other species. This is probably a result of
differences with respect to the content of ZPBs in egg
envelope among species. Therefore, major cleavage
patterns and their cleavage sites are conserved among
the euteleosts examined in the present study.
HCE cleavage sites
The proline-rich Pro-X-Y repeat region has been also
found in the N-terminal region of precursors of ZPB
of many euteleosts [9]. To determine whether the frag-
mentation of the region is a universal feature in eu-
teleosts, we further determined cleavage sites on the
Pro-X-Y repeat region of rainbow trout egg envelope
protein. The digests in rainbow trout hatching liquid
were fractionated by reverse phase column chromatog-
raphy, and the small peptides that eluted with a low
acetonitril concentration (30–40%) were collected. Six
major peaks were obtained and subjected to N-termi-
nal sequencing. The obtained sequences were
WP(A ⁄V), WPPI, WPVQPG, QPPQRPA and
(Q ⁄E)P(L ⁄F)P(Q ⁄P)RPA. These sequences were found
in the Pro-X-Y repeat regions of VEPa and VEPb
(Fig. 8), which are ZPB precursors of rainbow trout.
The result clearly indicates that the Pro-X-Y repeat

region of rainbow trout egg envelope proteins is bro-
ken into small pieces, with notable cleavage of the sites
locating the tryptophan, glutamine and glutamic acid
residues at the P1¢ site and the proline residue at the
P2¢ site. Considering that the digestion pattern in the
Pro-X-Y repeat region was similar among two of
the higher euteleosts (Fundulus and medaka) and one
of lower euteleosts (rainbow trout), the cleavage pat-
tern of HCE is also suggested to be conserved among
euteleosts.
Discussion
The present study investigated the egg envelope diges-
tion mechanism of Fundulus hatching enzyme. Three
cDNA orthologs of egg envelope precursor proteins,
ChgH, ChgHm and ChgL cDNAs, were cloned. By
comparing the N-terminal amino acid sequences of
HCE- and LCE-digests with the sequences deduced
from cDNAs, the cleavage sites of HCE and LCE on
egg envelope subunit proteins were determined. The
results obtained showed that not only genes of hatch-
ing enzymes and egg envelope proteins, but also cleav-
age sites of hatching enzymes are well conserved
between Fundulus and medaka. Below, we discuss the
mechanism of egg envelope digestion by hatching
enzyme, mainly based on the structural characteristics
of egg envelope protein.
In medaka, HCE swells the hardened fertilized egg
envelope to convert its compact structure into a loose
structure. This conversion results from medaka HCE
cleaving the Pro-X-Y region of ZI-1,2 in the envelope,

leading to the release of small peptide fragments, with
notable cleavage of the sites locating tyrosine and
asparagine residues at P1¢ site within the repeats
[10,13]. The released fragments contain e -(c-glutamyl)
lysine isopeptide cross-links that are responsible for
egg envelope hardening after fertilization [10].
Although we did not determine the content of e-(c-
glutamyl) lysine isopeptides in the Pro-X-Y region of
FhZPB, the content of glutamine (25%) and lysine
(7%) in the region resembled that of medaka (gluta-
mine, 21%; lysine, 6%). The present study showed
that FHCE1 ⁄ 2 also cleaved the Pro-X-Y region into
small fragments (three to twelve amino acids in
Fig. 8. Cleavage sites found in Pro-X-Y repeat regions in rainbow
trout egg envelope protein. Amino acid sequences of the Pro-X-Y
repeat regions of rainbow trout ZPB, VEPa (A) and VEPb (B), are
shown. Broken lines above the sequences indicate repeating units.
The sequences determined from low molecular weight products in
the hatching liquid are underlined. The cleavage sites are predicted
to be AflQ, QflW and AflE, and are indicated by arrowheads.
Egg envelope digestion mechanism M. Kawaguchi et al.
4982 FEBS Journal 277 (2010) 4973–4987 ª 2010 The Authors Journal compilation ª 2010 FEBS
length). FHCE1⁄ 2 preferred to cleave the site with a
tyrosine residue at the P1¢ site of the Pro-X-Y regions.
These results suggest that not only the digestion man-
ner of Fundulus HCE, but also its substrate specificity
is similar to that of medaka HCE. Thus, the contribu-
tion of HCE to egg envelope digestion acts to frag-
ment the Pro-X-Y regions of the hardened egg
envelope, leading to the release of small fragments

from the envelope, and swelling or loosening of the
compact structure of the envelope. This contribution
of HCE would make the envelope accessible to LCE.
The HCE-swollen envelope, as a result of a lack of
Pro-X-Y repeat regions, as described above, is consid-
ered to comprise mainly the ZP domain, namely the
ZP domain of the ZPC and trefoil⁄ ZP domains of
ZPB (Fig. 5A). Such ZP domains are assembled
together to form a long filamentous structure through
their noncovalent interaction [19,20]. In medaka, it has
been proposed that the swollen envelope is formed as
filaments by the assembly of ZP domains, and cleavage
of the LCE site at the center of the ZP domain con-
tributes to the complete solubilization of the HCE-
swollen envelope [13]. Another study [21] has shown
that the ZP domain consists of two sub-domains, ZP-
N and ZP-C sub-domains, and the two sub-domains
are connected by an intervening sequence. This inter-
vening sequence is proposed to be protease-sensitive
[21]. Applying this information to the results obtained
in the present study, it is reasonable to assume that
the LCE site found at the center of ZP domain is
located within such a protease-sensitive intervening
sequence [13]. Cleavage of this site results in the com-
plete solubilization of the swollen envelope, and there-
fore this site comprises the ‘key site’ for egg envelope
solubilization.
We have been studying the molecular evolution of
teleostean hatching enzyme genes [22–24]. The phylo-
genetic tree of hatching enzyme genes suggests that

elopomorphs (basal teleosts) possess a single type of
gene. After elopomorphs branched off from the ances-
tor, duplication and diversification of the gene
occurred, and two types of hatching enzyme genes
were established. Consequently, all the euteleosts pos-
sess two hatching enzymes: HCE and LCE. However,
it remained to be clarified whether their molecular
mechanism of egg envelope digestion is conserved
among euteleosts. In the present study, we compared
the sites cleaved by hatching enzymes from lower
euteleost (rainbow trout) to higher euteleosts (Fundulus,
medaka, stickleback and spotted halibut) [25–27].
The positions of all three LCE cleavage sites were
completely conserved among higher euteleosts, and
two of them were also conserved in all the euteleosts
examined. Especially, the ‘key site’ for egg envelope
solubilization by LCE was completely conserved.
Furthermore, rainbow trout HCEs were predicted to
cleave the center of the Pro-X-Y-Pro sequence in the
Pro-X-Y repeat region, similar to Fundulus and
medaka HCEs. Therefore, the egg envelope digestion
mechanism of the HCE-LCE system was considered to
be maintained during the evolution of euteleosts. To
provide evidence for this hypothesis, further studies
using other species located between the higher and
lower euteleosts will be conducted in the future.
The present study also suggests that the digestion of
HCE and LCE depends on the macromolecular archi-
tecture of the egg envelope. Although the positions of
the HCE and LCE sites were conserved among the eu-

teleosts examined, the amino acid sequences around the
sites were not well conserved. Focusing on the sequence
around the ‘key site’, seven substitutions in 22 amino
acid residues were observed between Fundulus and
medaka (Fig. 3). Between the two species, we found
that LCE acquired species-specificity in egg envelope
digestion, whereas HCE did not (i.e. both HCEs of
Fundulus and medaka were able to swell egg envelopes
of both species, but LCE could only solubilize the swol-
len envelope of its own species) [14; Kawaguchi M.,
Yasumasu S., Iuchi I., and Nishida M. unpublished
data]. These results imply that the hatching enzyme was
adapted to the mutation of the sequences around the
‘key site’, changed its substrate specificity, and thus co-
evolved with the egg envelope protein. One of our
future aims is to clarify the mechanism of this molecu-
lar co-evolution by determining important amino acid
substitutions for species-specific digestion of LCEs.
Materials and methods
Fish
Embryos of Fundulus heteroclitus were collected every day
and cultured in tap water at 25 °C. The embryos immedi-
ately before hatch were taken out of the water, allowed to
stand in air for 30 min to induce hatching, and transferred
in a small amount of a medium consisting of a half concen-
tration of artificial seawater (Yashima Pure Chemicals Co.,
Ltd., Osaka, Japan) and 2 mm NaHCO
3
[14]. After the
embryos hatched, the medium was filtered and collected.

This medium was termed the ‘hatching liquid’.
Purification of FLCE
FLCE was purified from Fundulus hatching liquid by devel-
oping the previous purification method. All procedures,
except for HPLC, were performed in the temperature range
M. Kawaguchi et al. Egg envelope digestion mechanism
FEBS Journal 277 (2010) 4973–4987 ª 2010 The Authors Journal compilation ª 2010 FEBS 4983
0–4 °C. Ammonium sulfate powder was added to approxi-
mately 45 mL of hatching liquid derived from approxi-
mately 3000 embryos (60% saturation). The precipitate was
collected by centrifugation and dissolved in 13 mL of
50 mm bicarbonate buffer (pH 10.2). After dialysis against
the bicarbonate buffer, the clear solution was applied onto
a Toyopearl HW-50S column (Tosoh Inc., Tokyo, Japan)
equilibrated with the same buffer. The fractions having
proteolytic activity were dialyzed and applied to an
S-Sepharose column (Amersham Pharmacia Biotech,
Uppsala, Sweden) previously equilibrated with 50 mm
Tris-HCl buffer (pH 8.0). Then, the column was washed
with the same buffer, and the adsorbed protein was eluted
once with the same buffer containing 0.4 m NaCl. After
being dialyzed against 20 mm Tris-HCl buffer (pH 7.5), the
samples were subjected to a Source 15S column of the
HPLC system (Gilson, Middleton, WI, USA) and eluted
with a linear gradient of 0–400 mm NaCl in 20 mm Tris-
HCl buffer (pH 7.5).
SDS
⁄
PAGE
After SDS ⁄ PAGE (12.5% or 15%) or tricine-SDS ⁄ PAGE

(15%) was performed, the gel was stained with Coomassie
Brilliant Blue G or using a Silver Stain II Kit (Wako,
Osaka, Japan).
Estimation of caseinolytic activity
The caseinolytic activity of hatching enzyme was measured
using a 750 lL reaction mixture consisting of 83 mm Tris-
HCl (pH 8.0) and 3.3 mgÆmL
)1
of casein. The mixture was
incubated for 30 min at 30 °C. After the reaction was
stopped by adding 250 lL of 20% perchloric acid, the reac-
tion mixture was allowed to stand in an ice-cold water bath
for 10 min, and centrifuged at 18 500 g for 5 min at 4 °C.
A
280
of the supernatant was measured. The specific activity
was expressed in terms of DA
280
min
)1
Æmg protein
)1
.
Cloning of choriogenin cDNAs
First-strand cDNAs were synthesized from RNA extracted
from the liver of spawning female Fundulus using the SMART
RACE cDNA amplification Kit (Clontech, Mountain View,
CA, USA). cDNA fragments for FhChgH were obtained
using OlChgH-F and OlChgH-R primers designed from
medaka ChgH cDNA. 5¢- and 3¢-RACE PCR was performed

using gene-specific primers designed from nucleotide
sequences of the cDNA fragment. The nucleotide sequences
of the primers were: OlChgH-F: 5¢-AATCCTGCTACTTTG
GAACAGGAGCAACCG-3¢; OlChgH-R: 5¢-GTCCCACT
GGGGCAGGCTGAAAGCATTGGG-3¢;5¢-RACE: 5¢-AA
GTGAATTGGAGTCAACATGTGTACA GCC-3¢;and
3¢-RACE: 5¢-TAGCCTACACCTCCTACTATTTGGACT
CAG-3¢.
For cloning of FhChgHm cDNA, 3¢-RACE PCR and its
nested PCR were performed directly using primers designed
from the nucleotide sequence of ChgHm for Cyprinodon
variegates, which belongs to the same order as Fundulus
(Cyprinodontiformes). 5¢-RACE and its nested PCR were
performed using gene-specific primers designed from nested
3¢-RACE PCR product. The nucleotide sequences for the
primes were: 5¢-RACE (for first PCR): 5¢-GGCAAAAGCT
GAAGTTGTACCAACAGGACC-3¢;5¢-RACE (for nested
PCR): 5 ¢-TTTGGACC ACCTCCTAGCAAACTT ATTGAC-3¢;
3¢-RACE (for first PCR): 5¢-ATGTCAAGCTATAAACTG
TTGCTATGATGG-3¢; and 3¢-RACE (for nested PCR):
5¢-GCAAATATGTGACACTTCAGTGCACCAAGG-3¢.
The full-length FhChgL cDNA was amplified directly by
5¢- and 3¢-RACE PCR and their nested PCR using primers
designed from C. variegates ChgL. The primers for FhChgL
cDNA were: 5¢-RACE (for first PCR): 5¢-CCAAAGTTAT-
TAATGAAGGCATAACTGGGG-3¢;5¢-RACE (for nested
PCR): 5
¢-TAAACACGCAGGGGCACGTGGAAGTACT
GC-3¢;3¢-RACE (for first PCR): 5 ¢-CCACTACCCAAGGA
GGCACAATGTGAGCAG-3¢; and 3¢-RACE (for nested

PCR): 5 ¢-AGGCCAGTGTTCCAGTATTTCC TGGGAGAC-3¢.
The choriogenin H gene fragment of spotted halibut
Verasper variegatus was amplified from genomic DNA
using ChgH-F1 and ChgH-R1 primers and their nested
primers (ChgH-F2 and ChgH-R2). The primers were
designed from nucleotide sequences conserved in the ZP
domain of choriogenin H genes, and their sequences were:
ChgH-F1: 5¢-MCBGRBRYWATWRTSTATGAVAAYHK
DMTG-3¢; ChgH-R1: 5¢-KWVASSDKBKGGGBTWGTK
KTDGYCCARCA-3¢; ChgH-F2: 5¢-AGNYTRHYVTTCC
AGKSYMGRTA-3¢; and ChgH-R2: 5¢-ACYYKSRTYR-
CAWCCYTTKG-3¢.
Northern blotting
Ten micrograms of total RNA extracted from the spawning
female liver of Fundulus and medaka were electrophoresed
on 1% formaldehyde-agarose gel, and transferred to a
nylon membrane (Hybond N; Amersham, Piscataway, NJ,
USA). DIG-labeled DNA probes were synthesized from
ZP domains of the choriogenins of Fundulus and medaka,
and their sizes were adjusted to approximately 520 bp for
Fundulus genes and approximately 540 bp for medaka
genes. Their nucleotide positions are from 1338 to 1849
(FhChgH); from 864 to 1379 (FhChgHm); from 698 to 1222
(FhChgL); from 1122 to 1671 (OlChgH); from 1294 to 1832
(OlChgHm); and from 633 to 1160 (OlChgL). Hybridization
was performed using a protocol described previously [28].
Phylogeny
A codon-based alignment of nucleotide sequences of ZP
domains was made using the clustal x software [29] and
codonalign 2.0 software [30]. A tree was constructed

Egg envelope digestion mechanism M. Kawaguchi et al.
4984 FEBS Journal 277 (2010) 4973–4987 ª 2010 The Authors Journal compilation ª 2010 FEBS
according to the maximum likelihood method with the gen-
eralized time reversible model using raxml7.0.3 [31]. The
reliability of the tree was assessed by bootstrap values
obtained with 1000 pseudoreplicates.
Determination of the N-terminal amino acid
sequences of digests by hatching enzyme
Envelopes isolated from unfertilized egg of Fundulus were
incubated at 30 °C with FHCE1, FHCE2 or the mixture of
FHCE1 ⁄ 2 and FLCE in a buffer containing 50 mm Tris-
HCl (pH 8.0) and 0.125 m NaCl. The digested proteins
were separated by SDS ⁄PAGE and electrically blotted onto
poly(vinylidene diflouride) membrane. After staining with
Coomassie Brilliant Blue G, the band portions were cut out
and subjected to a protein sequencer (Procise 491HT;
Applied Biosystems, Foster City, CA, USA).
Determination of FHCE1
⁄
2 cleavage sites in the
Pro-X-Y repeat region of egg envelope subunit
proteins
One hundred unfertilized egg envelopes were incubated at
30 °C with FHCE1 in 20 mm Tris-HCl (pH 8) for 4 h. The
supernatant was applied to a YMC-Pack ODS-A column
(YMC Co., Ltd, Kyoto, Japan) of the HPLC system equili-
brated with 0.1% trifluoroacetic acid (TFA) and eluted
with a linear gradient of 0–36% acetonitrile in 0.1% TFA.
The elution was monitored by measuring A
215

. Then, major
fractions were subjected to a protein sequencer (Procise
491HT; Applied Biosystems). The cleavage sites were deter-
mined by N-terminal sequencing and also deduced from a
comparison between the observed values of monoisotopic
molecular weight determined by a AXIMA-Performance
mass spectrometer (Shimadzu, Kyoto, Japan) using
a-cyano-4-hydroxycinnamic acid as a matrix and the
deduced molecular weight of the partial sequence of
FhChgH or FhChgHm cDNAs.
To confirm the sites more precisely, we first prepared a
recombinant protein possessing the Pro-X-Y repeat region.
cDNA for the Pro-X-Y repeat region of FhChgH
from Gln27 to Pro236 was amplified by PCR. A forward
(5¢-CATATGCAGAAGGGTTATCCACAACAGCC-3¢)and
reverse (5¢-GGATCCTTAATGATGATGATGATGAGGG
GTGGGAACTCCAGGGG-3¢) primer were designed con-
taining suitable restriction enzyme sites (BamHI and NdeI)
for cloning into a pET3c vector for expression in Escherichi-
a coli with His tag at the C-terminal. The amino acid
sequences are shown in Fig. 6C. The recombinant protein
containing the Pro-X-Y repeat region of FhChgH is briefly
referred to as rec.FhChgH_ProXY. E. coli strain One Shot
BL21 Star (DE3) (Invitrogen, Carlsbad, CA, USA) harbor-
ing the rec.FhChgH_ProXY expression plasmid was culti-
vated at 37 °C in LB medium (0.1 mgÆmL
)1
carbenicillin)
and induced when A
600

of 0.6 was reached with 1 mm isopro-
pyl thio-b-d-galactoside. After 4 h of induction, the cells
were harvested by centrifugation. The cells from a 250 mL
E. coli culture were suspended in 10 mL of 50 mm Tris-HCl
(pH 8) and frozen at )20 °C. After incubation with
3mgÆmL
)1
lysozyme at 37 °C, the cells were ruptured by
sonication. Because rec.FhChgH_ProXY was obtained as
water-soluble protein, the supernatant was applied to Ni-
NTA Superflow (Qiagen, Valencia, CA, USA), and eluted
once with 20 mm Tris-HCl buffer (pH 8) containing 0.3 m
imidazole and 0.15 m NaCl. The fraction thus obtained was
purified by the HPLC system using a YMC-Pack ODS-A
column (YMC Co., Ltd).
Next, FHCE cleavage sites were determined using
rec.FhChgH_ProXY. A 200 lL reaction mixture consisting
of 250 nm rec.FhChgH_ProXY as substrate and an appro-
priate amount of FHCE1 or FHCE2 in 50 mm Tris-HCl
(pH 8) was incubated at 30 °C for 90 min. The reaction
was stopped by the addition of 4 lL of 0.5 m EDTA. The
mixtures were applied onto a YMC-Pack ODS-A (YMC
Co., Ltd) of the HPLC system equilibrated with 0.1% TFA
and eluted with a linear gradient of 0–36% acetonitrile in
0.1% TFA. All the fractions were subjected to MALDI-
TOF-MS analysis to predict FHCE1⁄ 2 sites in
rec.FhChgH_ProXY.
Estimation of the activity of FHCE1
⁄
2 or FLCE

using synthetic peptides as substrate
Synthetic peptides consisting of eight or 11 amino acid resi-
dues were used to determine the cleaving efficiency of
FHCE1, FHCE2 and FLCE. The peptides were designed
from the sequences around FHCE1 ⁄ 2 and FLCE cleavage
sites. A 40 lL reaction mixture consisting of 100 lm of the
peptide in 50 mm Tris-HCl (pH 8) and an appropriate
amount of enzyme was incubated at 30 °C for 30 min.
After the reaction was stopped by the addition of 0.8 lLof
0.5 m EDTA, the mixtures were applied onto a YMC-Pack
ODS-A column (YMC Co., Ltd) of the HPLC system
equilibrated with 0.1% TFA and eluted with a linear gradi-
ent of 0–36% ⁄ 0–54% (i.e. depending on the substrates)
acetonitrile in 0.1% TFA. The elution was monitored by
measuring A
215
. The activity was calculated from the ratio
of peak area of digested peptides relative to that of digested
and undigested peptides. The cleavage sites were confirmed
either with amino acid sequencing or by MALDI-TOF-MS
analysis.
Determination of cleavage sites in the Pro-X-Y
repeat region from rainbow trout hatching liquid
Rainbow trout hatching liquid was applied to a YMC-Pack
ODS-A column (YMC Co., Ltd) of the HPLC system equili-
brated with 0.1% TFA and eluted with a linear gradient of
M. Kawaguchi et al. Egg envelope digestion mechanism
FEBS Journal 277 (2010) 4973–4987 ª 2010 The Authors Journal compilation ª 2010 FEBS 4985
0–72% acetonitrile in 0.1% TFA. Major peaks eluted from
30 to 40% acetonitrile were collected and subjected to a

protein sequencer (Procise 491HT; Applied Biosystems) to
determine cleavage sites.
Acknowledgements
We thank Dr Hiroshi Takahashi (National Fisheries
University) and Mr Yu-ichiro Meguro (Hokkaido Uni-
versity) for obtaining three-spined stickleback embryos,
as well as Mr Daisuke Shimizu (Miyako Station,
National Center for Stock Enhancement, Fisheries
Research Agency) for providing spotted halibut
embryos. The present study was supported in part by
a Grant-in-Aid for JSPS Fellows to M.K., and Grant-
in-Aid for Scientific Research (C) from JSPS to S.Y.
References
1 Yamagami K, Hamazaki TS, Yasumasu S, Masuda K
& Iuchi I (1992) Molecular and cellular basis of forma-
tion, hardening, and breakdown of the egg envelope in
fish. Int Rev Cytol 136, 51–92.
2 Yamagami K (1992) Studies on the hatching enzyme
and its substrate, egg envelope of Oryzias latipes. Zool
Sci 9, 1131.
3 Yamagami K (1996) Studies on the hatching enzyme
(choriolysin) and its substrate, egg envelope,
constructed of the precursors (choriogenins) in Oryzias
latipes: a sequel to the information in 1991 ⁄ 1992.
Zoolog Sci 13, 331–340.
4 Hamazaki TS, Iuchi I & Yamagami K (1987) Isolation
and parial characterization of a spawning female-
specific substance in the teleost, Oryzias latipes. J Exp
Zool 242, 343–349.
5 Murata K, Sugiyama H, Yasumasu S, Iuchi I,

Yasumasu I & Yamagami K (1997) Cloning of cDNA
and estrogen-induced hepatic gene expression for chori-
ogenin H, a precursor protein of the fish egg envelope
(chorion). Proc Natl Acad Sci USA 94, 2050–2055.
6 Sugiyama H, Yasumasu S, Murata K, Iuchi I &
Yamagami K (1998) The third egg envelope subunit in
fish: cDNA cloning and analysis, and gene expression.
Dev Growth Differ 40, 35–45.
7 Murata K, Sasaki T, Yasumasu S, Iuchi I, Enami J,
Yasumasu I & Yamagami K (1995) Cloning of cDNAs
for the precursor protein of a low-molecular-weight
subunit of the inner layer of the egg envelope (chorion)
of the fish Oryzias latipes. Dev Biol 167, 9–17.
8 Rankin T & Dean J (2000) The zona pellucida: using
molecular genetics to study the mammalian egg coat.
Rev Reprod 5, 114–121.
9 Kanamori A, Naruse K, Mitani H, Shima A & Hori H
(2003) Genomic organization of ZP domain containing
egg envelope genes in medaka (Oryzias latipes). Gene
305, 35–45.
10 Lee KS, Yasumasu S, Nomura K & Iuchi I (1994)
HCE, a constituent of the hatching enzymes of Oryzias
latipes embryos, releases unique proline-rich
polypeptides from its natural substrate, the hardened
chorion. FEBS Lett 339, 281–284.
11 Yasumasu S, Iuchi I & Yamagami K (1989) Purification
and partial characterization of high choriolytic enzyme
(HCE), a component of the hatching enzyme of the
teleost, Oryzias latipes. J Biochem 105, 204–211.
12 Yasumasu S, Iuchi I & Yamagami K (1989) Isolation

and some properties of low choriolytic enzyme (LCE), a
component of the hatching enzyme of the teleost,
Oryzias latipes. J Biochem 105, 212–218.
13 Yasumasu S, Kawaguchi M, Ouchi S, Sano K, Murata
K, Sugiyama H, Akama T & Iuchi I (2010) Mechanism
of egg envelope digestion by hatching enzymes, HCE
and LCE in medaka, Oryzias latipes. J Biochem 148,
439–448.
14 Kawaguchi M, Yasumasu S, Shimizu A, Hiroi J,
Yoshizaki N, Nagata K, Tanokura M & Iuchi I (2005)
Purification and gene cloning of Fundulus heteroclitus
hatching enzyme. A hatching enzyme system composed
of high choriolytic enzyme and low choriolytic enzyme
is conserved between two different teleosts, Fundulus
heteroclitus and medaka Oryzias latipes. FEBS J 272 ,
4315–4326.
15 Hamazaki TS, Nagahama Y, Iuchi I & Yamagami K
(1989) A glycoprotein from the liver constitutes the
inner layer of the egg envelope (zona pellucida interna)
of the fish, Oryzias latipes. Dev Biol 133, 101–110.
16 Sugiyama H, Murata K, Iuchi I, Nomura K &
Yamagami K (1999) Formation of mature egg envelope
subunit proteins from their precursors (choriogenins) in
the fish, Oryzias latipes: loss of partial C-terminal
sequences of the choriogenins. J Biochem 125, 469–475.
17 Schechter I & Berger A (1967) On the size of the active
site in proteases. I. Papain. Biochem Biophys Res
Commun 27, 157–162.
18 Bertenshaw GP, Turk BE, Hubbard SJ, Matters GL,
Bylander JE, Crisman JM, Cantley LC & Bond JS

(2001) Marked differences between metalloproteases
meprin A and B in substrate and peptide bond
specificity. J Biol Chem 276, 13248–13255.
19 Darie CC, Janssen WG, Litscher ES & Wassarman PM
(2008) Purified trout egg vitelline envelope proteins
VEbeta and VEgamma polymerize into homomeric
fibrils from dimers in vitro. Biochim Biophys Acta 1784,
385–392.
20 Litscher ES, Janssen WG, Darie CC & Wassarman PM
(2008) Purified mouse egg zona pellucida glycoproteins
polymerize into homomeric fibrils under non-denaturing
conditions. J Cell Physiol 214, 153–157.
Egg envelope digestion mechanism M. Kawaguchi et al.
4986 FEBS Journal 277 (2010) 4973–4987 ª 2010 The Authors Journal compilation ª 2010 FEBS
21 Jovine L, Darie CC, Litscher ES & Wassarman PM
(2005) Zona pellucida domain proteins. Annu Rev
Biochem 74, 83–114.
22 Kawaguchi M, Yasumasu S, Hiroi J, Naruse K, Inoue
M & Iuchi I (2006) Evolution of teleostean hatching
enzyme genes and their paralogous genes. Dev Genes
Evol 216, 769–784.
23 Kawaguchi M, Yasumasu S, Hiroi J, Naruse K, Suzuki T
& Iuchi I (2007) Analysis of the exon-intron structures of
fish, amphibian, bird and mammalian hatching enzyme
genes, with special reference to the intron loss evolution
of hatching enzyme genes in Teleostei. Gene 392, 77–88.
24 Kawaguchi M, Hiroi J, Miya M, Nishida M, Iuchi I &
Yasumasu S (2010) Intron-loss evolution of hatching
enzyme genes in Teleostei. BMC Evol Biol 10, 260.
25 Nelson JS (2006) Fishes of the World, 4th edn. John

Wiley & Sons, Inc., Hoboken, NJ.
26 Miya M, Takeshima H, Endo H, Ishiguro NB, Inoue
JG, Mukai T, Satoh TP, Yamaguchi M, Kawaguchi A,
Mabuchi K et al. (2003) Major patterns of higher
teleostean phylogenies: a new perspective based on 100
complete mitochondrial DNA sequences. Mol
Phylogenet Evol 26, 121–138.
27 Ishiguro NB, Miya M & Nishida M (2003) Basal
euteleostean relationships: a mitogenomic perspective
on the phylogenetic reality of the ‘Protacanthopterygii’.
Mol Phylogenet Evol 27, 476–488.
28 Kawaguchi M, Nakagawa M, Noda T, Yoshizaki N,
Hiroi J, Nishida M, Iuchi I & Yasumasu S (2008)
Hatching enzyme of ovoviviparous black
rockfish Sebastes schlegelii: environmental adaptation
of hatching enzyme and evolutionary aspects
of formation of pseudogene. FEBS J 275, 2884–
2898.
29 Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F
& Higgins DG (1997) The CLUSTAL_X windows
interface: flexible strategies for multiple sequence
alignment aided by quality analysis tools. Nucleic Acids
Res 25, 4876–4882.
30 Hall BG (2005) CodonAlign. In Phylogenetic Trees
Made Easy, 2nd edn. pp. 7. Sinauer Associates Inc,
Sunderland, MA.
31 Stamatakis A (2006) RAxML-VI-HPC: maximum
likelihood-based phylogenetic analyses with thousands
of taxa and mixed models. Bioinformatics 22, 2688–
2690.

M. Kawaguchi et al. Egg envelope digestion mechanism
FEBS Journal 277 (2010) 4973–4987 ª 2010 The Authors Journal compilation ª 2010 FEBS 4987