Báo cáo khoa học: Molecular design of a nylon-6 byproduct-degrading enzyme from a carboxylesterase with a b-lactamase fold ppt

Molecular design of a nylon-6 byproduct-degrading
enzyme from a carboxylesterase with a b-lactamase fold
Yasuyuki Kawashima
1,
*, Taku Ohki
1,
*, Naoki Shibata
2,3,
*, Yoshiki Higuchi
2,3
, Yoshiaki Wakitani
1
,
Yusuke Matsuura
1
, Yusuke Nakata
1
, Masahiro Takeo
1
, Dai-ichiro Kato
1
and Seiji Negoro
1
1 Department of Materials Science and Chemistry, Graduate School of Engineering, University of Hyogo, Japan
2 Department of Life Science, Graduate School of Life Science, University of Hyogo, Japan
3 RIKEN Harima Institute, SPring-8 Center, Sayo-gun, Hyogo, Japan
Nylon-6 is produced by ring-cleavage polymerization
of e-caprolactam, and consists of more than 100 units
of 6-aminohexanoate (Ahx). During the polymeriza-
tion reaction, some molecules fail to polymerize and
remain oligomers, whereas others undergo head-to-tail

condensation to form cyclic oligomers. These Ahx olig-
omers (designated as nylon oligomers) are byproducts
from nylon-6 factories, and contribute to the increase
in the amounts of industrial waste material discharged
into the environment. Therefore, an efficient system
for degradation of these byproducts is required. How-
ever, the efficiency of degradation is highly dependent
on specific enzymes that can catalyze the desired reac-
tions. We have been studying the degradation of the
Ahx oligomer by Arthrobacter sp. KI72 as a model
system [1–15]. Previous biochemical studies have
revealed that the Ahx linear dimer (Ald) hydrolase
(NylB) responsible for degradation of the nylon oligo-
mers and a carboxylesterase (NylB¢), which has approxi-
mately 0.5% of the NylB level of Ald-hydrolytic
Keywords
6-aminohexanoate-dimer hydrolase;
carboxylesterase; nylon oligomer; X-ray
crystallography; b-lactamase
Correspondence
S. Negoro, Department of Materials Science
and Chemistry, Graduate School of
Engineering, University of Hyogo, 2167
Shosha, Himeji, Hyogo 671 2280, Japan
Fax / Tel: +81 792 67 4891
E-mail:
Y. Higuchi, Department of Life Science,
Graduate School of Life Science, University
of Hyogo, 3-2-1 Koto, Kamigori-cho,
Ako-gun, Hyogo 678 1297, Japan

Fax / Tel: +81 791 58 0179
E-mail:
*These authors contributed equally to this
work
(Received 11 December 2008, revised 13
February 2009, accepted 20 February 2009)
doi:10.1111/j.1742-4658.2009.06978.x
A carboxylesterase with a b-lactamase fold from Arthrobacter possesses a
low level of hydrolytic activity (0.023 lmolÆmin
)1
Æmg
)1
) when acting on a
6-aminohexanoate linear dimer byproduct of the nylon-6 industry (Ald).
G181D ⁄ H266N ⁄ D370Y triple mutations in the parental esterase increased
the Ald-hydrolytic activity 160-fold. Kinetic studies showed that the triple
mutant possesses higher affinity for the substrate Ald (K
m
= 2.0 mm) than
the wild-type Ald hydrolase from Arthrobacter (K
m
=21mm). In addition,
the k
cat
⁄ K
m
of the mutant (1.58 s
)1
Æmm
)1

) was superior to that of the wild-
type enzyme (0.43 s
)1
Æmm
)1
), demonstrating that the mutant efficiently con-
verts the unnatural amide compounds even at low substrate concentrations,
and potentially possesses an advantage for biotechnological applications.
X-ray crystallographic analyses of the G181D ⁄ H266N ⁄ D370Y enzyme and
the inactive S112A-mutant–Ald complex revealed that Ald binding induces
rotation of Tyr370 ⁄ His375, movement of the loop region (N167–V177),
and flip-flop of Tyr170, resulting in the transition from open to closed
forms. From the comparison of the three-dimensional structures of various
mutant enzymes and site-directed mutagenesis at positions 266 and 370, we
now conclude that Asn266 makes suitable contacts with Ald and improves
the electrostatic environment at the N-terminal region of Ald cooperatively
with Asp181, and that Tyr370 stabilizes Ald binding by hydrogen-bonding ⁄
hydrophobic interactions at the C-terminal region of Ald.
Abbreviations
Ahx, 6-aminohexanoate; Ald, 6-aminohexanoate linear dimer; DD,
D-alanyl-D-alanine.
FEBS Journal 276 (2009) 2547–2556 ª 2009 The Authors Journal compilation ª 2009 FEBS 2547
activity, are encoded on a plasmid in Arthrobacter
[4,7–9] (Fig. 1). NylB and NylB¢ are composed of 392
amino acid residues, but differ at 46 residues. How-
ever, a single G181D [Gly181 (NylB¢ type) to Asp
(NylB type)] substitution in the NylB¢ sequence results
in a 20-fold increase in hydrolytic activity [10,13].
Also, an additional alteration, H266N [His266 (NylB¢
type) to Asn (NylB type)], increases the Ald-hydrolytic

activity to that of the parental NylB enzyme [10,12].
Three-dimensional structures of the enzymes provide
not only basic information, such as catalytic mecha-
nism and enzyme evolution, but also the information
required for improvement of enzyme function. A
NylB ⁄ NylB¢ hybrid (designated Hyb-24) gives good
crystals suitable for X-ray crystallographic analysis.
Hyb-24 includes five amino acid replacements (T3A,
P4R, T5S, S8Q, and D15G) in the NylB¢ protein
(Table 1), but possesses the NylB¢ level of Ald-hydro-
lytic activity [11,14]. X-ray crystallographic analysis of
Hyb-24 and Hyb-24DN (a Hyb-24 mutant with
G181D ⁄ H266N substitutions) has revealed that these
enzymes generate a two-domain structure (a and a ⁄ b)
that is similar to the folds of the penicillin-recognizing
family of serine-reactive hydrolases, especially to those
of the d-alanyl-d-alanine (DD) carboxypeptidase from
Streptomyces and the carboxylesterase (EstB) from
Burkholderia [11,12].
We have proposed that Ser112, Lys115 and Tyr215
are catalytic residues in Hyb-24 and Hyb-24DN [12].
Tyr215-O
g
functions as a general base to increase the
nucleophilicity of Ser112, which performs nucleophilic
attacks on amide compounds. The positively charged
Lys115-N
f
stabilizes the Ser112-O
c)

anion. However, in
Hyb-24DN, additional amino acid residues, Tyr170 and
Asp181, which are unnecessary for the esterolytic activi-
ties, are required to confer a NylB level of hydrolytic
activity towards Ald. In addition, nylon oligomer hydro-
lase exhibits unique structural alterations induced by
Ald, i.e. movement of the loop region (N167–V177) and
flip-flop of Tyr170. On the basis of these findings, we
have proposed that amino acid substitutions in the cata-
lytic cleft of a pre-existing esterase with a b-lactamase
fold result in the evolution of a nylon oligomer hydro-
lase, and that catalysis proceeds according to the follow-
ing steps: (a) Ald-induced transition from open
(substrate-unbound) to closed (substrate-bound) forms;
(b) nucleophilic attack on Ald by Ser112 and formation
Fig. 1. Reaction catalyzed by NylB ⁄ NylB¢. Hydrolysis of -6-amino-
hexanoate linear dimer (Ald) (nylon oligomer hydrolytic activity) (A)
and p-nitrophenylacetate (esterolytic activity) (B).
Table 1. Enzymes and plasmids.
Abbreviations Characteristics Reference
NylB Wild-type Ald hydrolase from Arthrobacter sp. KI72 [4,7]
NylB¢ Wild-type carboxylesterase with b-lactamase fold from
Arthrobacter sp. KI72 (88% homology to NylB)
[7–9]
Hyb-24 NylB ⁄ NylB¢ hybrid protein constructed from conserved
PvuII sites located 24 amino acid residues downstream
of the initiation codons (NylB¢ containing
T3A ⁄ P4R ⁄ T5S ⁄ S8Q ⁄ D15G substitutions)
[11,14]
Hyb-24D Hyb-24 containing G181D substitution [13]

Hyb-24D-A
112
Hyb-24D containing S112A substitution This study
Hyb-24N Hyb-24 containing H266N substitution This study
Hyb-24Y Hyb-24 containing D370Y substitution [13]
Hyb-24DN Hyb-24 containing G181D ⁄ H266N substitutions [12]
Hyb-24DN-A
112
Hyb-24DN containing S112A substitution [12]
Hyb-24DY Hyb-24 containing G181D ⁄ D370Y substitutions [13]
Hyb-24DNY Hyb-24 containing G181D ⁄ H266N ⁄ D370Y substitutions This study
Hyb-24DNY-A
112
Hyb-24DNY containing S112A substitution This study
Hyb-24DD Hyb-24 containing G181D ⁄ H266D substitutions This study
Hyb-24DG Hyb-24 containing G181D ⁄ H266G substitutions This study
pHY3 Hybrid plasmid composed of vector pKP1500 region and
a 1.4 kb EcoRI ⁄ HindIII fragment containing the Hyb-24gene
[11,14]
Molecular design of nylon oligomer hydrolase Y. Kawashima et al.
2548 FEBS Journal 276 (2009) 2547–2556 ª 2009 The Authors Journal compilation ª 2009 FEBS
of a tetrahedral intermediate; (c) formation of an acyl
enzyme and transition to an open form; and (d) deacyla-
tion [12].
We have concluded that Asp181-COO
)
stabilizes
substrate binding by electrostatic interactions with
Ald-NH
þ

3
[12]. However, the role of Asn266 was still
unclear. In addition, random mutagenesis experiments
with the parental carboxylesterase (Hyb-24) gene have
revealed that a D370Y substitution occurring opposite
to Gly181 in the catalytic cleft (17.1 A
˚
from Tyr370
at the C
a
position) enhances Ald-hydrolytic activity
eight-fold in comparison to the parental Hyb-24
(0.023 lmolÆmin
)1
Æmg
)1
protein) [13]. In the current
study, we constructed a mutant enzyme by integrating
the three amino acid alterations (G181D ⁄ H266N ⁄
D370Y) individually into the Hyb-24 sequence, and
examined the cumulative effects on Ald-hydrolytic
activity. Moreover, we determined the three-dimen-
sional structures of Hyb-24D (Hyb-24 with having the
G181D substitution), Hyb-24DNY (Hyb-24 mutant
with G181D ⁄ H266N ⁄ D370Y substitutions), and their
enzyme–substrate complexes, and analyzed the roles of
Asn266 and Tyr370 in comparison with the structures
of typical enzymes in the penicillin-recognizing family
of serine-reactive hydrolases.
Results and Discussion

Cumulative effects of amino acid substitution
on Ald-hydrolytic activity
The catalytic function of mutant enzymes was com-
pared on the basis of specific activity for Ald. Assays
conducted under standard assay conditions using
10 mm Ald have shown that G181D ⁄ H266 ⁄ D370Y
substitutions in Hyb-24 increase the activity 160-fold
(3.6 lmolÆmin
)1
Æmg
)1
) (Table 2). To determine the
individual effects of G181D, H266N and D370Y sub-
stitutions on the catalytic function, we constructed
Hyb-24 mutants with combinations of the substitu-
tions, and determined the kinetic parameters (Table 3).
We could not determine K
m
and V
max
values for
parental Hyb-24 and Hyb-24N (Gly181 enzymes),
owing to their low activities, whereas the K
m
for Hyb-
24D (31 mm for Ald) was found to be close to the
value for wild-type NylB (21 mm), suggesting that a
single G181D substitution improves Ald binding. Simi-
larly, D370Y substitution in Hyb-24 improved Ald
binding (K

m
=39mm in Hyb-24Y). In contrast, a sin-
gle H266N substitution in Hyb-24 decreased Ald
hydrolytic activity (Table 2; Hyb-24N).
In Hyb-24D (Asp181 enzymes), H266N substitution
increased the k
cat
4.6-fold, but barely affected the K
m
value (see Hyb-24DN). This result suggests that
H266N substitution is effective at increasing the turn-
over of the catalytic reaction in combination with
Asp181. In contrast, D370Y substitution decreased the
K
m
to 7 mm (23% of the level of Hyb-24D), but barely
affected the k
cat
value (see Hyb-24DY). Thus, D370Y
substitutions mainly improved Ald binding.
In Hyb-24DN, D370Y substitution further improved
substrate binding (K
m
=2mm). Although the muta-
tion had negative effects on k
cat
(30% of that of Hyb-
24), the k
cat
⁄ K

m
value of Hyb-24DNY (1.58 s
)1
Æmm
)1
)
was four-fold to five-fold that of Hyb-24DN
(0.34 s
)1
Æmm
)1
) and wild-type NylB (0.43 s
)1
Æmm
)1
).
The enzyme–substrate interactions at positions 181,
266 and 370 are discussed below on the basis of the
three-dimensional structures.
Enzyme–substrate interaction in the
catalytic cleft
To analyze the structural alterations induced by G181D,
H266N and D370Y substitutions in Hyb-24, we per-
formed X-ray crystallographic analysis of Hyb-24D and
Hyb24DNY, and compared the structures with those of
Hyb-24 and Hyb-24DN, which had been identified pre-
viously [11–13]. Superimposition of the four molecules
revealed that the overall structures share almost identi-
cal folding patterns within rmsd values smaller than
0.2 A

˚
. In Hyb-24 (Gly181 enzyme), the region encom-
passing D169–A174 had poor electron density, and
therefore Tyr170, which is responsible for substrate
binding, could not be identified in the three-dimensional
models [11]. In contrast, the electron density maps of
Hyb-24D and Hyb-24DNY (Asp181 enzyme) at the flex-
ible loop region (N167–V177) were clear enough to
assign all the side chain atoms. Hydrogen bonding
between Tyr170-O
g
and Asp181-O
d
fixes the flexible
loop in the open form, which has an energy barrier for
transition to the closed form (Figs 2 and 3 and Fig. S1).
Upon substrate binding, the loop is shifted by
approximately 5 A
˚
at Tyr170-C
a
, and the side chain of
Tyr170 is rotated. Through the combined effect,
Tyr170-O
g
moves a total of approximately 11 A
˚
,
resulting in the formation of hydrogen bonds with the
nitrogen of the amide linkage in Ald. In addition, in

the Hyb-24DN-A
112
–Ald complex, the electron density
map was poor for the C-terminal half of Ald [12]. In
contrast, in Hyb-24D-A
112
–Ald and Hyb-24DNY-
A
112
–Ald, the catalytic and binding residues and Ald
in the catalytic cleft had clear electron density distribu-
tions for which structural models could be determined
(Fig. 2A). Thus, the movement of the loop and
rotation of Tyr170 cover the active site to generate a
Y. Kawashima et al. Molecular design of nylon oligomer hydrolase
FEBS Journal 276 (2009) 2547–2556 ª 2009 The Authors Journal compilation ª 2009 FEBS 2549
closed form, and the modes of these motions were
conserved for the three Hyb-24-related proteins
(Fig. 3, and Figs S1 and S2). On the bases of these
findings, we concluded that dynamic motions induced
by Ald play essential roles in Ald hydrolysis.
Superimposition of the bound and unbound Ald
structures revealed that catalytic residues (Ser112 and
Lys115) are conserved at the original positions in
Hyb-24D, Hyb-24DN, and Hyb-24DNY. In contrast,
upon substrate binding, another catalytic residue
(Tyr215) rotates its side chain by approximately 40°
around the C
b
–C

c
bond, and the phenolic oxygen
moves by 0.81–1.1 A
˚
(Fig. 3 and Fig. S1). These
results suggest that stable binding of Ald by electro-
static interaction with Asp181-COO
-
causes movement
of Tyr215 for suitable positioning in the enzyme–
substrate complex.
In substrate-unbound Hyb-24D and Hyb-24DN,
Asp370-O
d
forms hydrogen bonds with the His375 imid-
azole, and even after Ald binding, no significant move-
ments were identified for Asp370 and His375 (Fig. 3A).
In contrast, in Hyb-24DNY, Ald binding induced the
following structural alterations (Fig. 3B): the His375
side chain rotates by approximately 100° around C
a
–C
b
and by approximately 170° around C
b
–C
c
, and flips the
imidazole ring (6.1 A
˚

at the imidazole nitrogen), to gen-
erate a hydrogen-bonding network including Tyr370-O
g
and the Ald carboxyl (distance approximately 3.2 A
˚
).
Through this effect, Tyr370 moves the aromatic ring
(6.4 A
˚
at Tyr-O
g
), allowing it to contact Ald (Fig. 3B).
These results suggest that binding at the C-terminal
region of Ald is improved by the D370Y substitution.
The roles of Asn266 and Tyr370 were further examined
by site-directed mutagenesis.
Roles of Asn266
Superimposition of Hyb-24DNY with the class A
b-lactamase revealed that Asn266 of Hyb-24DNY has
a similar spatial position to that of Glu166 in the
class A b-lactamase (Fig. S3). In the class A b-lactam-
ase (Protein Data Bank ID code, 1M40), the distance
between Ser70-O
c
and Glu166-O
e2
is 4.5 A
˚
, and the
so-called ‘hydrolytic water’ (Wat1004) forms a bridge

between the two residues by hydrogen bonding
(Fig. S3). Moreover, this network is believed to be
responsible for the b-lactam hydrolysis [16–20]. In
Hyb-24DNY, Asn266-O
d
is 5.0 A
˚
away from Ser112-
O
c
, and this distance is slightly larger than the distance
between Ser70-O
c
and Glu166-O
e2
of b-lactamase.
However, upon substrate binding, water molecules
(Wat115, Wat357, Wat375, etc.) in the catalytic cleft
of Hyb-24DNY are excluded. Wat397, nearest to
Table 3. Kinetic parameters of His-tagged Hyb-24 and its mutant
enzymes for Ald. Ald-hydrolytic activity was assayed using the His-
tagged purified enzymes under standard assay conditions, except
that various concentrations of Ald were used. Kinetic parameters
(k
cat
and K
m
values) were evaluated by directly fitting data to the
Michaelis–Menten equation using
GRAPHPAD prism, version 5.01

(GraphPad, San Diego, CA, USA). The k
cat
values are expressed as
turnover numbers per subunit (M
r
of the subunit: 42 000).
Enzyme
Kinetic parameters
k
cat
(s
)1
) K
m
(mM)
k
cat
⁄ K
m
(s
)1
ÆmM
)1
)
Hyb-24D 2.01 ± 0.24 30.9 ± 8.01 0.065
Hyb-24Y 0.61 ± 0.056 39.1 ± 6.73 0.016
Hyb-24DN 9.2 ± 0.24 27.2 ± 1.25 0.34
Hyb-24DY 2.5 ± 0.15 7.1 ± 1.28 0.35
Hyb-24DNY 3.2 ± 0.19 2.0 ± 0.33 1.58
NylB 9.0 ± 1.46 21.0 ± 6.65 0.43

Table 2. Effect of amino acid alternations in His-tagged Hyb-24 on enzyme activity. Enzyme activities of His-tagged proteins were assayed
using 10 m
M Ald, 0.2 mM p-nitrophenylacetate (C2 ester), 0.2 mM p-nitrophenylbutyrate (C4 ester) and p-nitrophenyloctanoate (C8 ester) as
substrates. Details are given in Experimental procedures. The numbers in parentheses indicate the relative activities expressed as a ratio of
the specific activity of the Hyb-24 protein.
Enzyme
Ald-hydrolytic activity
(lmolÆmin
)1
Æmg
)1
)
Esterase activity (lmolÆmin
)1
Æmg
)1
)
C2 ester C4 ester C8 ester
Hyb-24 0.023 (1) 4.81 (1) 2.61 (1) 0.28 (1)
Hyb-24D (G181D) 0.47 (20) 3.16 (0.66) 1.28 (0.49) < 0.005 (< 0.02)
Hyb-24N (H266N) 0.008 (0.35) 7.63 (1.59) 0.70 (0.27) 0.28 (1.0)
Hyb-24Y (D370Y) 0.19 (8.2) 6.31 (1.3) 13.4 (5.1) 1.28 (4.7)
Hyb-24DN (G181D ⁄ H266N) 3.53 (153) 5.93 (1.23) 2.73 (1.05) 0.19 (0.68)
Hyb-24DY (G181D ⁄ D370Y) 1.79 (78) 3.15 (0.65) 5.44 (2.08) 0.027 (0.096)
Hyb-24DD (G181D ⁄ H266D) 1.37 (60) 1.50 (0.31) 1.78 (0.68) 0.051 (0.18)
Hyb-24DG (G181D ⁄ H266G) 0.0010 (0.04) 0.48 (0.10) 0.25 (0.096) 0.0038 (0.014)
Hyb-24DNY (G181D ⁄ H266N ⁄ D370Y) 3.60 (157) 10.2 (2.12) 4.40 (1.69) 0.088 (0.31)
Molecular design of nylon oligomer hydrolase Y. Kawashima et al.
2550 FEBS Journal 276 (2009) 2547–2556 ª 2009 The Authors Journal compilation ª 2009 FEBS
Asn266 (4.7 A

˚
away from Asn266), was identified in
the substrate-bound structure, but Wat397 was not
connected to Ser112-O
c
by the hydrogen-bonding
network (Fig. S3). In addition, substitution to Asp266
in Hyb-24DN is rather inhibitory for activity, as
described below (Table 2; Hyb-24DD). Thus, absence
of ‘hydrolytic water’ in the catalytic cleft in Hyb-
24DNY suggests that the role of Asn266 (Asp266) is
different from that of Glu166 in b-lactamase, although
the possibility remains that the dynamic motion of
water molecules, accompanied by open ⁄ closed inter-
conversions, is responsible for the catalysis.
The roles of Asn266 can be inferred from comparisons
between the structure of Asn266 enzymes (Hyb-24DN-
A
B
C
Fig. 2. Stereoview of the catalytic cleft of nylon oligomer hydro-
lase. (A) 2F
o
) F
c
electron density maps of Hyb-24DNY-A
112
–Ald
contoured at 1.0r. The side chains (stick diagram) of some residues
(Ala112, Lys115, Tyr170, Asp181, Arg187, Tyr215, Phe264,

Asn266, Phe317, Trp331, Ile343, Ile345, Tyr370, and His375), water
molecules (Wat18, Wat335, Wat377, Wat397, and Wat430) and
the substrate Ald are shown. (B, C) Superimposition of Hyb-
24DNY-A
112
–Ald (blue) on Hyb-24D-A
112
–Ald (green). Structures
around the N-terminal region of Ald with the side chains of some
residues [Asp181, Phe264, His266 (Asn266)] are shown (B). Struc-
tures around the C-terminal region of Ald with the side chains of
some residues [Ile343, Tyr370 (Asp370), His375] are shown (C).
Hydrogen bonds between two atoms in the enzyme–substrate
complex are indicated as red dotted lines, with distance in ang-
stroms. Substrate Ald was refined as alternative conformations
(Ald
A
and Ald
B
) on the basis of electron density maps.
A
B
C
Fig. 3. Stereoviews of Ald-bound and unbound structures of nylon
oligomer hydrolases. (A) Superimposition of Hyb-24D-A
112
–Ald
(orange) on Hyb-24D (green). (B, C) Superimposition of Hyb-24DNY-
A
112

–Ald (orange) on Hyb-24DNY (green). The main chain folding
(ribbon diagram) and side chains (stick diagram) of some residues
[Ser112 (Ala112), Lys115, Tyr170, Asp181, Tyr215, His266
(Asn266), Asp370 (Tyr370), His375] located in the catalytic cleft are
shown (A, B). Hydrogen bonds are indicated as red dotted lines
(Hyb-24D-A
112
–Ald and Hyb-24DNY-A
112
–Ald) and magenta dotted
lines (Hyb-24D and Hyb-24DNY), with distance in angstroms. Sur-
face structures of the entrance of the catalytic cleft are shown (C).
Carbon, nitrogen and oxygen atoms in the substrate Ald (space-fill-
ing diagram) are shown in yellow, blue, and red, respectively. Ald-
bound and unbound structures without superimposition are shown
in Fig. S2.
Y. Kawashima et al. Molecular design of nylon oligomer hydrolase
FEBS Journal 276 (2009) 2547–2556 ª 2009 The Authors Journal compilation ª 2009 FEBS 2551
A
112
–Ald and Hyb-24DNY-A
112
–Ald) and that of the
His266 enzyme (Hyb-24D-A
112
–Ald). In the His266
enzyme, it is likely that the bulky His266 imidazole
(2.9 A
˚
away from Ald-NH

þ
3
) creates a steric hindrance
effect against substrate binding, and that the positively
charged imidazole-NH
+
creates electrostatic repulsion
against Ald-NH
þ
3
in the pH range lower than the pK
a
of
the His imidazole (Fig. 2B). Therefore, these effects
should destabilize substrate binding, and H266N substi-
tution is effective at diminishing the negative effects,
resulting in enhancement of Ald-hydrolytic activity.
To examine the effects of position 266 on enzyme
activity, we constructed mutant enzymes from Hyb-
24D. Hyb-24DG (Gly266 enzyme) possessed only
0.03% of the Hyb-24DN activity (Asn266 enzyme)
(Table 2). As Asn266-C
a
is approximately 6 A
˚
from the
substrate Ald at the nearest position (C2), alteration to
Gly266 should reduce the effective contact with the sub-
strate. This suggests that a suitable contact at position
266 is required to hold the substrate in the catalytic

cleft. In addition, the Ald-hydrolytic activity of the
Asp266 mutant (Hyb-24DD) was found to be seven-fold
higher that of the His266 enzyme (Hyb-24D), but the
activity was still only approximately 40% of that of
the Asn266 enzyme. This demonstrates that the presence
of two acidic residues (Asp181 and Asp266) around
Ald-NH
þ
3
is rather inhibitory for the activity.
We have found that various substitutions at position
181 affect the Ald-hydrolytic activity > 10
4
-fold, but
barely affect the esterolytic activity [11]. In contrast,
substitutions at position 266 affect both activities,
although the extent of the esterolytic activity (for
C2 esters, 0.48–5.93 lmolÆmin
)1
Æmg
)1
; for C4 esters,
0.25–5.44 lmolÆmin
)1
Æmg
)1
; and for C8 esters, 0.038–
0.19 lmolÆmin
)1
Æmg

)1
) is smaller than that of the
Ald-hydrolytic activity (0.001–3.53 lmolÆmin
)1
Æmg
)1
)
(Table 2). This may imply that alterations at posi-
tion 266, which is close to the catalytic triad (Ser ⁄
Lys ⁄ Tyr), affect both activities more significantly than
alterations at position 181.
From these analyses, we concluded that Asn266 con-
tributes to close contacts with the substrate, and that
the electrostatic environment around Ald-NH
þ
3
,
responsible for efficient Ald binding, is generated
mainly by Asp181, and additively by Asn266.
Roles of Tyr370
Whereas Ald-hydrolytic activity was enhanced 160-fold
through accumulation of three amino acid substitu-
tions in Hyb-24, activity against the C2 ester was not
as severely affected, and was only 0.65-fold to 2.1-fold
higher (Table 2). However, it should be noted that a
single D370Y substitution increased the esterase activ-
ity against the C4 ester approximately five-fold. More-
over, we have found that the activity against tributyrin
(glyceryltributyrate) of Hyb-24Y was 30-fold to 50-fold
of the activity of Hyb-24 [13]. In contrast, G181D sub-

stitution in Hyb-24 decreased the activity against
longer acyl chains. In addition, as Hyb-24DY pos-
sessed lower esterase activity than Hyb-24Y, the
presence of Asp181 is considered to be inhibitory also
for esterase activity in Tyr370 mutants (Table 2).
The carboxyl-half in the substrate Ald is surrounded
by hydrophobic residues, such as Trp331, Phe317, and
Ile343 (Fig. 2A,C). This suggests that the hydrophobic
interactions stabilize substrate binding. In addition,
D370Y substitution should make the environment of
the catalytic cleft more hydrophobic, as the water
molecules (Wat22, Wat44, Wat242, Wat367, Wat368,
Wat400, and so on) found in Hyb-24D are excluded in
Hyb-24DNY. To examine the effect of amino acid
alterations at position 370 more extensively, we con-
structed various mutant enzymes in which Asp370 in
Hyb-24 was altered to one of 10 other amino acid
residues (Table S1). To simplify the estimation of the
specific activity of each enzyme, we quantified the
amount of Hyb-24-related protein and Ald-hydrolytic
activity in cell extracts, and normalized the data on
the basis of the amount of Hyb-24-related protein (see
Experimental procedures). Alterations to hydrophobic
residues, especially to Trp and Phe, increased the Ald-
hydrolytic activity, although the activity was slightly
lower than that of Hyb-24Y (Tyr370). In addition,
significant enhancements of the activities were found
after substitution to Met and Ile. On the basis of these
findings, we concluded that substrate binding at the
C-terminal region is improved by hydrophobic inter-

actions in some mutant enzymes (Phe370, Trp370,
Met370 and Ile370 enzymes) rather than by specific
hydrogen bonding involving Tyr370-O
g
.
Mutation of Asp370 to hydrophobic residues also
increased the substrate specificity for carboxyl esters
with longer acyl chains (Table S1). Especially in the
Met, Phe and Trp mutants and Hyb-24Y (Tyr370
enzyme), activity against C4 esters and C8 esters was
increased 4- to 7-fold over the activity of the Asp370
enzyme. Thus, increased hydrophobic interactions
around position 370 can explain the increased binding
of esters with longer acyl chains, which results in the
alteration of substrate specificity for carboxyl esters.
Concluding remarks
From the comparisons of the three-dimensional
structures of Hyb-24, Hyb-24D, Hyb-24DN, and
Molecular design of nylon oligomer hydrolase Y. Kawashima et al.
2552 FEBS Journal 276 (2009) 2547–2556 ª 2009 The Authors Journal compilation ª 2009 FEBS
Hyb-24DNY, we suggest the following enzyme–
substrate interactions, where these resulted in stepwise
increases in activity: (a) effective substrate binding was
achieved by electrostatic interaction between Asp181-
COO
)
and Ald-NH
þ
3
(G181D substitution); (b)

Asn266 improves the electrostatic environment cooper-
atively with Asp181, and gives suitable contacts with
Ald (H266N substitution); and (c) Ald binding induces
cooperative movement of Tyr370 ⁄ His375, generating
hydrogen-bonding ⁄ hydrophobic interactions at the
C-terminal region in Ald (D370Y substitution). Thus,
Ald hydrolase activity requires strict substrate binding,
achieved by induced fit motion, whereas the enzyme
performs the catalytic function as a more relaxed open
form for carboxylesterase activity. This model coin-
cides with our finding that Ald-hydrolytic activity is
significantly affected by amino acid substitutions at
positions 170, 181, 266, and 370, which are responsible
for Ald binding, whereas amino acid substitutions at
these positions do not affect esterase activity as
severely. In addition, Ald hydrolase, which is superior
to the wild-type enzyme in affinity for Ald and k
cat
⁄ K
m
value, was successfully constructed by integrating
G181D ⁄ H266N ⁄ D370Y substitutions into the paren-
tal carboxylesterase. This result demonstrates that
the mutant efficiently converts the unnatural amide
compounds even at low substrate concentrations, and
potentially possesses advantages for biotechnological
applications.
Experimental procedures
Site-directed mutagenesis and construction of
plasmids expressing mutant enzymes

The mutant enzymes and plasmids used in this study are
listed in Table 1. To obtain the other mutant enzymes
from Hyb-24, site-directed mutagenesis was carried out by
PCR [21], using the following primers (mutated sites are
underlines): RHmutN1 (5¢-GCCGCCGT
TCGCGAAGCC
GAA-3¢) (for H266N substitution); RHmutD1 (5¢-GACGC
CGCCGT
CCGCGAAGCCGAAACCCGT-3¢) (for H266D
substitution); RHmutG1 (5¢-GACGCCGCCG
CCCGCG
AAGCCGAAACCCGT-3¢) (for H266G substitution); and
RDmutY1 (5¢-GTGTAGGGATCGGGCCACG-3¢) (for
D370Y substitution). To replace Asp370 in Hyb-24 with
other amino acids, the mutant primer with NNN at posi-
tion 370 (RDmutX1) (5¢-CCGGTGCCAGTGCTCGGT
NNNGGGATCGGGCCACGACGACAGC-3¢) was used.
After nucleotide sequencing of the mutants we confirmed
that isolated mutants possess a single D370N, D370E,
D370K, D370T, D370C, D370G, D370I, or D370F muta-
tion in the Hyb-24 sequence. For the D370W mutant,
primer RDmutW1 (5¢-CCGGTGCCAGTGCTCGGT
CCA
GGGATCGGGCCACGACGACAGC-3¢) was used. For
the D370M mutant, primer RDmutM1 (5¢-CCGGTGCC
AGTGCTCGGT
CATGGGATCGGGCCACGACGACA
GC-3¢) was used. For isolation of S112A mutants, site-
directed mutagenesis was performed with the synthetic
oligonucleotide 5¢-TGCTGATG

GCCGTCTCGAAGT-3¢.
The mutant enzymes were expressed in Escherichi coli
KP3998, using pKP1500 as the vector [11,12].
Enzyme purification, enzyme assay, and protein
concentration
For crystallization and X-ray diffraction experiments,
native enzymes were purified to homogeneity from cell
extracts of E. coli clones by successive chromatography on
anion exchange (Hi-Trap Q-Sepharose; GE Healthcare Bio-
Science AB, Uppsala, Sweden), gel filtration (Seph-
acryl S-200 High Resolution; GE Healthcare Bio-Science
AB) and anion exchange (Hi-Trap Q-Sepharose) columns
[11]. In order to analyze the specific activities of various
mutant enzymes, a His-tagged region was fused to the
N-terminus of each mutant enzyme, using the expression
vector pQE-80L (Qiagen GmbH, Hilden, Germany). The
His-tagged enzymes were expressed in E. coli JM109, and
purified to homogeneity [11].
Ald-hydrolytic activities were assayed at 30 °C using
10 mm Ald (chemically synthesized in our laboratory) as sub-
strate in 20 mm potassium phosphate buffer (pH 7.3), con-
taining 10% glycerol (standard assay condition) [9–13].
Reaction mixtures were fractionated on a C
18
RP-HPLC col-
umn (TSK-GEL ODS-80Ts; TOSOH Co., Tokyo, Japan),
and the decrease in Ald and increase in Ahx were monitored
by absorbance at 210 nm (A
210 nm
). For kinetic studies, the

activities were assayed under standard assay conditions,
except that different Ald concentrations were used. Esterase
activities against 0.2 mm p-nitrophenylacetate (Nakarai tes-
que, Kyoto, Japan) (C2 ester), 0.2 mm p-nitrophenylbutyrate
(Sigma-Aldrich, MO, USA) (C4 ester) and 0.2 mm
p-nitrophenyloctanoate (Wako Pure Chemical Industries,
Ltd, Osaka, Japan) (C8 ester) were assayed [11,12]. Protein
concentrations were assayed by the Lowry–Folin method.
To compare the specific activities of Hyb-24 mutant
enzymes with substitutions at position 370, the Ald-hydro-
lytic activity in the crude enzyme solution was assayed by
HPLC [13]. The amount of the Hyb-24 mutant protein
included in the cell extract was quantified by densito-
metric analysis of protein bands separated by SDS ⁄
PAGE using nih image analysis software (o.
nih.gov/nih-image/) [13]. The specific activity was expressed
as the Ald-hydrolytic activity ⁄ amount (mg) of Hyb-24-
mutant protein. From the results obtained using cell
extracts, the specific Ald-hydrolytic activity of wild-type
NylB was estimated to be approximately 180-fold that
exhibited by Hyb-24, and this value was almost the
Y. Kawashima et al. Molecular design of nylon oligomer hydrolase
FEBS Journal 276 (2009) 2547–2556 ª 2009 The Authors Journal compilation ª 2009 FEBS 2553
same with the ratio obtained from the purified enzymes
(specific activity of His-tagged purified NylB/specific
activity of His-tagged purified Hyb-24). In addition, no
Ald-hydrolytic activity was detected in E. coli harboring
the vector (without the NylB ⁄ NylB¢ region) (< 1% of the
NylB¢ level of activity), and background esterolytic acti-
vity was also quite low as compared to the activity in

E. coli clones producing the NylB ⁄ NylB¢-related enzymes.
Therefore, we have determined that the estimation based
on data from the cell extracts roughly agrees with the
results obtained using the purified enzyme.
Crystallographic analysis
The crystals of Hyb-24D and Hyb-24DNY were grown by
the sitting-drop vapor-diffusion method from the protein
buffer solution (10–20 mg protein mL
)1
, 0.1 m Mes,
pH 6.5) (Nakarai tesque, Kyoto, Japan) containing ammo-
nium sulfate (2.0–2.2 m) (Nakarai tesque, Kyoto, Japan),
lithium sulfate (0.1–0.2 m) (Wako Pure Chemical Industries,
Ltd, Osaka, Japan) and glycerol [15–25% (v ⁄ v)] at 10 °C,
to a final size of about 0.3 · 0.3 · 0.3 mm, according to
the protocol used for Hyb-24 and Hyb-24DN [11,14]. The
enzyme–substrate complex for the S112A mutant enzymes
(Hyb-24D-A
112
and Hyb-24DNY-A
112
) was prepared by
soaking the crystals in the cryoprotectant [2.0 m ammonium
sulfate, 30% (v ⁄ v) glycerol, and 0.1 m Mes buffer, pH 6.5]
containing 100 m m substrate (Ald) for 3 h [12]. Diffraction
data for the crystals were collected to 1.45–1.70 A
˚
resolu-
tion as follows.
Diffraction datasets of Hyb-24D were collected at 100 K

using the beamline BL41XU (SPring-8, Hyogo, Japan)
equipped with the MarCCD detector system. Diffraction
datasets of Hyb-24DNY and Hyb-24DNY-A
112
–Ald were
collected at 100 K using the beamline BL-5A (Photon
Factory, Tsukuba, Japan) equipped with the ADSC
Quantum 315r detector system. Diffraction datasets of
Hyb-24D-A
112
–Ald were collected at 100 K using the beam-
line BL38B1 (SPring-8, Hyogo, Japan) equipped with the
Rikagaku Jupiter CCD detector system. Integration of the
reflections was performed using the hkl2000 software pack-
age [22]. Rigid-body refinement was performed using the
coordinates of Hyb-24DN to fit the unit cell of the
Hyb-24DNY and Hyb-24D protein crystals, followed by
positional and B-factor refinement with cns [23]. The initial
model was similarly obtained using the coordinates of
Hyb-24DN-A
112
–Ald for protein crystals of Hyb-24D-A
112
–
Ald and of Hyb-24DNY-A
112
–Ald. Several cycles of manual
model rebuilding were performed by xfit [24]. Results of the
crystal structure analysis are summarized in Table 4.
The atomic coordinates and structure factors for Hyb-

24D (Protein Data Bank ID code: 2E8I), Hyb-24DNY
(Protein Data Bank ID code: 2ZM0), Hyb-24D-A
112
–Ald
(Protein Data Bank ID code: 2ZM7) and Hyb-24DNY-
A
112
–Ald (Protein Data Bank ID code: 2ZMA) have
Table 4. Data collection and refinement statistics.
A
Hyb-24D and Hyb-24D-A
112
–Ald
Hyb-24D Hyb-24D-A
112
–Ald
Data collection
Space group P3
2
21 P3
2
21
Unit cell
parameters
a = b (A
˚
) 96.69 96.68
c (A
˚
) 112.93 113.16

Wavelength (A
˚
) 0.8000 0.9000
Resolution
(outer shell) (A
˚
)
50–1.45 (1.50–1.45) 50–1.60 (1.66–1.60)
Total reflections 1 152 434 882 657
Unique reflections
(outer shell)
107 985 (10 619) 81 044 (7973)
Completeness
(outer shell) (%)
99.8 (99.0) 100.0 (99.9)
R
merge
(outer shell)
(%)
a
8.2 (49.6) 6.3 (43.5)
<I> ⁄ <r(I)> 25.5 (3.0) 38.5 (4.0)
Refinement
Resolution
(outer shell) (A
˚
)
41.9–1.45
(1.54–1.45)
31.7–1.60

(1.70–1.60)
R
work
(outer shell) (%) 18.7 (26.0) 17.2 (21.5)
R
free
(outer shell) (%) 19.9 (27.5) 18.7 (22.2)
B
Hyb-24DNY and Hyb-24DNY-A
112
–Ald
Hyb-24DNY Hyb-24DNY-A
112
–Ald
Data collection
Space group P3
2
21 P3
2
21
Unit cell
parameters
a = b (A
˚
) 96.66 96.69
c (A
˚
) 112.94 112.91
Wavelength (A
˚

) 1.0000 1.0000
Resolution
(outer shell) (A
˚
)
50–1.51 (1.56–1.51) 50–1.51 (1.56–1.51)
Total reflections 1 037 212 549 789
Unique reflections
(outer shell)
96 062 (9515) 96 045 (9326)
Completeness
(outer shell) (%)
99.9 (100) 99.5 (97.5)
R
merge
(outer shell)
(%)
5.0 (26.5) 6.3 (47.1)
<I> ⁄ <r(I)> 68.3 (9.20) 31.7 (2.2)
Refinement
Resolution (outer
shell) (A
˚
)
46.8–1.51 (1.60–1.51) 33.6–1.51 (1.60–1.51)
R
work
(outer shell)
(%)
a

18.6 (23.0) 17.5 (23.6)
R
free
(outer shell)
(%)
b
19.9 (24.8) 19.0 (24.4)
a
R ¼
P
hkl
F
obs
kÀkF
calc
P
hkl
F
obs
jj
ÀÁ






À1
, k: scaling factor.
b

R ¼
P
hkl
F
obs
k
ÀkF
calc
P
hkl
F
obs
jj
ÀÁ






À1
, k: scaling factor.
Molecular design of nylon oligomer hydrolase Y. Kawashima et al.
2554 FEBS Journal 276 (2009) 2547–2556 ª 2009 The Authors Journal compilation ª 2009 FEBS
been deposited in the Protein Data Bank (http://www.
rcsb.org/). The structures of Hyb-24 (Protein Data Bank
ID code: 1WYB) [11], Hyb-24DN (Protein Data Bank ID
code: 1WYC) [12] and Hyb-24DN-A
112
–Ald (Protein Data

Bank ID code: 2DCF) [12] have been previously reported.
Figures of three-dimensional models of proteins were gener-
ated with molfeat (v. 3.6; FiatLux Co., Tokyo, Japan).
Acknowledgements
This work was supported in part by a Grant-in-Aid
for Scientific Research (Japan Society for Promotion
of Science), and grants from the GCOE Program, the
National Project on Protein Structural and Functional
Analyses, the basic research programs CREST type,
‘Development of the Foundation for Nano-Interface
Technology’ from JST and the JAXA project.
References
1 Negoro S (2000) Biodegradation of nylon oligomers.
Appl Microbiol Biotechnol 54, 461–466.
2 Negoro S (2002) Biodegradation of nylon and other
synthetic polyamides. Biopolymers 9, 395–415.
3 Kinoshita S, Negoro S, Muramatsu M, Bisaria VS,
Sawada S & Okada H (1977) 6-Aminohexanoic acid
cyclic dimer hydrolase: a new cyclic amide hydrolase
produced by Achromobacter guttatus KI72. Eur J
Biochem 80, 489–495.
4 Kinoshita S, Terada T, Taniguchi T, Takene Y, Masu-
da S, Matsunaga N & Okada H (1981) Purification and
characterization of 6-aminohexanoic acid oligomer
hydrolase of Flavobacterium sp. KI72. Eur J Biochem
116, 547–551.
5 Negoro S, Kakudo S, Urabe I & Okada H (1992) A
new nylon oligomer degradation gene (nylC) on plasmid
pOAD2 from Flavobacterium sp. J Bacteriol 174, 7948–
7953.

6 Kakudo S, Negoro S, Urabe I & Okada H (1993)
Nylon oligomer degradation gene, nylC on plasmid
pOAD2 from a Flavobacterium strain encodes endo-type
6-aminohexanoate oligomer hydrolase: purification and
characterization of the nylC gene product. Appl Environ
Microbiol 59, 3978–3980.
7 Kato K, Ohtsuki K, Koda Y, Maekawa T, Yomo T,
Negoro S & Urabe I (1995) A plasmid encoding
enzymes for nylon oligomer degradation: nucleotide
sequence and analysis of pOAD2. Microbiology 141,
2585–2590.
8 Negoro S, Taniguchi T, Kanaoka M, Kimura H &
Okada H (1983) Plasmid-determined enzymatic
degradation of nylon oligomers. J Bacteriol 155, 22–31.
9 Okada H, Negoro S, Kimura H & Nakamura S
(1983) Evolutionary adaptation of plasmid-encoded
enzymes for degrading nylon oligomers. Nature 306,
203–206.
10 Kato K, Fujiyama K, Hatanaka HS, Prijambada ID,
Negoro S, Urabe I & Okada H (1991) Amino acid
alterations essential for increasing the catalytic activity
of the nylon-oligomer degradation enzyme of Flavobac-
terium sp. Eur J Biochem 200, 165–169.
11 Negoro S, Ohki T, Shibata N, Mizuno N, Wakitani Y,
Tsurukame J, Matsumoto K, Kawamoto I, Takeo M &
Higuchi Y (2005) X-ray crystallographic analysis of
6-aminohexanoate-dimer hydrolase: molecular basis
for the birth of a nylon oligomer degrading enzyme.
J Biol Chem 280, 39644–39652.
12 Negoro S, Ohki T, Shibata N, Sasa K, Hayashi H,

Nakano H, Yasuhira K, Kato D, Takeo M & Higuchi
Y (2007) Nylon-oligomer degrading enzyme ⁄ substrate
complex: catalytic mechanism of 6-aminohexanoate-
dimer hydrolase. J Mol Biol 370, 142–156.
13 Ohki T, Wakitani Y, Takeo M, Yasuhira K, Shibata N,
Higuchi Y & Negoro S (2006) Mutational analysis of
6-aminohexanoate-dimer hydrolase: relationship
between nylon oligomer hydrolytic and esterolytic
activities. FEBS Lett 580, 5054–5058.
14 Ohki T, Mizuno N, Shibata N, Takeo M, Negoro S
& Higuchi Y (2005) Crystallization and x-ray diffrac-
tion analysis of 6-aminohexanoate-dimer hydrolase
from Arthrobacter sp. KI72. Acta Crystallogr
F61,
928–930.
15 Hatanaka HS, Fujiyama K, Negoro S, Urabe I &
Okada H (1991) Alteration of catalytic function of
6-aminohexanoate-dimer hydrolase by site-directed
mutagenesis. J Ferment Bioeng 71, 191–193.
16 Shimamura T, Ibuka A, Fushinobu S, Wakagi T,
Ishiguro M, Ishii Y & Matsuzawa H (2002) Acyl-inter-
mediate structures of the extended-spectrum class A
b-lactamase, Toho-1, in complex with cefotaxime,
cephalothin, and benzylpenicillin. J Biol Chem 277,
46601–46608.
17 Minasov G, Wang X & Shoichet BK (2002) An ultra-
high resolution structure of TEM-1b-lactamase suggests
a role for Glu166 as the general base in acylation. JAm
Chem Soc 124, 5333–5340.
18 Golemi-Kotra D, Meroueh SO, Kim C, Vakulenko SB,

Bulychev A, Stemmler AJ, Stemmler TL & Mobashery
S (2004) The importance of a critical protonation state
and the fate of the catalytic steps in class A b-lactamas-
es and penicillin-binding proteins. J Biol Chem 279,
34665–34673.
19 Banerjee S, Pieper U, Kapadia G, Pannell LK & Herz-
berg O (1998) Role of the omega-loop in the activity,
substrate-specificity, and structure of class-A b-lactam-
ase. Biochemistry 37, 3286–3296.
20 Hermann JC, Ridder L, Mulholland AJ & Holtje HD
(2003) Identification of Glu166 as the general base in
Y. Kawashima et al. Molecular design of nylon oligomer hydrolase
FEBS Journal 276 (2009) 2547–2556 ª 2009 The Authors Journal compilation ª 2009 FEBS 2555
the acylation reaction of class A b-lactamases
through QM ⁄ MM modeling. J Am Chem Soc 125,
9590–9591.
21 Ito W, Ishiguro H & Kurosawa Y (1991) A general
method for introducing a series of mutations into
cloned DNA using the polymerase chain reaction. Gene
102, 67–70.
22 Otwinowski Z & Minor W (1997) Processing of x-ray
diffraction data collected in oscillation mode. Meth
Enzymol 276, 307–326.
23 Brunger AT, Adams PD, Clore GM, DeLano WL,
Gros P, Grosse-Kunstleve RW, Jiang JS, Kuszewski J,
Nilges N, Pannu NS et al. (1998) Crystallography and
NMR system (CNS): a new software system for macro-
molecular structure determination. Acta Crystallogr
D54, 905–921.
24 McRee DE (1993) Practical Protein Crystallography.

Academic Press, San Diego, CA.
Supporting information
The following supplementary material is available:
Fig. S1. Stereoview of the catalytic cleft of Hyb-24DN.
Fig. S2. Stereoviews of surface structure of Ald-bound
and unbound Hyb-24DNY.
Fig. S3. Stereoview of the catalytic cleft of Hyb-
24DNY and class A b-lactamase (TEM-1).
Table S1. Effect of amino acid alterations at position
370 in Hyb-24 on enzyme activity.
This supplementary material can be found in the
online version of this article.
Please note: Wiley-Blackwell is not responsible for
the content or functionality of any supplementary
materials supplied by the authors. Any queries (other
than missing material) should be directed to the corre-
sponding author for the article.
Molecular design of nylon oligomer hydrolase Y. Kawashima et al.
2556 FEBS Journal 276 (2009) 2547–2556 ª 2009 The Authors Journal compilation ª 2009 FEBS