Báo cáo khoa học: MicroRNA-9 inhibits ovarian cancer cell growth through regulation of NF-jB1 ppt

MicroRNA-9 inhibits ovarian cancer cell growth through
regulation of NF-jB1
Li-Min Guo*, Yong Pu*, Zhe Han*, Tao Liu, Yi-Xuan Li, Min Liu, Xin Li and Hua Tang
Tianjin Life Science Research Center and Basic Medical School, Tianjin Medical University, China
Introduction
Ovarian cancer remains a leading cause of morbidity
and mortality, with little change in survival rates over
the past 30 years. Previous studies have revealed sev-
eral genes related to human ovarian cancer [1], but
the common molecular mechanisms of ovarian cancer
remain to be elucidated. Although focusing on known
genes has already yielded new information, previously
unknown noncoding RNAs, such as microRNAs
(miRNAs), may also lend insight into the biology of
ovarian cancer. Since their discovery [2–5], miRNAs
have emerged as integrated and important post-tran-
scriptional regulators of gene expression in animals
and plants [6,7]. MicroRNAs are 21-23-nucleotide
regulatory RNAs processed from 70–100-nucleotide
hairpin pre-miRNAs. Their 5¢-end binds to a target
complementary sequence in the 3¢-UTR of mRNA
and, given the degree of complementarity, miRNA
binding appears to result in translational repression,
or in some cases, cleavage of cognate mRNAs, caus-
ing partial or full silencing of the respective protein
coding genes. As a new layer of gene-regulation
mechanism, miRNAs have diverse functions, includ-
ing the regulation of cellular differentiation, prolifera-
tion and apoptosis, as well as cancer initiation and
progression [8,9]. Indeed, a number of studies have
reported differentially regulated miRNAs in diverse

cancer types such as breast cancer [10], lung cancer
[11], chronic lymphocytic leukemia [12], colon cancer
Keywords
cell growth; miR-9; NF-jB1; ovarian cancer;
target gene
Correspondence
H. Tang, Tianjin Life Science Research
Center and Basic Medical School,
Tianjin Medical University, Tianjin 300070,
China
Fax: +86 22 2354 2503
Tel: +86 22 2354 2503
E-mail:
*These authors contributed equally to this
work
(Received 21 January 2009, revised 18 July
2009, accepted 24 July 2009)
doi:10.1111/j.1742-4658.2009.07237.x
MicroRNAs are emerging as important regulators of cancer-related pro-
cesses. Our studies show that microRNA-9 (miR-9) is downregulated in
human ovarian cancer relative to normal ovary, and overexpression of
miR-9 suppresses cell growth in vitro. Furthermore, the 3¢-UTR of NF-jB1
mRNA is found to be regulated directly by miR-9, demonstrating that
NF-jB1 is a functionally important target of miR-9 in ovarian cancer
cells. When miR-9 is overexpressed in ovarian cancer cells, the mRNA and
protein levels of NF-jB1 are both suppressed, whereas inhibition of
miR-9 results in an increase in the NF-jB1 expression level. Ovarian cancer
tissues display significantly low expression of miR-9 and a high level of
NF-jB1 compared with normal tissues, indicating that regulation of
NF-jB1 by miR-9 is an important mechanism for miR-9 to inhibit ovarian

cancer proliferation.
Abbreviations
ASO, antisense oligonucleotide; EGFP, enhanced green fluorescence protein; miR-9, microRNA-9; miRNA, microRNA; MTT, 3-(4,5-
dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide; NF-jB, nuclear factor of kappaB.
FEBS Journal 276 (2009) 5537–5546 ª 2009 The Authors Journal compilation ª 2009 FEBS 5537
[13], thyroid carcinoma [14] and pancreatic cancer
[15].
During tumorigenesis and development, overexpres-
sed miRNAs may potentially target tumor suppressor
genes, whereas downregulated miRNAs would theoret-
ically regulate oncogenes. For example, the let-7 miR-
NAs, which have low expression in lung cancer, can
negatively regulate the oncogenes RAS [16] and
HMGA2 [17], resulting in the upregulation of these
oncogenes. Conversely, miR-27a, which is highly
expressed in gastric adenocarcinoma and breast cancer,
acts as an oncogene by downregulating tumor suppres-
sor genes [18,19]. These facts indicate that miRNAs
may play a critical role in cancer-related processes.
Here, we elucidate a general reduction in miR-9 level
in ovarian cancer tissues compared with normal tis-
sues. In ovarian cancer cell line ES-2, overexpression
of miR-9 could suppress cell growth, which showed a
dose-dependent effect. Subsequent experiments con-
firmed that nuclear factor jB1 (NF-jB1) was a target
of miR-9 and was downregulated by miR-9 at both
the transcriptional level and the translational level.
These results suggest that regulation of NF-jB1 by
miR-9 is a mechanism by which miR-9 may inhibit
ovarian cancer proliferation.

Results
miR-9 is downregulated in ovarian cancer cells
Currently, almost all of the miRNA-related studies on
cancers are based on the different expression profile of
miRNAs in cancer cells versus normal cells. Thus,
methods used to detect mRNA expression can also be
used in studies on the potential roles of miRNAs in
cancers [20] and a recent study reported that miR-9
may be of potential importance as biomarker in recur-
rent ovarian cancer. Results show that miR-9 was
downregulated in recurrent cancers [21]. We were
therefore led to ask whether miR-9 was downregulated
in ovarian cancer relative to normal ovary. Using real-
time RT-PCR, we compared miR-9 expression profiles
between four pairs of ovarian cancers and normal
ovarial tissues. As a result, miR-9 showed on average
0.3-fold lower expression in ovarian cancer tissues than
in normal ovarial tissues (Fig. 1), suggesting that
miR-9 was downregulated in ovarian cancers.
Overexpression of miR-9 suppresses cell growth
in vitro
Previous studies have indicated that miR-9 is seen to
be markedly downregulated in ovarian cancers, and
may function as a tumor suppressor gene. Thus, we
tested whether overexpression of miR-9 in ES-2 cells
could affect cell growth. In a 3-(4,5-dimethylthiazol-
2-yl)-2,5-diphenyl-tetrazolium bromide (MTT) assay,
cells transfected with miR-9 expression vector
pcDNA3B ⁄ pri-iR-9 were found to grow more slowly
than the control group, with an inhibition of  30%

(Fig. 2A). Moreover, as the concentration of
pcDNA3B ⁄ pri-miR-9 increased in transfection, cell
proliferation activity showed a gradual decrease, indi-
cating the dose-dependent effect of miR-9 on the inhi-
bition of cell proliferation (Fig. 2B). We also found
that overexpression of miR-9 suppressed cell growth in
a time-dependent manner. Although there was no dif-
ference between control and pcDNA3B ⁄ pri-miR-9
groups during the first 2 days after transfection, exoge-
nously expressed miR-9 in ES-2 cells caused a 20%
reduction in cell proliferation at 72 h after transfection
(Fig. 2C). These results indicated that the expression
level of miR-9 had an influence on cell growth. To fur-
ther validate the antiproliferative effect of miR-9 on
the growth of ES-2 cells, a colony formation assay was
performed. It was shown that the colony number of
ES-2 cells transfected with pcDNA3B ⁄ pri-miR-9 was
significantly lower than those transfected with control
vector (Fig. 2D). The dramatic contrast in colony
formation activity indicated that overexpression of
miR-9 could suppress the colony formation activity of
ES-2 cells. These results were consistent with the MTT
assay and further suggested that overexpression of
miR-9 suppresses cell growth in vitro.
Fig. 1. Dysregulation of miR-9 in ovarian cancer tissues. The miR-9
expression level of four pairs of human ovarian cancer tissue sam-
ples (Ca) and four matched normal ovarial tissue samples (N) was
detected by real-time RT-PCR. The relative expression of miR-9
was defined as: quantity of miR-9 ⁄ quantity of U6 in the same sam-
ple. The expression of normal ovarian samples was regarded as the

normalizer and the relative miR-9 quantity (mean ± SD) are shown
(*P < 0.05).
MiR-9 inhibits ovarian cancer cell growth L M. Guo et al.
5538 FEBS Journal 276 (2009) 5537–5546 ª 2009 The Authors Journal compilation ª 2009 FEBS
NF-jB1 is a candidate target of miR-9
According to the above data, we hypothesized that
miR-9 might inhibit the malignant phenotype of ovar-
ian cancer cells by regulating oncogenes and ⁄ or genes
that control cell proliferation or apoptosis [20]. Thus,
to investigate how miR-9 operates during the progres-
sion of ovarian cancer, we tried to search for the target
genes of miR-9. The gene that was predicted by all the
three algorithm programs (pictar, targetscan and
mirbase targets) was chosen as the candidate target
of miR-9. Among these genes, NF-jB1, a transcription
regulator that is involved in a wide variety of biologi-
cal functions, was found to have a putative miR-9
binding site within its 3¢-UTR. We therefore chose it
for further research.
NF-jB1 gene 3¢-UTR carries a putative miR-9
binding site and is negatively regulated by miR-9
It is well known that miRNAs cause mRNA cleavage
or translational repression by forming imperfect base
pairing with the 3¢-UTR of target genes. Further-
more, the 2–8 nucleotides of miRNA, known as the
‘seed region’, are suggested to be the most important
factor for target recognition [22]. Therefore, we pre-
dicted that NF-jB1 mRNA 3¢-UTR might contain a
miR-9 binding site, which was reversed complemen-
tary with the miR-9 ‘seed region’. With the help of

the TargetScan database, we found a binding site for
miR-9 in NF-jB1 mRNA 3¢-UTR (Fig. 3A). To con-
firm that miR-9 can bind to this region and cause
translational repression, we constructed an enhanced
green fluorescence protein (EGFP) reporter vector.
ES-2 cells were transfected with the reporter vector
along with pcDNA3B ⁄ pri-miR-9 or control vector.
As a result, the intensity of EGFP fluorescence in
pcDNA3B ⁄ pri-miR-9-treated cells is significantly
lower than that in the control vector group (Fig. 3B).
Similarly, we constructed another EGFP reporter vec-
tor containing the mutational NF-jB1 3¢-UTR
(Fig. 3A). It was shown that overexpression of miR-9
could not affect the intensity of EGFP fluorescence in
this 3¢-UTR mutant vector (Fig. 3C). These facts sug-
gested that miR-9 may bind directly to the 3¢-UTR
of NF-jB1 mRNA and repress gene expression.
These data highlight the prediction that NF-jB1 is a
direct target for miR-9.
Fig. 2. Overexpression of miR-9 suppresses
cell growth in vitro. (A) Cell growth was
measured using the 3-(4,5-dimethylthiazol-2-
yl)-2,5-diphenyl-tetrazolium bromide (MTT)
assay. ES-2 cells were transfected with
pcDNA3B ⁄ pri-miR-9 (Pri-miR-9) or control
vector (Ctrl) and at 72 h post transfection
the MTT assay was performed. The histo-
gram shows mean (± SD) of A
n
from three

independent experiments (*P < 0.05).
(B) A gradually increased concentration of
pcDNA3B ⁄ pri-miR-9 (pri-miR-9) from 0 to
15 ngÆlL
)1
was transfected into ES-2 cells
and the dose-dependent anti-proliferative
effects were detected using the MTT assay.
(C) ES-2 cells were transfected with
pcDNA3B ⁄ pri-miR-9 and he MTT assay was
used to determine relative cell growth activ-
ity at 24, 48 and 72 h. (D) The effect of
miR-9 on cell proliferation was evaluated
using a colony formation assay. ES-2 cells
were transfected with pcDNA3B ⁄ pri-miR-9
(Pri-miR-9) or control vector (Ctrl) at a final
concentration of 10 ngÆlL
)1
and then
seeded in 12-well plates. The number of
colonies was counted at the sixth day after
seeding and the colony formation rate was
calculated (*P < 0.05).
L M. Guo et al. MiR-9 inhibits ovarian cancer cell growth
FEBS Journal 276 (2009) 5537–5546 ª 2009 The Authors Journal compilation ª 2009 FEBS 5539
MiR-9 regulates NF-jB1 mRNA and protein
expression in ES-2 cells
miRNAs may suppress the expression of target genes
through translational repression or degradation of a
target’s transcript. To assess whether miR-9 had a

functional role in the downregulation of endogenous
NF-jB1 expression, ES-2 cells were transfected with the
miR-9 blockage, known as miR-9 antisense oligonucleo-
tide (ASO) or pcDNA3B ⁄ pri-miR-9 to alter the miR-9
expression level; the NF-jB1 mRNA level was measured
by real-time RT-PCR. As a result, when miR-9 was
blocked, NF-j B1 mRNA was elevated compared with
the control group, with an 80% increase (Fig. 4A).
Conversely, when miR-9 was enhanced, NF-jB1
mRNA showed a 30% decrease compared with the
control group (Fig. 4B), indicating that miR-9 could
downregulate the endogenous NF-jB1 mRNA level.
Furthermore, the effects of miR-9 on NF-jB1 protein
expression in ES-2 cells were examined using a western
blot assay. It was shown that knockdown of miR-9
enhanced NF-jB1 protein expression, including its
cytoplamsic precursor p105 and corresponding process-
ing product p50 (Fig. 4C). By contrast, overexpression
of miR-9 reduced the NF-jB1 protein level (Fig. 4D).
These results demonstrated that miR-9 regulates endog-
enous NF-jB1 expression through both the mRNA
degradation and translational repression pathways.
To confirm the validity of miR-9 blocking or over-
expression, we checked the expression level of miR-9
using real-time RT-PCR, and found that when ES-2
cells were transfected with miR-9 ASO, the miR-9 level
was decreased 60% (Fig. 4E). Conversely, the miR-9
level in pcDNA3B ⁄ pri-miR-9 transfected ES-2 cells was
enhanced 5.05-fold in contrast to the control group
(Fig. 4F). These data indicated that miR-9 was indeed

altered by the blockage or the expression vector.
NF-jB1 is overexpressed in ovarian cancer
tissues
Given that miR-9 is downregulated in ovarian cancer
and that NF-jB1 is a target of miR-9, we hypothesized
that NF-jB1 might be overexpressed in ovarian cancer
tissues relative to normal tissues. A real-time RT-PCR
assay was used to detect the NF-jB1 profile in four
pairs of ovarian cancer tissue samples and normal
ovarian tissue samples. As a result, NF-jB1 mRNA
had on average 1.96-fold higher expression in ovarian
cancer tissues than in normal ovarial tissues (Fig. 5),
which is consistent with the dysregulation of miR-9 in
ovarian cancer.
Fig. 3. Validation of NF-jB1 as the target of miR-9 by fluorescent reporter assay. (A) As predicted in the TargetScan database, the NF-jB1
3¢-UTR carries a miR-9 binding site. The NF-jB1 3¢-UTR mutation containing a mutated miR-9 ‘‘seed region’ binding site is shown. Arrows
indicate the mutated nucleotides. (B) ES-2 cells were transfected with the pcDNA3 ⁄ EGFP-NF-jB1 3¢-UTR reporter vector (EGFP-NF-jB1
3¢-UTR) and pcDNA3B ⁄ pri-miR-9 (Pri-miR-9) or control vector. Cells were lysed at 72 h after transfection and the intensity of EGFP fluores-
cence was detected. The RFP expression vector pDsRed2-N1 was spiked in and used for normalization (*P < 0.05). (C) ES-2 cells were
transfected with the pcDNA3 ⁄ EGFP-NF-jB1 3¢-UTR mutation reporter vector (EGFP-NF-jB1 3¢-UTR mutant) as well as pcDNA3B ⁄ pri-miR-9
(Pri-miR-9) or control vector and the fluorescent intensity was detected (**P > 0.05).
MiR-9 inhibits ovarian cancer cell growth L M. Guo et al.
5540 FEBS Journal 276 (2009) 5537–5546 ª 2009 The Authors Journal compilation ª 2009 FEBS
Knockdown of NF-jB1 inhibits ES-2 cells growth
in vitro
An abundance of data indicates that the IjB kinase and
NF-jB subunits can act to promote tumorigenesis, and
NF-jB functions as a tumor promoter [23]. Hence, we
tested whether knockdown of NF-jB1 affects cell
growth. The siRNA expression vector pSilencer ⁄ si-NF-

jB1 was constructed, and by transfection with pSilencer ⁄
si-NF-jB1, the endogenous NF-jB1 expression was
effectively suppressed, with a 50% decrease for P105 and
a 40% decrease for P50 (Fig. 6A) Next, pSilencer⁄ si-NF-
jB1 was transiently transfected into ES-2 cells and cell
growth activity was detected using a MTT assay. It was
indicated that knockdown of NF-jB1 suppressed cell
growth in a time-dependent manner. A significant reduc-
tion in cell proliferation was found at 72 h post transfec-
tion, with  20% inhibition (Fig. 6B), similar to the
effect of pri-miR-9 on ovarian cell growth (Fig. 2C).
These results are consistent with the finding that overex-
pression of miR-9 suppresses cell growth in vitro, provid-
ing further evidence that NF-jB1 is involved in miR-9-
mediated suppression of ovarian cancer. Accordingly,
identification of NF-jB1 as a miR-9 target gene may
explain, at least in part, why overexpression of miR-9
suppresses cell growth.
Fig. 4. MiR-9 regulates NF-jB1 at transcrip-
tional and translational level. (A,B) Large
RNA was extracted from ES-2 cells trans-
fected with miR-9 ASO [anti-(miR-9)] or
control oligonucleotides (Ctrl); pcDNA3B ⁄
pri-miR-9 (Pri-miR-9) or control vector (Ctrl),
and the NF-jB1 mRNA level was measured
by real-time RT-PCR. b-actin mRNA was
regarded as the endogenous normalizer.
The relative NF-jB1 expression level
(mean ± SD) is shown (*P < 0.05). (C,D)
Protein was extracted from ES-2 cells trans-

fected with miR-9 ASO [anti-(miR-9)] or
control oligonucleotides (Ctrl); pcDNA3B ⁄
pri-miR-9 (Pri-miR-9) or control vector (Ctrl),
and the NF-jB1 protein level was measured
by western blotting. GAPDH protein was
regarded as the endogenous normalizer and
the relative NF-jB1 protein level is shown
(*P < 0.05). (E,F) Small RNA was extracted
from ES-2 cells transfected with miR-9 ASO
[anti-(miR-9)] or control oligonucleotides
(Ctrl); pcDNA3B ⁄ pri-miR-9 (Pri-miR-9) or con-
trol vector (Ctrl), and the expression of
miR-9 was measured by real-time RT-PCR.
U6 snRNA was regarded as the endogenous
normalizer and the relative miR-9 expression
level (mean ± SD) is shown (*P < 0.05).
L M. Guo et al. MiR-9 inhibits ovarian cancer cell growth
FEBS Journal 276 (2009) 5537–5546 ª 2009 The Authors Journal compilation ª 2009 FEBS 5541
Discussion
miRNA expression correlates with various cancers,
and miRNAs are thought to function as either tumor
suppressors or oncogenes. A recent study reported that
miR-9 may be of potential importance as a biomarker
in recurrent ovarian cancer. Expression of 180 miR-
NAs was detected in primary and recurrent serous
papillary adenocarcinomas, and the result showed that
miR-9 was downregulated in recurrent cancers [21]. In
early breast cancer development, miR-9 was also trans-
criptionally downregulated in a methylation-dependent
way [24].

Previous studies led us to ask whether miR-9 was
dysregulated in ovarian cancer compared with normal
ovary [25]. Given that miR-9 has a lower expression
level in cancer cells, we used a gain-of-function
approach by transfecting the ovarian cancer cell line
ES-2 with miR-9 expression vector pcDNA3B ⁄ pri-
miR-9. In the MTT assay, overexpression of miR-9
resulted in cell growth arrest, which showed dose-
dependent and time-dependent effects. In addition, col-
ony formation is typical of malignant transformed
cells, and is inconspicuous in normal cells. Using a
colony formation assay, we found that the colony for-
mation activity of ES-2 cells transfected with
pcDNA3B ⁄ pri-miR-9 was significantly suppressed.
Also, we tend to believe that miR-9 affects ovarian cell
growth activity over the long term, because the inhibi-
tion rate of pri-miR-9 in the MTT assay was not as
significant as in the colony formation assay. These
experiments indicated that miR-9 overexpressed ovar-
ian cancer cells showed a suppression of malignant
phenotypes, suggesting the role of miR-9 in the growth
inhibition of malignant cells.
The fundamental function of miRNA is to regulate
their targets by direct cleavage of the mRNA or by
inhibition of protein synthesis, according to the degree
of complementarity with their target 3¢-UTRs. Identifi-
cation of miRNA target genes has been a great
Fig. 5. Dysregulation of NF-jB1 in ovarian cancer tissue samples.
The NF-jB1 expression level in the four pairs of human ovarian can-
cer tissue samples (Ca) and matched four normal ovarial tissue

samples (N) was detected by real-time RT-PCR. b-actin mRNA was
regarded as the endogenous normalizer and the relative NF-jB1
expression level (mean ± SD) is shown (*P < 0.05).
Fig. 6. Knockdown of NF-jB1 inhibits growth of ES-2 cells in vitro.
(A) The validity of pSilencer ⁄ si-NF-jB1 (si-NF-jB1) was examined in
ES-2 cells by western blotting with anti-(NF-jB1) serum and the
relative protein level is shown (*P < 0.05). (B) Knockdown of NF-jB1
suppresses cell growth in a time-dependent manner. Growth of ES-2
cells transfected with pSilencer ⁄ si-NF-jB1 (si-NF-jB1) showed a
20% reduction at 72 h post-transfection. Values are means ± SD of
three independent experiments and the relative cell growth activity
is shown (*P < 0.05).
MiR-9 inhibits ovarian cancer cell growth L M. Guo et al.
5542 FEBS Journal 276 (2009) 5537–5546 ª 2009 The Authors Journal compilation ª 2009 FEBS
challenge. Computational algorithms have been the
major driving force in predicting miRNA targets,
which are based mainly on base pairing of miRNA
and target gene 3¢-UTR [26–28]. According to the pre-
diction result, NF-jB1 is found to have a putative
miR-9 binding site within its 3¢-UTR; we therefore
chose it for further research.
An effective method to identify the direct targets of
miRNAs is the fluorescent reporter assay. We used an
EGFP-NF-jB1 3¢-UTR reporter vector in the fluores-
cent report assay and found a decrease in EGFP inten-
sity following overexpresstion of miR-9. Furthermore,
when another reporter vector containing a mutational
miR-9 ‘seed region’ binding site was used in the
fluorescent reporter assay, overexpresstion of the
miR-9-mediated fluorescent decrease could no longer

be detected. These results suggested that miR-9 can
bind directly to the NF-jB1 3¢-UTR and negatively
regulate NF-jB1 gene expression. In addition, using
quantitative RT-PCR and western blotting, we con-
firmed that overexpression of miR-9 could cause the
decrease in NF-jB1 mRNA and protein levels, whereas
inhibition of miR-9 results in an increase in NF-jB1
expression levels. Furthermore, NF-jB1 displayed a
higher expression level in ovarian cancer tissues com-
pared with normal ovary, which is consistent with the
dysregulation of miR-9 in ovarian cancer. These data
indicated that NF-jB1 is a direct target of miR-9.
According to existing research, NF-jB transcription
factors can both induce and repress gene expression by
binding to discrete DNA sequences, known as jB ele-
ments, in promoters and enhancers. In mammalian
cells, there are five NF-jB family members, RelA
(p65), RelB, c-Rel, p50 ⁄ p105 (NF-jB1) and p52 ⁄ p100
(NF-jB2), and different NF-jB complexes are formed
from their homodimers and heterodimers. In most cell
types, NF-jB complexes are retained in the cytoplasm
by a family of inhibitory proteins known as inhibitors
of NF-jB(IjB). Activation of NF-jB typically
involves the phosphorylation of IjBbyIjB kinase
complex, which results in IjB degradation. This
releases NF-jB and allows it to translocate freely to
the nucleus [29].
An abundance of data indicates that the IjB kinases
and NF-jB subunits can act to promote tumorigenesis,
and this subject has been extensively reviewed else-

where [30]. Briefly, the pro-oncogenic effect of NF-jB
can be thought of as arising from the overproduction
of its normal target genes as a consequence of its
chronic activation and nuclear localization in tumor
cells. For example, NF-jB can stimulate tumor cell
survival through the continual induction of anti-apop-
totic genes such as Bcl-xL, X-IAP, cIAP1 and cIAP2,
and A20[31]. Through this antiapoptotic activity,
NF-jB can also reduce the effectiveness of many
common cancer therapies, which themselves activate
NF-kB. By regulating gene expression, NF-jB can also
promote other oncogenic processes including tumor
cell proliferation through its ability to induce proto-
oncogenes such as cyclin D1 and c-Myc, metastasis
through its ability to induce the expression of cellular
adhesion molecules and matrix metalloproteinases,
angiogenesis through the regulation of vascular endo-
thelial growth factor and cell immortality through reg-
ulating telomerase. Finally, in some model systems,
NF-jB provides the critical link between tumor devel-
opment and chronic inflammation, a process thought
to be the basis of up to 20% of human cancers. It is
not difficult to see that any pathway affecting the
expression level or transcriptional activity of NF-jB
can also alter the oncogenic activity of NF-jB. Our
research validated the upregulation of NF-jB in ovar-
ian cancer by quantitative RT-PCR, which may pro-
mote the oncogenic activity of NF-jB and contribute
to tumorigenesis. Because NF-jB1 is a target gene of
miR-9, suppression of miR-9 may account for the

overexpression of NF-jB1 in ovarian cancer, although
other mechanisms cannot be excluded.
In conclusion, miR-9 displays a low level in ovarian
cancer tissues compared with normal ovarian tissues,
and overexpression of miR-9 represses cell growth. A
new target gene of miR-9, NF-jB1, was found to be
upregulated in ovarian cancer tissues. These findings
indicate that inhibition of miR-9 in ovarian cancer
may contribute to the malignant phenotype by main-
taining a high level of NF-jB1. Thus, the identification
of miR-9 and its target gene, NF-jB1, in ovarian can-
cer may help us to understand the potential molecular
mechanism of tumorigenesis, and may have diagnostic
and therapeutic value in the future.
Materials and methods
Materials
Four pairs of ovarian tissues, including four human ovarian
cancer tissues and the matched normal ovarial tissues from
the same patient, were used in this study. The normal ovar-
ian tissues were the distal end of the operative excisions far
away from the tumors. The samples were received from the
Tumor Bank Facility of Tianjin Medical University Cancer
Institute and Hospital and National Foundation of Cancer
Research. All of the samples were obtained with patients’
informed consent and were confirmed by the pathologic
analysis. Large and small RNA of tissue samples was
extracted and purified using mirVanaÔ miRNA Isolation
L M. Guo et al. MiR-9 inhibits ovarian cancer cell growth
FEBS Journal 276 (2009) 5537–5546 ª 2009 The Authors Journal compilation ª 2009 FEBS 5543
Kit (Ambion, Austin, TX, USA) according to manufac-

turer’s instructions.
Cell culture
Human ovarian cancer cell line ES-2 was grown in RPMI
1640 (GIBCO BRL, Grand Island, NY, USA) supple-
mented with 10% fetal bovine serum, 100 UÆmL
)1
penicillin
and 100 lgÆmL
)1
streptomycin, and incubated at 37 °Cina
humidified chamber supplemented with 5% CO
2
.
Construction of expression vectors
To construct the miR-9 expression vector pcDNA3B ⁄ pri-
miR-9, we first modified pcDNA3 by mutating the BglII
site outside the mutiple cloning site, then amplified a
386 bp DNA fragment carrying pri-miR-9 from genomic
DNA using PCR primers miR-9-sense, 5¢-CGG
AGAT
CTTTTCTCTCTTCACCCTC-3¢, and miR-9-antisense, 5¢-
CAA
GAATTCGCCCGAACCAGTGAG-3¢. The amplified
fragment was cloned into modified pcDNA3 at BamHI and
EcoRI sites. To construct the siRNA expression vector pSi-
lencer ⁄ si-NF-jB1, an  70 bp double-stranded si-NF-jB1
was obtained by annealing using two single-strands NF-
jB1-Top, 5¢-GATCCCGCCTGAACAAATGTTTCATTTG
GTCAAGAGCCAAATGAAACATTTGTTCAGGCTTTG
GAAA-3¢; and NF-jB1-Bot, 5¢-AGCTTTTCCAAAAAA

GCCTGAACAAATGTTTCATTTGGCTCTTGACCAAA
TGAAACATTTGTTCAGGCGG-3¢, and then cloned into
pSilencer 2.1 neo vector (Ambion). Annealing was per-
formed as: 95 °C for 5 min and room temperature for 2 h.
Transfection
Transfection was performed with Lipofectamine 2000
Reagent (Invitrogen, Carlsbad, CA, USA) following the
manufacturer’s protocol. Briefly, cells were seeded in plates
the day before transfection to ensure a suitable cell conflu-
ent on the day of transfection. pcDNA3B ⁄ pri-miR-9 or
pSilencer ⁄ si-NF-jB1 and respective control vectors were
used at 5 ngÆlL
)1
, and miR-9 ASO (5¢-TCATAC
AGCTAGATAACCAAAGA-3¢) or control oligonucleo-
tides (5¢-GTGGATATTGTTGCCATCA-3¢) were used at
200 nm for each transfection in antibiotic-free Opti-MEM
medium (Invitrogen). Transfection efficiency was monitored
by Cy5-oligonucleotide and spiking RFP-expressing vector
when necessary.
Cell proliferation assay
Cells were seeded in 96-well plate at 4000 cells per well the
day before transfection and then transfected with
pcDNA3B ⁄ pri-miR-9 or control vector as mentioned
above. Furthermore, to detect the dose-dependent effect,
we gradually increased quantity of pcDNA3B ⁄ pri-miR-9
from 0 to 15 ngÆlL
)1
. And to examine the time-dependent
effect of pSilencer ⁄ NF-jB1 on ES-2 cells, we detected via-

ble proliferation cells 24, 48 and 72 h after transfection
respectively. MTT assay was used to detect viable prolifera-
tion cells. The absorbance at 570 nm (A
570
) was detected
using lQuant Universal Microplate Spectrophotometer
(Bio-tek Instruments, Winooski, VT, USA).
Colony formation assay
After transfection, cells were counted and seeded in 12-well
plates in triplicate at 100 cellsÆwell
)1
. Fresh culture medium
was replaced every 3 days. The colony was counted only if
it contained > 50 cells, and the number of colonies was
counted from the sixth day after seeding. The rate of col-
ony formation was calculated with the equation: colony
formation rate = (number of colonies ⁄ number of seeded
cells) · 100%.
Bioinformatics method
The miRNA targets predicted by computer-aided algorithms
were obtained from pictar ( />bin/new_PicTar_vertebrate.cgi), targetscan (http://www.
targetscan.org) and mirbase targets (http://microrna.
sanger.ac.uk/cgi-bin/targets/v5/search.pl).
Fluorescent report assay
The EGFP expression vector pcDNA3 ⁄ EGFP was con-
structed as previously described [18]. The 3¢-untranslated
mRNA sequences of NF-jB1 containing the miR-9 binding
site were amplified by PCR using the following primers: NF-
jB1 sense, 5¢-CCG
GGATCCGCAAACTCAGCTTTAC-3¢;

and NF-jB1 antisense, 5¢-CG
GAATTCGTGGCGACCGT
GATACC-3¢. PCR products were cloned into pcDNA3 ⁄
EGFP at BamHI and EcoRI sites. Moreover, the fragment of
NF-jB1 3¢-UTR mutant, which contained a mutational
miR-9 binding site, was amplified using PCR site-directed
mutagenesis and cloned into pcDNA3 ⁄ EGFP at the same
sites. The two more primers carrying the mutated NF-jB1
3¢-UTR fragment were used in the mutagenesis: NF-jB1
MS, 5¢-CACCGTGTAAAGCATACCCCTAAAATTC-3¢;
and NF-jB1 MA, 5¢-GAATTTTAGGGGTATGCTTTA
CACGGTG-3¢.
ES-2 cells were transfected with pcDNA3B ⁄ pri-miR-9 or
control vector, miR-9 ASO or control oligonucleotides at
24-well plate, and then with the reporter vector
pcDNA3 ⁄ EGFP-NF-jB1 3¢-UTR or pcDNA3 ⁄ EGFP-NF-
jB1 3¢-UTR mutant on the next day. The RFP expression
vector pDsRed2-N1 (Clontech, Mountain View, CA, USA)
was spiked in and used for normalization. The cells were
lysed with radioimmunoprecipitation assay lysis buffer
MiR-9 inhibits ovarian cancer cell growth L M. Guo et al.
5544 FEBS Journal 276 (2009) 5537–5546 ª 2009 The Authors Journal compilation ª 2009 FEBS
(150 mm NaCl, 50 mm Tris ⁄ HCl, pH 7.2, 1% Triton
X-100, 0.1% SDS) 72 h later and the proteins were har-
vested. The intensities of EGFP and RFP fluorescence were
detected with Fluorescence Spectrophotometer F-4500
(HITACHI, Tokyo, Japan).
Real-time RT-PCR
Small RNA (5 lg) was reverse transcribed to cDNA using
M-MLV reverse transcriptase (Promega, Madison, WI,

USA) with primers miR-9-RT or U6-RT respectively. RT
primers were as follows: miR-9-RT, 5¢-TCGTATCCAG
TGCAGGGTCCGAG GTGCA CTG GATAC GACTCA TA
CAG-3¢; and U6-RT, 5¢-GTCGTATCCAGTGCAGGGT
CCGAGGTATTCGCACTGGATACGACAAAATATGG
AAC-3¢, which can fold to stem–loop structures. The
cDNA was used to amplify mature miR-9 and an endoge-
nous control U6 snRNA, respectively, through PCR. PCR
primers were: miR-9-Fwd, 5¢-GCCCGCTCTTTGGTTAT
CTAG-3¢; and U6-Fwd, 5¢-TGCGGGTGCTCGCTTCGG
CAGC-3¢, which could ensure the specificity of the PCR
products, and reverse, 5¢-CCAGTGCAGGGTCCGAGGT-3¢,
which was universal. All the primers were purchased from
Invitrogen. PCR cycles were as follows: 94 °C for 5 min, fol-
lowed by 40 cycles of 94 °C for 30 s, 50 °C for 30 s and 72 ° C
for 40 s. Real-time PCR was performed using SYBR Premix
Ex TaqÔ (TaKaRa, Otsu, Shiga, Japan) on a 7300 Real-Time
PCR system (ABI, Foster City, CA, USA). The relative
expression of miR-9 was defined as follows: quantity of
miR-9 ⁄ quantity of U6 in the same sample.
To detect the relative level of NF-jB1 transcription, real-
time RT-PCR was performed. Briefly, a cDNA library was
generated through reverse transcription using M-MLV
reverse transcriptase (Promega) with 5 l g of the large
RNA. The cDNA was used to amplify the NF-jB1 gene
and b-actin gene as an endogenous control through PCR.
PCR primers were as follows: NF-jB1 sense and NF-jB1
antisense were as above; b-actin sense, 5¢-CGTGAC
ATTAAGGAGAAGCTG-3¢; and b-actin antisense,
5¢-CTAGAAGCATTTGCGGTGGAC-3¢. PCR cycles were

as follows: 94 °C for 5 min, followed by 40 cycles of 94 °C
for 1 min, 56 °C for 1 min and 72 °C for 1 min. Real-time
PCR was performed as described above, and the relative
NF-jB1 expression level was defined as follows: quantity of
NF-jB1 ⁄ quantity of b-actin in the same sample.
Western blot
ES-2 cells were transfected with pri-miR-9 or control vec-
tor, miR-9 ASO or control oligonucleotides. Forty-eight
hours later the cells were lysed with RIPA lysis buffer and
proteins were harvested. All proteins were resolved on 10%
SDS denatured polyacrylamide gel and then transferred
onto a nitrocellulose membrane. Membranes with anti-
(NF-jB1) serum or anti-GAPDH serum were incubated
with blotting overnight at 4 ° C Membranes were then
washed and incubated with horseradish peroxidase-conju-
gated secondary antibody. Protein expression was assessed
by enhanced chemiluminescence and exposure to chemilu-
minescent film. Lab WorksÔ Image Acquisition and Ana-
lysis Software (UVP, Upland, CA, USA) were used to
quantify band intensities. Antibodies were purchased from
Saier Inc (Tianjin, China) or Sigma-Aldrich (St Louis, MO,
USA).
Statistical analysis
Statistical analysis utilized two-tailed Student’s t-test. Statis-
tical significance was set as P < 0.05.
Acknowledgements
We thank the Tumor Bank Facility of Tianjin Medical
University Cancer Institute and Hospital and National
Foundation of Cancer Research for providing human
ovarian cancer samples. We also thank the College of

Public Health of Tianjin Medical University for the
technical assistance in fluorescent detection. This work
was supported by the National Natural Science
Foundation of China (NO: 30873017) and the Natural
Science Foundation of Tianjin (NO: 08JCZDJC23300
and 09JCZDJC17500).
References
1 Corney DC & Nikitin AY (2008) MicroRNA and
ovarian cancer. Histol Histopathol 23, 1161–1169.
2 Lee RC, Feinbaum RL & Ambros V (1993) The
C. elegans heterochronic gene lin-4 encodes small RNAs
with antisense complementarity to lin-14. Cell 75,
843–854.
3 Lee RC & Ambros V (2001) An extensive class of small
RNAs in Caenorhabditis elegans. Science 294, 862–864.
4 Lau NC, Lim LP, Weinstein EG & Bartel DP (2001) An
abundant class of tiny RNAs with probable regulatory
roles in Caenorhabditis elegans. Science 294, 858–862.
5 Lagos-Quintana M, Rauhut R, Lendeckel W & Tuschl
T (2001) Identification of novel genes coding for small
expressed RNAs. Science 294, 853–858.
6 Pillai RS, Bhattacharyya SN & Filipowicz W (2007)
Repression of protein synthesis by miRNAs: how many
mechanisms? Trends Cell Biol 17, 118–126.
7 Nilsen TW (2007) Mechanisms of microRNA-mediated
gene regulation in animal cells. Trends Genet 23, 243–249.
8 Croce CM & Calin GA (2005) miRNAs, cancer, and
stem cell division. Cell 122, 6–7.
9 Chen CZ, Li L, Lodish HF & Bartel DP (2004)
MicroRNAs modulate hematopoietic lineage differ-

entiation. Science 303 , 83–86.
L M. Guo et al. MiR-9 inhibits ovarian cancer cell growth
FEBS Journal 276 (2009) 5537–5546 ª 2009 The Authors Journal compilation ª 2009 FEBS 5545
10 Iorio MV, Ferracin M, Liu CG, Veronese A, Spizzo R,
Sabbioni S, Magri E, Pedriali M, Fabbri M, Campiglio
M et al. (2005) MicroRNA gene expression deregula-
tion in human breast cancer. Cancer Res 65, 7065–7070.
11 Yanaihara N, Caplen N, Bowman E, Seike M, Kumam-
oto K, Yi M, Stephens RM, Okamoto A, Yokota J,
Tanaka T et al. (2006) Unique microRNA molecular
profiles in lung cancer diagnosis and prognosis. Cancer
Cell 9, 189–198.
12 Calin GA, Liu CG, Ferracin M, Hyslop T, Spizzo R,
Sevignani C, Fabbri M, Cimmino A, Lee EJ, Wojcik
SE et al. (2007) Ultraconserved regions encoding ncR-
NAs are altered in human leukemias and carcinomas.
Cancer Cell 12, 215–229.
13 Akao Y, Nakagawa Y & Naoe T (2007) MicroRNA-
143 and -145 in colon cancer. DNA Cell Biol 26,
311–320.
14 Visone R, Pallante P, Vecchione A, Cirombella R,
Ferracin M, Ferraro A, Volinia S, Coluzzi S, Leone V,
Borbone E et al. (2007) Specific microRNAs are down-
regulated in human thyroid anaplastic carcinomas.
Oncogene 26, 7590–7595.
15 Bloomston M, Frankel WL, Petrocca F, Volinia S, Alder
H, Hagan JP, Liu CG, Bhatt D, Taccioli C & Croce CM
(2007) MicroRNA expression patterns to differentiate
pancreatic adenocarcinoma from normal pancreas and
chronic pancreatitis. JAMA 297, 1901–1908.

16 Johnson SM, Grosshans H, Shingara J, Byrom M,
Jarvis R, Cheng A, Labourier E, Reinert KL, Brown D
& Slack FJ (2005) RAS is regulated by the let-7 micro-
RNA family. Cell 120, 635–647.
17 Mayr C, Hemann MT & Bartel DP (2007) Disrupting
the pairing between let-7 and Hmga2 enhances onco-
genic transformation. Science 315, 1576–1579.
18 Liu T, Tang H, Lang Y, Liu M & Li X (2009)
MicroRNA-27a functions as an oncogene in gastric
adenocarcinoma by targeting prohibitin. Cancer Lett
273, 233–242.
19 Mertens-Talcott SU, Chintharlapalli S, Li X & Safe S
(2007) The oncogenic microRNA-27a targets genes that
regulate specificity protein transcription factors and the
G2–M checkpoint in MDA-MB-231 breast cancer cells.
Cancer Res 67, 11001–11011.
20 Zhang B, Pan X, Cobb GP & Anderson TA (2007)
microRNAs as oncogenes and tumor suppressors. Dev
Biol 302, 1–12.
21 Laios A, O’Toole S, Flavin R, Martin C, Kelly L, Ring
M, Finn SP, Barrett C, Loda M, Gleeson N et al. (2008)
Potential role of miR-9 and miR-223 in recurrent ovarian
cancer. Mol Cancer 7, 35, doi:10.1186/1476-4598-7-35.
22 Grimson A, Farh KK, Johnston WK, Garrett-Engele P,
Lim LP & Bartel DP (2007) MicroRNA targeting speci-
ficity in mammals: determinants beyond seed pairing.
Mol Cell 27, 91–105.
23 Perkins ND (2004) NF-kappaB: tumor promoter or
suppressor? Trends Cell Biol 14, 64–69.
24 Lehmann U, Hasemeier B, Christgen M, Muller M,

Romermann D, Langer F & Kreipe H (2008) Epigenetic
inactivation of microRNA gene hsa-mir-9-1 in human
breast cancer. J Pathol 214, 17–24.
25 Zhang L, Huang J, Yang N, Greshock J, Megraw MS,
Giannakakis A, Liang S, Naylor TL, Barchetti A, Ward
MR et al. (2006) microRNAs exhibit high frequency
genomic alterations in human cancer.
Proc Natl Acad
Sci USA 103, 9136–9141.
26 Stark A, Brennecke J, Russell RB & Cohen SM (2003)
Identification of Drosophila microRNA targets. PLoS
Biol 1, E60.
27 Lewis BP, Shih IH, Jones-Rhoades MW, Bartel DP &
Burge CB (2003) Prediction of mammalian microRNA
targets. Cell 115, 787–798.
28 Kiriakidou M, Nelson PT, Kouranov A, Fitziev P,
Bouyioukos C, Mourelatos Z & Hatzigeorgiou A (2004)
A combined computational–experimental approach pre-
dicts human microRNA targets. Genes Dev 18, 1165–
1178.
29 Hayden MS & Ghosh S (2004) Signaling to
NF-kappaB. Genes Dev 18, 2195–2224.
30 Luo JL, Kamata H & Karin M (2005) IKK ⁄ NF-
kappaB signaling: balancing life and death – a new
approach to cancer therapy. J Clin Invest 115, 2625–
2632.
31 Kucharczak J, Simmons MJ, Fan Y & Gelinas C (2003)
To be, or not to be: NF-kappaB is the answer – role of
Rel ⁄ NF-kappaB in the regulation of apoptosis. Onco-
gene 22, 8961–8982.

MiR-9 inhibits ovarian cancer cell growth L M. Guo et al.
5546 FEBS Journal 276 (2009) 5537–5546 ª 2009 The Authors Journal compilation ª 2009 FEBS