Báo cáo khoa học: Adenine, a hairpin ribozyme cofactor – high-pressure and competition studies potx

Adenine, a hairpin ribozyme cofactor – high-pressure and
competition studies
Myriam Ztouti
1,
*, Hussein Kaddour
1,
*, Francisco Miralles
1
, Christophe Simian
1
, Jacques Vergne
1
,
Guy Herve
´
2
and Marie-Christine Maurel
1
1 Acides Nucle
´
iques et Biophotonique, FRE 3207 CNRS, Fonctions et Interactions des Acides Nucle
´
iques, UPMC Universite
´
Paris 06,
France
2 Laboratoire Prote
´
ines, Biochimie Structurale et Fonctionnelle, FRE 2852 CNRS, UPMC Universite
´
Paris 06, France

An important issue in the problem of the origin of life
is whether or not an RNA world could have been
compatible with extreme primordial conditions. This
scenario of evolution postulates that an ancestral
molecular world is common to all present forms of life;
the functional properties of nucleic acids and proteins
as we see them today, especially catalytic properties,
would have been carried out by ribonucleic acids [1–6].
Catalytic RNAs, or ribozymes, are found nowadays in
the human genome [7], organelles of plants [8] and
lower eukaryotes, amphibians, prokaryotes, bacterio-
phages, and viroids and satellite viruses that infect
plants. A ribozyme also exists in hepatitis delta virus,
a serious human pathogen [9].
Additional ribozymes will certainly be found in the
future, and it is tempting to look for RNA cofactors
such as those found in protein enzymes [10]. Indeed,
RNA could increase its range of functionalities by
incorporating catalytic building blocks such as imidaz-
ole, thiol, and functional amino and carboxylate
groups [11–13]. Another way for RNA to increase its
chemical diversity would be to bind exogenous mole-
cules carrying reactive groups and handle them as
catalytic cofactors. We reported the isolation of new
RNA aptamers able to bind adenine in a novel mode
of purine recognition [14]. Adenine is a probable prebi-
otic analog of histidine. Its catalytic capabilities are
equivalent to those of histidine, because of the
Keywords
adenine; catalysis; hairpin ribozyme; high

pressure; RNA
Correspondence
M C. Maurel, Acides Nucle
´
iques et
Biophotonique (ANBioPhy), Universite
´
Pierre
et Marie Curie, Tour 42–(42–43)–5
e
`
me
e
´
tage,
4 place Jussieu, 75252 Paris Cedex 05,
France
Fax: +33 1 44 27 99 16
Tel: +33 1 44 27 40 21
E-mail:
*These authors contributed equally to this
work
(Received 28 November 2008, revised 29
January 2009, accepted 25 February 2009)
doi:10.1111/j.1742-4658.2009.06983.x
The RNA world hypothesis assumes that life arose from ancestral RNA
molecules, which stored genetic information and catalyzed chemical reac-
tions. Although RNA catalysis was believed to be restricted to phosphate
chemistry, it is now established that the RNA has much wider catalytic
capacities. In this respect, we devised, in a previous study, two hairpin

ribozymes (adenine-dependent hairpin ribozyme 1 and adenine-dependent
hairpin ribozyme 2) that require adenine as cofactor for their reversible
self-cleavage. We have now used high hydrostatic pressure to investigate
the role of adenine in the catalytic activity of adenine-dependent hairpin
ribozyme 1. High-pressure studies are of interest because they make it pos-
sible to determine the volume changes associated with the reactions, which
in turn reflect the conformational modifications and changes in hydration
involved in the catalytic mechanism. They are also relevant in the context
of piezophilic organisms, as well as in relation to the extreme conditions
that prevailed at the origin of life. Our results indicate that the catalytic
process involves a transition state whose formation is accompanied by a
positive activation volume and release of water molecules. In addition,
competition experiments with adenine analogs strongly suggest that exo-
genous adenine replaces the adenine present at the catalytic site of the
wild-type hairpin ribozyme.
Abbreviation
ADHR1, adenine-dependent hairpin ribozyme 1.
2574 FEBS Journal 276 (2009) 2574–2588 ª 2009 The Authors Journal compilation ª 2009 FEBS
presence of the imidazole moiety [15]. In this respect,
we produced two adenine-dependent hairpin ribozymes
[adenine-dependent hairpin ribozyme 1 (ADHR1) and
adenine-dependent hairpin ribozyme 2] that require
adenine as a catalytic cofactor for their reversible self-
cleavage [16]. Figure 1 shows the structure of the mod-
ified ADHR1 used here. These hairpin ribozymes use
different catalytic strategies with respect to wild-type
hairpin ribozyme, by using exogenous adenine as a
cofactor for catalysis. These hairpin ribozymes are of
great interest with respect to the primitive RNA world
hypothesis. Adenine is synthesized in significant

amounts in experiments aimed at mimicking the prebi-
otic conditions [17]. It can be considered as a prebiotic
analog of histidine, and could have been used by ribo-
zymes of the RNA world in the same way as present-
day enzymes use histidine.
The hairpin ribozyme is a small RNA molecule that
catalyzes the reversible cleavage of a phosphodiester
bond [18]. The cleavage reaction proceeds via nucleo-
philic attack of a 2¢-OH group on an adjacent phos-
phorus atom, resulting in a 2¢,3¢-cyclic phosphate and
a5¢-hydroxyl terminus [19]. The catalytic mechanisms
of the hairpin ribozyme are not entirely understood.
Nevertheless, it has been concluded that an important
conformational transition of the molecule is necessary
to allow the formation of the active site [20]. The mini-
mal catalytic form of the hairpin ribozyme is com-
posed of two adjacent helix–loop–helix domains, A
and B (Fig. 1). The hairpin ribozyme can form an
extended conformation (undocked state) or a bent con-
formation (docked state). In the docked state, loops A
and B come into close contact, forming the active site
[21,22]. Most of the nucleotides in loops A and B are
essential for catalysis [23]. Among them, adenine 38
has been identified as a key residue [24–28]. Structural
and mechanistic studies have shown that divalent
cations stabilize the hairpin ribozyme in its docked
conformation, but do not participate directly in cataly-
sis [29,30]. Indeed, hairpin ribozymes remain func-
tional in reactions without divalent cations [29,31],
excluding a catalytic requirement for metal-bound

water or direct metal coordination to ribose or phos-
phate oxygen atoms, and no metal ions have been
found in the active site [25].
In a previous study, the effects of hydrostatic pres-
sure on the catalytic activity of the minimal hairpin
ribozyme were studied [32]. Several factors led us to
use this methodology: First, pressure makes it possible
to determine the thermodynamic constants of the reac-
tion and the volume changes associated with it, allow-
ing evaluation of the conformational modifications
involved in the catalytic mechanism. Pressure revers-
ibly modifies hydrophobic and ionic interactions, thus
altering the solvation of the macromolecules. As a con-
sequence, pressure modifies the equilibrium constant of
a reaction if it is accompanied by a significant volume
change (DV). It can also modify the kinetics of reac-
tions that involve a significant activation volume
(DV
„
). Therefore, DV and DV
„
can be directly esti-
mated by analyzing the variation of the reaction equi-
librium and rate constants as a function of pressure.
Second, the existence of contemporary life in extreme
conditions, such as the volcanic deep-sea vents, provid-
ing habitats for living cellular and viral species,
encouraged us to focus on the activity and persistence
of RNA under extreme conditions of hydrostatic
pressure, osmotic pressure, and temperature [32,33].

Fig. 1. Wild-type and adenine-dependent hairpin ribozyme struc-
tures. (A) Minimal wild-type self-cleaving hairpin ribozyme. (B)
ADHR1. Both ribozymes contain four helices and two loops. The
cleavage site in each hairpin ribozyme is indicated by an arrow.
Nucleotides differing between the two hairpin ribozymes are indi-
cated by black dots. 3¢-Extensions and 5¢-extensions added for
hybridization with replication primers are shown in light type.
M. Ztouti et al. Adenine-dependent ribozyme under pressure
FEBS Journal 276 (2009) 2574–2588 ª 2009 The Authors Journal compilation ª 2009 FEBS 2575
Finally, the study of RNA under high hydrostatic
pressure could help in the evaluation of the relevance
of the RNA world hypothesis, in particular in the con-
text of the extreme conditions of early life. In this
regard, it is now proposed that life could have origi-
nated around the deep-sea vents [34], although this is
still a matter of controversy [35–37]. The high pressure
in these environments could have enhanced some prim-
itive reactions whose DV and DV
„
would have been
unfavorable. Compensatory effects between tempera-
ture and pressure could have facilitated adaptation to
these environments. The rich chemistry, temperature
and high pressure prevailing around the deep-sea vents
offer a plausible environment for the emergence of life
[35].
High hydrostatic pressures (up to 200 MPa) were
previously applied to the hairpin ribozyme, with the
knowledge that the covalent bonds in nucleic acids are
stable up to at least 1200 MPa, and are therefore not

affected. The results obtained from experiments using
hydrostatic and osmotic pressure showed that the cata-
lytic process involves a transition state whose forma-
tion is accompanied by a positive DV
„
of
34 ± 5 mLÆmol
)1
, associated with a release of 78 ± 4
water molecules per RNA molecule [32]. These results
agree with the conclusion that the hairpin ribozyme
must undergo an important conformational change
that brings loops A and B into close contact.
In the present work, and in order to obtain more
information on the mechanism by which adenine
restores the catalytic activity of ADHR1, we examined
the influence of hydrostatic pressure (up to 150 MPa)
on this hairpin ribozyme (Fig. 1B). Our results indicate
that, as in the case of the wild-type hairpin ribozyme,
the catalytic process involves a transition state whose
formation is accompanied by an apparent positive
DV
„
and a release of water molecules. Unexpectedly,
this apparent DV
„
is not significantly reduced when
ADHR1 is preincubated in the presence of Mg
2+
.In

addition, competition experiments strongly suggest that
adenine binds to ADHR1 at the site where the adenine
of the wild-type ribozyme is present in the docked
conformation.
Results
Self-cleavage activity of ADHR1 requires both
adenine and Mg
2+
ADHR1 was obtained using the in vitro systematic
evolution of ligands by exponential enrichment proce-
dure, as described previously and summarized in
Experimental procedures. Its self-cleavage activity is
strictly dependent on adenine. However, its catalytic
activity also requires Mg
2+
, as does that of the wild-
type hairpin ribozyme. The respective roles of adenine
and Mg
2+
remain to be elucidated. Figure 2 shows
that a 10 min preincubation of ADHR1 with either
adenine or MgCl
2
before the addition of the comple-
mentary cofactor to the reaction mixture had no signif-
icant effect on the kinetics of the self-cleavage
reaction, although a very small increase in the reaction
rate was observed when the two cofactors were added
together. This indicates that both adenine and Mg
2+

must be present for the reaction to occur, and that the
order of addition of the two cofactors does not signifi-
cantly influence the reaction rate.
Lack of influence of ADHR1 concentration on the
rate of the ADHR1 cleavage reaction
Before analyzing the effects of pressure on the self-
cleavage reaction of ADHR1, it was verified that the
kinetics of this reaction are independent of hairpin
ribozyme concentration, as expected from a unimo-
lecular intramolecular reaction without trans-reaction
between two hairpin ribozyme molecules. For this
purpose, the kinetics of the self-cleavage reaction
0
10
20
30
40
50
60
70
80
0 50 100 150 200
Cleavage (%)
Time (min)
Fig. 2. The self-cleavage kinetics of ADHR1 are independent of the
order of addition of the cofactors adenine and Mg
2+
. The kinetics
of self-cleavage of ADHR1 were analyzed after 10 min of preincu-
bation with either adenine (d) or MgCl

2
(h) before starting the
reaction by adding the complementary cofactor. These kinetics are
not significantly different from those obtained when the two
cofactors are added simultaneously (e). The curves were obtained
by fitting the results to the expected exponential kinetics
(Experimental procedures).
Adenine-dependent ribozyme under pressure M. Ztouti et al.
2576 FEBS Journal 276 (2009) 2574–2588 ª 2009 The Authors Journal compilation ª 2009 FEBS
were determined at atmospheric pressure with hairpin
ribozyme concentrations from 0.5 to 1.5 lm. The
results obtained (Fig. 3) indicated that the cleavage
rate of ADHR1 was indeed independent of its con-
centration over the range analyzed, as expected for
an exponential equilibration. The following experi-
ments were performed using 0.5 lm hairpin
ribozyme.
Effects of hydrostatic pressure on the rate of the
ADHR1 self-cleavage reaction
To determine whether the self-cleavage activity of
ADHR1 is altered by pressure, as is the case for the
wild-type hairpin ribozyme [32], the amounts of
ADHR1 cleaved after 1 h of incubation in the pres-
ence of 6 mm Mg
2+
and 6 mm adenine at various
pressures up to 150 MPa were determined. Figure 4
shows that the amounts decreased regularly, indicating
that pressure had an important negative effect on the
rate of the reaction. This effect could result from a

modification of the catalytic constant of the reaction,
or of its equilibrium constant, or both. To distinguish
between these possibilities, the kinetics of the reaction
were followed at pressures ranging from 0.1 to
200 MPa over 6 h. The percentages of cleavage were
determined (see Experimental procedures), and each
curve was fitted to an exponential so as to extract the
values of the rate constant and of the apparent equilib-
rium. However, it is well established that Mg
2+
induces the docking of loops A and B for the struc-
tural organization of the catalytic site, and in the case
of the wild-type hairpin ribozyme, it was hypothesized
that the apparent DV
„
measured corresponds to both
the volume change associated with the docking process
and the strict DV
„
of activation related to the forma-
tion of the transition state. Upon addition of Mg
2+
alone, ADHR1 might condense into the closed confor-
mation, even in the absence of adenine, which is then
required for the reaction to occur. To answer this
question, two different sets of experiments were con-
ducted. In the first, ADHR1 was preincubated for
10 min with MgCl
2
before addition of adenine and

application of pressure. In the second, ADHR1 was
preincubated with adenine for 10 min before addition
of MgCl
2
and application of pressure. The results
obtained are shown in Figs 5 and 6.
The fit of the kinetic data to the exponential equa-
tion (Figs 5A and 6A) made it possible to estimate the
rate (k
obs
) at each pressure analyzed. This rate con-
stant clearly decreased with increasing hydrostatic
pressure, and the logarithm of this constant was then
plotted as a function of pressure. For both sets of
experiments, a linear decrease of the logarithm of the
k
obs
with increasing pressure was observed (Figs 5B
0
10
20
30
40
50
60
70
80
0 50 100 150 200 250 300 350 400
Cleavage (%)
Time (min)

Fig. 3. Effect of the concentration of ADHR1 on the kinetics of the
self-cleavage reaction. Kinetics of the ADHR1 self-cleavage reaction
at atmospheric pressure and ribozyme concentrations of: d,
0.5 l
M;+,1lM; e, 1.5 lM.
0
5
10
15
20
25
30
35
0 255075100125150
Cleavage (%)
Pressure (MPa)
Fig. 4. Effect of hydrostatic pressure on the self-cleavage activity.
The fraction of cleaved ADHR1 after 1 h of incubation under
increasing pressure (up to 150 MPa) is shown as function of the
pressure applied. ADHR1 (0.5 l
M) was incubated in the presence
of 6 m
M Mg
2+
and 6 mM adenine, as described in Experimental
procedures.
M. Ztouti et al. Adenine-dependent ribozyme under pressure
FEBS Journal 276 (2009) 2574–2588 ª 2009 The Authors Journal compilation ª 2009 FEBS 2577
and 6B). Such a variation is characteristic of reactions
involving a positive apparent DV

„
that can be calcu-
lated from the slope of the graphs. This gives activa-
tion volumes of 26 ± 1.7 mLÆmol
)1
for the first set of
experiments (ADHR1 preincubated with MgCl
2
) and
23±2mLÆmol
)1
for the second set of experiments
(ADHR1 preincubated with adenine). These values
were very close to and slightly lower than that
obtained in the case of the wild-type hairpin ribozyme
(34 ± 5 mLÆmol
)1
).
The values of the equilibrium constant K
eq
provided
by the fit of the experimental data to an exponential
process also showed a linear decrease in the logarithm
of K
eq
with increasing pressure (Figs 5C and 6C).
From the slope of these graphs, DV values of
16 ± 1.8 mLÆmol
)1
and 14 ± 1 mLÆmol

)1
were calcu-
lated for the first and second set of experiments,
respectively. These values were not significantly differ-
ent from that obtained in the case of the wild-type
hairpin ribozyme (17 ± 4.5 mLÆmol
)1
).
Reversibility of the effects of hydrostatic pressure
The decrease in the equilibrium constant reported
above could result from some irreversible alterations
of the RNA molecule. To check this possibility, we
investigated the reversibility of the decrease of hairpin
ribozyme activity observed at 150 MPa. The reaction
was followed at this pressure for 3 h, the reaction mix-
ture was then instantly brought back to atmospheric
pressure, and the reaction was allowed to proceed for
a further 3 h. The percentage of cleaved hairpin ribo-
zyme was then plotted as a function of time. Figure 7
shows that, as soon as the reaction mixture was
returned to atmospheric pressure, the reaction reached
the rate observed at atmospheric pressure. Thus, the
negative effects of pressures up to 150 MPa on the
hairpin ribozyme activity were fully reversible. How-
ever, the reaction rate appeared to be slightly higher
than that of the control at atmospheric pressure, sug-
gesting that preincubation at elevated pressure had a
small favorable effect on the rate of the reaction. In
0
10

20
30
40
50
60
70
80
0 50 100 150 200 250 300 350 400
–6.5
–6
–5.5
–5
–4.5
0 20406080100120140160
ΔV
#
= 26 ± 1 mL·mol
–1
–2
–1.5
–1
–0.5
0
0 20 40 60 80 100 120 140 160
ΔV = 16 ± 1 mL·mol
–1
Time (min)
Pressure (MPa)
Pressure (MPa)
Cleavage (%)

In k
obs
In K
eq
A
B
C
Fig. 5. Cleavage kinetics at various hydrostatic pressures of
ADHR1 preincubated with MgCl
2
. (A) Cleavage kinetics are shown
for the reaction conducted at atmospheric pressure (d), 25 MPa
(h), 50 MPa (e), 75 MPa (·), 100 MPa (+), and 125 MPa (D). In
these experiments, ADHR1 was brought to the indicated pressures
after 10 min of preincubation with Mg
2+
, followed by the addition
of adenine. (B) Logarithm of the observed cleavage rate (k
obs
)asa
function of pressure. (C) Logarithm of the calculated equilibrium
constant (K
eq
) as a function of pressure. K
eq
was obtained from the
exponential fit of the results (Experimental procedures) and corre-
sponds to the cleaved ⁄ uncleaved RNA concentration ratio.
Adenine-dependent ribozyme under pressure M. Ztouti et al.
2578 FEBS Journal 276 (2009) 2574–2588 ª 2009 The Authors Journal compilation ª 2009 FEBS

any case, the negative effects of high pressures (up to
150 MPa) on the hairpin ribozyme activity were fully
reversible.
Change in equilibrium upon pressure variation
The kinetics of the self-cleavage reaction under pres-
sure reported above show a decrease of the apparent
equilibrium constant of this reaction, corresponding to
a positive DV. This variation of the apparent equilib-
rium constant could result either from inactivation of
the hairpin ribozyme under pressure (something that is
unlikely on the basis of the results presented in the
preceding section) or from re-equilibration of the reac-
tion on the basis of the DV, the pressure increasing the
rate of the ligation reaction. To test these possibilities,
the cleavage reaction was followed at atmospheric
pressure for 3 h, the pressure was then raised to
0
10
20
30
40
50
60
70
80
0 50 100 150 200 250 300 350 400
–6.5
–6
–5.5
–5

–4.5
0 20 40 60 80 100 120 140 160
–2
–1.5
–1
–0.5
0
0 20 40 60 80 100 120 140 160
Time (min)
Pressure (MPa)
Cleavage (%)
In k
obs
In K
eq
ΔV
≠
= 23 ± 2 mL·mol
–1
ΔV

= 14 ± 1mL·mol
–1
Pressure (MPa)
A
B
C
Fig. 6. Cleavage kinetics at various hydrostatic pressures of
ADHR1 preincubated with adenine. (A) Cleavage kinetics are shown
for the reaction conducted at atmospheric pressure (d), 25 MPa

(h), 50 MPa (e), 75 MPa (·), 100 MPa (+), 125 MPa (D), and
150 MPa (r). In these experiments, ADHR1 was brought to the
indicated pressures after 10 min of preincubation with adenine, fol-
lowed by the addition of Mg
2+
. (B) Logarithm of the observed
cleavage rate (k
obs
) as a function of pressure. (C) Logarithm of the
calculated equilibrium constant (K
eq
) as a function of pressure. K
eq
was obtained from the exponential fit of the results (Experimental
procedures), and corresponds to the cleaved ⁄ uncleaved RNA
concentration ratio.
0
10
20
30
40
50
60
70
80
0 50 100 150 200 250 300 350 400
Cleavage (%)
Time (min)
Fig. 7. Reversibility of the effects of hydrostatic pressure on the
catalytic activity of ADHR1. Cleavage kinetics are shown for the

reaction at atmospheric pressure (d) and at 150 MPa (h). After 3 h
of reaction under pressure, the reaction mixture was quickly
brought to atmospheric pressure, and the reaction was followed for
a further 3 h (e).
M. Ztouti et al. Adenine-dependent ribozyme under pressure
FEBS Journal 276 (2009) 2574–2588 ª 2009 The Authors Journal compilation ª 2009 FEBS 2579
150 MPa, and the reaction was followed for another
3 h (data not shown). A decrease in the equilibrium
was observed, indicating that the ligation reaction pro-
ceeded under pressure for the system to reach a new
value of the equilibrium constant dictated by the DV
of the reaction. However, the low extent of this pro-
cess (about 20%), the existence of unexplained small
oscillations upon application of the pressure and the
rapid hydrolysis of the cyclic phosphate at the 2¢–3¢-
end of the cleaved hairpin ribozyme [38] precluded
study of the DV values associated with the ligation
reaction.
Influence of hydrostatic pressure on the Mg
2+
dependence of the ADHR1 self-cleavage reaction
The catalytic activity of ADHR1 is Mg
2+
-dependent.
Thus, the decrease in the rate constant of the self-
cleavage reaction under pressure could result from a
conformational change affecting the affinity of the
hairpin ribozyme for Mg
2+
. To test this possibility,

the Mg
2+
saturation curves of ADHR1 were deter-
mined at atmospheric pressure (Fig. 8A) and at
75 MPa (Fig. 8B), in the presence of Mg
2+
concentra-
tions ranging from 1 to 20 mm. It appears that these
saturation curves are sigmoidal-like in the case of the
wild-type hairpin ribozyme (Fig. 8C). Consequently,
the curves were fitted to the Hill equation. This yielded
Mg
2+
half-saturation concentrations of 10.7 ± 2
and 12.6 ± 2 mm, respectively, for the self-cleavage
reaction at atmospheric pressure and at 75 MPa. The
corresponding Hill coefficients were 1.8 ± 0.3 and
1.9 ± 0.4 respectively. These results indicate that the
binding of the Mg
2+
was not significantly altered by
pressure, either qualitatively or quantitatively.
Influence of hydrostatic pressure on the adenine
dependence of the ADHR1 self-cleavage reaction
As described above, ADHR1 was selected on the basis
of the strict dependence of its self-cleavage activity on
0
10
20
30

40
50
60
70
80
0 20 40 60 80 100
0
10
20
30
40
50
60
70
80
0 20 40 60 80 100
Atmospheric pressure
75 MPa pressure
0
0.05
0.1
0.15
0.2
0.25
0.3
0.35
0.4
0 10152025
V
i

(picomole·min
–1
)
Time (min)
Cleavage (%)
Time (min)
Cleavage (%)
Mgcl
2
(m
M)
5
A
B
C
Fig. 8. Influence of Mg
2+
concentration on the cleavage kinetics of
ADHR1 under pressure. (A, B) The cleavage kinetics of ADHR1
were analyzed in the presence of increasing concentrations of
MgCl
2
at atmospheric pressure (A) and at 75 MPa (B) in the pres-
ence of 6 m
M adenine. The MgCl
2
concentrations were: 3 mM (·),
6m
M (h), 9 mM (s), 12 mM (n), 16 mM (+), and 20 mM (r). (C)
The graphically determined initial rates of these reactions [atmo-

spheric pressure (d ) and 75 MPa (h)] were plotted as a function of
MgCl
2
concentration. The data were fitted to the Hill equation to
determine the Mg
2+
half-saturation concentration and to evaluate
the cooperativity of the binding of Mg
2+
to ADHR1.
Adenine-dependent ribozyme under pressure M. Ztouti et al.
2580 FEBS Journal 276 (2009) 2574–2588 ª 2009 The Authors Journal compilation ª 2009 FEBS
adenine. Therefore, the decrease in the reaction rate
observed under pressure could result from a decrease
in the affinity of ADHR1 for adenine. To examine
this possibility, the adenine saturation curve was
determined at atmospheric pressure and at 75 MPa.
Figure 9A shows the variation of the reaction rate as a
function of adenine concentration under these two
conditions. The double reciprocal plots of these results
(Fig. 9B) show that, although the reaction rate was
nearly sixfold lower at 75 MPa than at atmospheric
pressure, there was no significant difference in the
affinity of the hairpin ribozyme for adenine between
these two experimental conditions (3.8 ± 1 and
5.6 ± 2 mm respectively). Similar results were
obtained when these experiments were conducted at
higher pressures (data not shown). Thus, the decrease
in the rate constant observed under pressure did not
result from a decrease in the affinity of the hairpin

ribozyme for adenine.
Influence of osmotic pressure on the ADHR1
self-cleavage reaction
The positive apparent activation volume detected in
the hydrostatic pressure experiments indicates that the
self-cleavage reaction involves a compaction, which
should be accompanied by a decrease in the solvation
of the molecule. To investigate this prediction, the
effect of osmotic pressure on the kinetics of the self-
cleavage reaction was examined. The ADHR1 cleavage
rate was measured in the presence of increasing con-
centrations of poly(ethylene glycol) 400, the agent used
to increase the osmotic pressure in the solvent phase of
the incubation mixture [39]. The results presented in
Fig. 10A show that increasing concentrations of
poly(ethylene glycol) 400 up to 10% increased the
ADHR1 cleavage rate, confirming the release of water
molecules during the reaction. From the variation of
the reaction rate as a function of osmotic pressure
(Fig. 10B), it can be calculated [39] that the formation
of the transition state (probably including the domain
closure) involved the release of 100 ± 18 water mole-
cules per hairpin ribozyme molecule.
Competition experiments
Previous work showed that the specificity of adenine in
restoring the catalytic activity of ADHR1 is rather
loose [16], and that some adenine analogs, such as
6-methyladenine, purine, and even imidazole, can also
confer activity to this modified hairpin ribozyme,
although with slightly lower efficiency. Similarly, it

was shown that 2,6-diaminopurine, isocytosine and
3-methyladenine could restore the activity of an inac-
tive form of the hairpin ribozyme in which the essen-
tial adenine 38 was deleted or replaced by an abasic
analog [27]. It was observed that 2,6-diaminopurine
was significantly more efficient than adenine in restor-
ing the catalytic activity. In an attempt to obtain addi-
tional information about the binding of adenine and
some of its analogs to ADHR1, competition experi-
ments were performed. ADHR1 was incubated in the
presence of 6 mm Mg
2+
and in the presence of adenine
or one of its analogs, either alone or in combination in
I/V
i
(picomole·min
–1
)
A

B
Fig. 9. Influence of adenine concentration on the cleavage kinetics
of ADHR1 under pressure. The effect of adenine concentrations on
the rate of the self-cleavage reaction of ADHR1 was analyzed at
atmospheric pressure (d ) and under a pressure of 75 MPa (h)in
the presence of 6 m
M Mg
2+
. (A) The rates are shown here as a

function of adenine concentration. (B) The Lineweaver–Burke plot
was used to estimate the apparent K
d
values of adenine in the
reaction at atmospheric pressure and at 75 MPa. These are,
respectively. 3.8 ± 1 and 5.6 ± 2 m
M.
M. Ztouti et al. Adenine-dependent ribozyme under pressure
FEBS Journal 276 (2009) 2574–2588 ª 2009 The Authors Journal compilation ª 2009 FEBS 2581
various proportions. It appeared that isocytosine did
not reactivate ADHR1 (Fig. 11A), although it effi-
ciently inhibited the cleavage reaction promoted by
adenine. The Dixon plot obtained with the use of three
adenine concentrations yielded a value of 38 ± 5 mm
for the dissociation constant (K
i
) of isocytosine
(Fig. 11B). 3-Methyladenine did not either restore the
activity of ADHR1 (Fig. 11C), but it also inhibited the
adenine-dependent reaction, with a K
i
of 5±2mm
(Fig. 11D). The Dixon plots also show the competitive
nature of the inhibition by these two nucleobases
(Fig. 11B,D). Regarding 2,6-diaminopurine, Fig. 12
shows that this adenine analog was about 30% more
efficient than adenine in restoring the activity of
ADHR1, and that the reactivation by these two com-
pounds was not additive. When these two activators
are added together in various proportions, the rate of

the reaction lies between those observed in the pres-
ence of either adenine or 2,6-diaminopurine alone, as
predicted for a mechanism in which two activators
bind competitively at the same site [40]. Taken
together, these results indicate that adenine and its
analogs bind competitively to the same site(s). The lin-
earity of the Dixon plots suggests, in addition, that
this site is unique.
Discussion
ADHR1 was obtained by a selection procedure aimed
at identifying hairpin ribozymes whose catalytic activ-
ity depends on exogenous adenine. In the present
work, hydrostatic and osmotic pressures were used to
analyze the catalytic mechanism of ADHR1 and com-
pare it with that of the minimal wild-type hairpin ribo-
zyme from which it was produced, in an attempt to
obtain some information about the mechanism of reac-
tivation of this modified hairpin ribozyme by adenine.
This methodology allowed us previously to show that
the reaction of the wild-type hairpin ribozyme involves
an apparent DV
„
of 34 ± 5 mLÆmol
)1
, which was
interpreted as resulting from both the docking of
loops A and B and the formation of the transition
state [32]. Consistent with this interpretation, osmotic
pressure experiments showed that this process is
accompanied by the release of 78 ± 4 water molecules

per mole of RNA.
Apparent volume of activation (DV
„
)
To investigate the self-cleavage mechanism of ADHR1,
two sets of experiments were conducted under hydro-
static pressure. In the first set, ADHR1 was preincu-
bated with MgCl
2
before addition of adenine and the
application of pressure. In the second set, ADHR1
was preincubated with adenine, before addition of
MgCl
2
and the application of pressure. In both cases,
the analysis of the kinetics of the self-cleavage reaction
indicates that, as in the case of the wild-type hairpin
ribozyme, the reaction involves an apparent positive
DV
„
. Hence, the order of addition of adenine and
MgCl
2
has no apparent effect on the docking of the
modified hairpin ribozyme. Indeed, the DV
„
values
0
5
10

15
20
25
30
35
40
0 10152025303540
1.5 × 10
–14
2 × 10
–14
2.5 × 10
–14
3 × 10
–14
3.5 × 10
–14
4 × 10
–14
13579
KT ln (k
II
/k
o
) (dyne.cm)
Slope =
Δ
V
w
Time (min)

Cleavage (%)
Posm (× 10
6
) (dynes·cm
–2
)
5
2468
A
B
Fig. 10. Effect of osmotic pressure on the self-cleavage reaction.
(A) Cleavage kinetics are shown for increasing concentrations of
poly(ethylene glycol) 400 (v ⁄ v): 0% (d ), 2.5% (h), 5% (e), 7.5%
(·), and 10% (+). (B) The number of water molecules released dur-
ing the self-cleavage reaction was calculated from the slope of the
variation of KT ln (k
P
⁄ k
O
) as a function of osmotic pressure. k
P
and
k
O
are, respectively, the observed rate constants of the reaction
under osmotic stress and standard conditions, K the Boltzmann
constant, and T the absolute temperature [39].
Adenine-dependent ribozyme under pressure M. Ztouti et al.
2582 FEBS Journal 276 (2009) 2574–2588 ª 2009 The Authors Journal compilation ª 2009 FEBS
calculated from these kinetic experiments are very

similar (DV
„
=26±2mLÆmol
)1
and DV
„
=23±
2mLÆmol
)1
for the first and second sets of experi-
ments, respectively).
The fact that preincubation of ADHR1 with Mg
2+
does not decrease the apparent DV
„
of the reaction
was rather unexpected. As, in the case of the wild-type
hairpin ribozyme, this DV
„
was interpreted as corre-
sponding to both the docking process and the forma-
tion of the transition state, one could expect that
preincubation of ADHR1 with Mg
2+
would have pro-
moted docking and that, consequently, the reaction
then initiated by the addition of adenine would have
presented a significantly lower DV
„
. Such is not the

case, and several explanations can be proposed. In
spite of its rather high value, the DV
„
might corre-
spond only to the formation of the transition state of
the cleavage reaction. This would imply that, in the
experiments performed with the wild-type ribozyme
and ADHR1, this domain closure would be completed
during the 1 min lag-time between the addition of
MgCl
2
and the application of pressure. Alternatively,
the docking process in ADHR1 could require the
0
2
4
6
8
10
–60 –40 –20 20 40 60
0
5
10
15
20
25
30
35
40
0 10203040506070

0
5
10
15
20
25
30
0
5
10
15
20
25
30
35
40
0
–60 –40 –20 20 40 600
0 10203040506070
Time (min)
Time (min)
Isocytosine (m
M)
3-methyladenine (m
M)
Cleavage (%)Cleavage (%)
I/V
i
(picomole·min)
–1

I/V
i
(picomole·min)
–1
A
B
C
D
Fig. 11. Competition experiments with the
adenine analogs isocytosine and 3-methylad-
enine. (A) The kinetics of the self-cleavage
of ADHR1 were determined in the presence
of increasing concentrations of isocytosine
[0 m
M (d), 1 mM (s), 5 mM (e), 20 mM (·),
50 m
M (h)], in the presence of 6 mM ade-
nine. A control experiment was performed
in the presence of isocytosine alone (
). (C)
Identical experiments for 3-methyladenine,
with control in the presence of 6 m
M
3-methyladenine alone ( ). (B, D) Dixon
plots of the competition experiments
between adenine and isocytosine or
3-methyladenine: d,3m
M adenine; r,
6m
M adenine; s,10mM adenine.

0
10
20
30
40
50
60
02010 30 40 50 60 70
Time (min)
Cleavage (%)
Fig. 12. Competition experiments between adenine and 2,6-diamin-
opurine. The kinetics of self-cleavage of ADHR1 were determined in
the presence of increasing concentrations of 2,6-diaminopurine:
0m
M (d), 1 mM (s), and 5 mM (e). The adenine concentration was
kept at 6 m
M. The kinetics of self-cleavage of ADHR1 were also
determined at 6 m
M 2,6-diaminopurine in the absence of adenine ( ).
M. Ztouti et al. Adenine-dependent ribozyme under pressure
FEBS Journal 276 (2009) 2574–2588 ª 2009 The Authors Journal compilation ª 2009 FEBS 2583
simultaneous presence of both Mg
2+
and adenine. In
this respect, it is interesting to note that some indica-
tions exist that the requirement for Mg
2+
lies within
two ranges of concentration, the micromolar and mil-
imolar ranges [30].The need for both Mg

2+
and ade-
nine for the docking to occur might require only one
of these Mg
2+
-binding processes. The DV
„
values
obtained in both sets of experiments are also close to
that obtained in the case of the wild-type hairpin ribo-
zyme (DV
„
=34±5mLÆmol
)1
). This suggests that
there are no major differences in the amplitude of the
molecular rearrangements required for the activation
of ADHR1 as compared with the wild-type hairpin
ribozyme. However, on the basis of the osmotic pres-
sure experiments, about 100 ± 18 water molecules are
expelled during the ADHR1 self-cleavage reaction, a
value that is slightly higher than the 78 ± 4 water
molecules calculated in the case of the self-cleavage
reaction of the wild-type hairpin ribozyme. The extrap-
olation of the progress curves to equilibrium, calcu-
lated from the fit of these curves to an exponential
process, suggests that cleavage is also accompanied, in
both sets of experiments, by a positive DV. Indeed, DV
values of 16 ± 2 and 14 ± 1 mLÆmol
)1

were obtained
for the first and second experimental conditions,
respectively. This suggests that at the end of the reac-
tion, the hairpin ribozyme remains significantly less
solvated than the uncleaved molecule. A similar result
(DV =17±4mLÆmol
)1
) was obtained for the wild-
type hairpin ribozyme. Therefore, in both ADHR1
and wild-type hairpin ribozymes, once self-cleavage is
accomplished, the molecule remains slightly less
hydrated than the uncleaved hairpin ribozyme [32].
The rate constant of self-cleavage of the hairpin ribo-
zyme subjected to high hydrostatic pressures is com-
pletely recovered upon returning to atmospheric
pressure, indicating that the effects of pressure are
fully reversible, as was previously observed with the
wild-type hairpin ribozyme. Thus, hydrostatic pres-
sures up to 200 MPa do not damage the hairpin ribo-
zyme. This observation is consistent with other studies
showing that nucleic acids, and in particular RNA,
can withstand very high pressures [41–43]. This prop-
erty has been attributed to the base-paired double-heli-
cal topology of the molecule [44]. The decrease in the
rate constant of the self-cleavage reaction could have
resulted from a pressure-induced conformational
change that would affect binding of Mg
2+
or adenine.
However, our results concerning the dependence of

self-cleavage of ADHR1 under hydrostatic pressure on
the Mg
2+
and adenine concentrations clearly indicate
that neither the binding of Mg
2+
nor that of adenine
is altered by pressure.
Exogenous adenine requirement
As mentioned above, the active site of the hairpin
ribozyme is formed by the interaction of loops A and
B. Three active site nucleobases located near the reac-
tive phosphodiester, G8, A9, and A38, appear to be
directly involved in the catalytic chemistry. In particu-
lar, structural analysis has shown that A38 contri-
butes to the architecture of the active site through an
array of stacking and hydrogen-bonding interactions
[25,26,45,46]. Functional groups of A38 and part of
the G+1 binding pocket form a tertiary interaction
that is responsible for aligning the reactive phosphodi-
ester in the active site. A38 stacks above the essential
G+1, and N7 of G+1 accepts a hydrogen bond from
the 2¢-OH of A38. N7 of A38 also forms a hydrogen
bond with the (C6) NH
2
of A24. Each of these inter-
actions is likely to contribute to catalysis by fixing
the reactive phosphodiester in the geometry needed
for in-line attack. The proximity of the functional
groups of A38 to the reactive phosphodiester also

makes this nucleobase a good candidate for participa-
tion in the catalysis. Recent studies have focused on
the role of A38 in the formation of the reaction site.
Abasic substitution of A38 strongly reduces cleavage
and ligation activity [27]. In addition, exogenous nu-
cleobases such isocytosine, 3-methyladenine and 2,6-
diaminopurine, which share the amidine group of ade-
nine, restore the activity to abasic ribozyme variants
lacking A38. Detailed analysis of the pH dependence
of hairpin ribozymes variants with covalent substitu-
tions indicates that the optimal cleavage and ligation
reactions depend on the protonation state of A38
[27]. Moreover, a recent study has analyzed the crys-
tallographic structure of several hairpin ribozyme
variants at A38 position [47]. The structural effects of
the replacement of A38 by 2,6-diaminopurine, 2-ami-
nopurine, cytosine and guanine were analyzed. For
each variant, two substrate modifications were used
to mimic the precatalytic state and the conformation
of a reaction intermediate. The results revealed the
importance of the N1 and N6 groups of A38 in the
establishment of proper electrostatic interactions at
the catalytic site. The precatalytic structures of the
substitutions impairing the catalytic activity of the
hairpin ribozyme (AP38, Cyt38, and G38) showed the
greatest deviation at the scissile phosphate bond,
owing to differences in hydrogen bonding with vari-
ant functional groups (A38, DAP38). In addition, the
structures of the reaction intermediates of the non-
functional substitution were associated with non-

native conformations of the local fold (Gua38), as
well as syn to anti-base alterations for Cyt38 and
Adenine-dependent ribozyme under pressure M. Ztouti et al.
2584 FEBS Journal 276 (2009) 2574–2588 ª 2009 The Authors Journal compilation ª 2009 FEBS
Gua38. In such cases, the imino moiety faced away
from the O5¢ leaving group.
Interestingly, in ADHR1, the nucleotides involved in
the formation of the active site A10, G8 and A9 are
conserved, but A38 has been replaced by G38, which
lacks the amine group. Moreover, previous studies had
shown that, in addition to adenine, some adenine ana-
logs could restore the catalytic activity of ADHR1,
showing that the specificity of adenine in reactivating
ADHR1 is rather loose [16]. The competition experi-
ments reported here show that, among the adenine
analogs tested, some can rescue the catalytic activity of
ADHR1, as does adenine, whereas some are only com-
petitive inhibitors of adenine. It appears that 2,6-diam-
inopurine is more efficient than adenine at restoring
the activity of ADHR1. The behavior of all these
nucleobases shows a general pattern of competition for
their binding with low affinity (all in the millimolar
range) to the same site(s), whether or not they reacti-
vate ADHR1. The linearity of the Dixon plots suggests
that this site is unique. Similarly, it has been shown
that some inactive forms of the hairpin ribozyme in
which A38 was either deleted or replaced by abasic
nucleotides can be reactivated by adenine analogs such
as isocytosine, 3-methyladenine and 2,6-diaminopurine
when these analogs are either added to the cleavage

incubation medium or covalently incorporated in the
modified hairpin ribozyme in place of A38 [27]. Taken
together, these results suggest that the site at which all
these nucleobases bind competitively is the site where
A38 is normally present in the structure of the docked
conformation of the hairpin ribozyme, either restoring
activity or inhibiting this activity restored by adenine.
In this regard, it is interesting to note that externally
added adenine has no influence on the catalytic activity
of the wild-type hairpin ribozyme (unpublished result
from this laboratory). The results reported here might
be of significance regarding the adenine dependence of
riboswitches [10].
In the experiments reported here, 2,6-diaminopurine
appeared to be more efficient than adenine in restoring
the activity of ADHR1. In this regard, it is interesting
to note that the same difference was observed when
2,6-diaminopurine or adenine were covalently inserted
in position 38 in the hairpin ribozyme [27], suggesting
that the modes of action of these two nucleobases are
similar, whether they are inserted in the structure of
the hairpin ribozyme or externally added.
A recent study by Nam et al. [48] has highlighted
the importance of electrostatic interactions in the cata-
lytic site of the hairpin ribozyme, suggesting that rate
enhancement can be realized through nonspecific
electrostatic interactions in the solvated hairpin ribo-
zyme active site. The authors concluded that ‘in the
absence of a protonated A38 the ribozyme can exploit
an alternative reaction path that involves specific

hydrogen bonding interactions with active site nucleo-
bases to achieve catalysis’. In our case, this could
involve the externally added adenine or 2,6-diaminopu-
rine and, possibly, water molecules [49].
These properties and the plasticity of these small
RNA molecules, especially at the level of their
catalytic sites, might be of significance regarding the
conditions that prevailed in the supposed ‘RNA world’
or in an early stage of the development of life, when
small RNA would have played a major role. Popula-
tions of small RNA could have interacted randomly
with small metabolites of all kinds (including adenine
and analogs), although with low specificity and poor
affinity, but some of these transient complexes could
have acquired feeble catalytic properties. Strict specific-
ity and high affinity most probably then emerged pro-
gressively during evolution in the progressive transition
from chemical to biological catalysis.
Experimental procedures
Materials
DNA primers were provided by Proligo (Evry, France).
Taq DNA polymerase and PCR buffer were obtained from
Invitrogen (Carlsbad, CA, USA), and dNTPs from Pro-
mega (Madison, WI, USA). T7 RNA polymerase, rNTPs
and transcription buffer were obtained from Fermentas
(St Leon-Rot, Germany).
RNA preparation
The sequence of primer P1 (promoter primer) is 5¢-TAATA
CGACTCACTATAGGGTACGCTGAAACAGA-3¢, and
that of primer P2 (reverse primer) is 5¢-CCTCCGAA

ACAGGACTGTCAGGGGGTACCAG-3¢. The 85-nucleo-
tide template used as the minus strand in the synthesis of
ADHR1 was obtained by the systematic evolution of
ligands by exponential enrichment method [16]. In brief,
selection was started by introducing randomized substitu-
tions of nucleotides located in regions previously identified
as essential for the self-cleavage catalytic activity of the
hairpin ribozyme. The selection procedure was designed to
identify inactive hairpin ribozymes whose catalytic activity
could be rescued by free exogenous adenine. Its entire
sequence is 5¢-CCTCCGAAACAGGACTGTCAGGGGG
TACCAGGTAATGCATCACAACGTTTTCACGGTTGA
TTCTCTGTTTCAGCGTACCC-3¢. The two primer bind-
ing regions are located in the 5¢-terminus and 3¢-terminus.
A 4 mL PCR reaction with each primer (P1 and P2)
at 1.5 lm,6nm template and 100 units of Taq DNA
M. Ztouti et al. Adenine-dependent ribozyme under pressure
FEBS Journal 276 (2009) 2574–2588 ª 2009 The Authors Journal compilation ª 2009 FEBS 2585
polymerase in appropriate buffer was performed as follows:
2 min at 94 °C, 20 cycles of 30 s at 94 °C, 30 s at 56 °C,
and 1 min at 72 °C, and 7 min at 72 °C. The dsDNA pool
was ethanol precipitated and dissolved in water for in vitro
transcription. The reaction mixture (8 mL) contained 2 mm
each rNTP, 0.15 lm DNA and 4800 units of T7 RNA
polymerase in the transcription buffer (Fermentas). After
overnight incubation at 37 °C, treatment with DNase1
(2 unitsÆlg
)1
of DNA), and deproteinization, the full-length
uncleaved hairpin ribozyme was purified by 10% denatur-

ing PAGE, ethanol precipitated, and resuspended in
distilled water at a concentration of 25 lm, yielding approx-
imately 11 nmol of RNA.
RNA cleavage reaction
RNA (25 lm) in cleavage buffer (50 mm Tris ⁄ HCl,
pH 7.5, and 0.1 mm EDTA) was subjected to denaturation
and renaturation steps (heated to 90 °C for 1 min, and
then slowly cooled, at 3 °CÆmin
)1
,to23°C). The solutions
were completed with two cleavage buffers, one containing
6mm MgCl
2
and the second 6 mm adenine, at final con-
centrations such that RNA reached a final concentration
of 0.5 lm. The reaction started at room temperature, when
MgCl
2
and adenine were added to the mixture. Two con-
ditions for starting the reaction were used. The first condi-
tion consisted of incubation of RNA in the cleavage
buffer containing adenine, the reaction being started by
addition of MgCl
2
to the mixture. The second condition
was incubation of RNA in cleavage buffer containing
MgCl
2
, the reaction being started by addition of adenine
to the mixture. For the Mg

2+
dependence of the cleavage
reaction under hydrostatic pressure, RNA was incubated
in the cleavage buffer with adenine, and the reaction
was started by addition of the second buffer containing
MgCl
2
at a concentrations ranging from 3 to 20 mm.
When needed, various hydrostatic pressures were applied.
Aliquots were removed from the mixtures at various times,
and the reaction was stopped by adding one volume of
loading solution (7 m urea, 50 mm EDTA, pH 7.5, 0.01%
xylene cyanol).
Analysis of the products of the self-cleavage
reaction
After each cleavage reaction, ice-stored aliquots (80 lL
containing 0.55 lg of RNA) were analyzed by denaturing
10% PAGE and ethidium bromide staining. RNA frag-
ments were revealed by UV transillumination, and scanned.
The relative light intensities of the fragments were quanti-
fied using an image analyzer (imagej). The percentages of
cleavage were plotted as a function of time for each condi-
tion, subtracting the t
0
values so that all plots start at 0,
unless otherwise specified. Using the software kaleida-
graph, the kinetics toward equilibrium were fitted to the
exponential equation x ¼ x
eq
ð1 À e

Àk
obs
t
Þ, where x
eq
is the
fraction of cleaved RNA at equilibrium, x the fraction of
cleaved RNA at time t, and k
obs
the observed cleavage rate
constant. K
eq
was taken as the cleaved ⁄ uncleaved RNA
concentration ratio. The error bars applied to the rate
constant values were calculated on the basis of three
quantitative scans made on each of three independent
electrophoretic analyses.
Kinetics of the cleavage reaction under
hydrostatic pressure
The influence of hydrostatic pressure was investigated by
subjecting the reaction mixtures outlined above to constant
hydrostatic pressures ranging from 0.1 to 150 MPa, using
previously described apparatus that allows the removal of
samples from the incubation chamber while the pressure is
kept constant [50]. Aliquots were removed at various times
(0–360 min), quenched, ice-stored, and analyzed as described
below. For technical reasons, it takes 1–2 min to fill the
incubation chamber and apply the desired pressure. Conse-
quently, for the determination of the rate constants, the frac-
tion of hairpin ribozyme cleaved before applying pressure

was subtracted from all cleavage values so as to visualize
only the catalytic activity occurring under pressure. How-
ever, to estimate the equilibrium constants, the fraction of
RNA cleaved during this lag period and before the addi-
tion of MgCl
2
(during preparation and storage) was
taken into account. The DV
„
was calculated from the
equation k = A exp)(PDV
„
⁄ RT), where k is the rate con-
stant of the reaction, R is universal gas constant
(8.314 cm
3
ÆMPaÆK
)1
Æmol
)1
) (1 MPa = 10 bar = 10.13 atm),
T the temperature (K), and P the pressure (MPa) [51]. Error
bars were calculated on the basis of experimental variations
and using the margin of error given by the software for
the fits.
Kinetics of the self-cleavage reaction under
osmotic pressure
The influence of osmotic pressure was investigated by add-
ing an osmotic pressure agent to the cleavage medium,
poly(ethylene glycol) 400, as previously described [32]. This

agent was added at concentrations ranging from 0% to
10% (v ⁄ v). Aliquots were removed and quenched at various
times (0–40 min), ice-stored, and analyzed as described
below. The number of water molecules released upon hair-
pin ribozyme cleavage was calculated using the equation
dKT ln(k
P
⁄ k
O
) ⁄ dP
osm
= DV
w
= DN
w
(30 A
˚
3
), where k
P
is the observed cleavage rate constant (k
obs
) at osmotic
pressure P, k
O
the k
obs
in the absence of added solute, K
the Boltzmann constant, and T the temperature (K). DV
w

is
the change in volume, 30 A
˚
3
the molecular volume of
water, and DN
w
the linked change in the number of associ-
ated water molecules [39].
Adenine-dependent ribozyme under pressure M. Ztouti et al.
2586 FEBS Journal 276 (2009) 2574–2588 ª 2009 The Authors Journal compilation ª 2009 FEBS
Influence of pressure on the adenine and Mg
2+
saturation curves
The influence of pressure on the binding of adenine and
Mg
2+
to ADHR1 was investigated by analyzing the
self-cleavage reaction of the hairpin ribozyme at several
concentrations of adenine and MgCl
2
, either at atmospheric
pressure or under a hydrostatic pressure of 75 MPa. The
percentage of cleavage for each experimental condition was
then plotted as a function of time, and the kinetics were fit-
ted to the exponential equation described above, allowing
the estimation of the initial rates of the reaction. In the case
of Mg
2+
, the initial rates were plotted as a function of the

cofactor concentration, and the data were fitted to the Hill
equation, log(v ⁄ V
m
)v) = log K + n
H
log (s), where v is
the reaction rate, V
m
the maximal velocity, K the apparent
binding constant, n
H
the Hill coefficient, and (s) the Mg
2+
concentration. In the case of adenine, the apparent K
d
was
obtained from a double reciprocal plot.
Acknowledgements
This work was supported by grants from two specific
CNRS programs: GDR exobiologie and PID ‘Origines
des Plane
`
tes et de la Vie’. The authors are indebted
to A L. Haenni for reading and improving this
manuscript.
References
1 Woese CR (1965) On the evolution of the genetic code.
Proc Natl Acad Sci USA 54, 1546–1552.
2 Crick FH (1968) The origin of the genetic code. J Mol
Biol 38, 367–379.

3 Joyce GF (2002) The antiquity of RNA-based evolu-
tion. Nature 418, 214–221.
4 Orgel LE (1968) Evolution of the genetic apparatus.
J Mol Biol 38 , 381–393.
5 Gilbert W (1986) The RNA world. Nature 319, 618.
6 Gesteland RF, Cech TR & Atkins JF (1999) In The
RNA World. Cold Spring Harbor Laboratory Press,
New York, NY.
7 Salehi-Ashtiani K, Lupta
´
k A, Litovchick A & Szostak
JW (2006) A genomewide search for ribozymes reveals
an HDV-like sequence in the human CPEB3 gene. Sci-
ence 313, 1788–1792.
8 Przybilski R, Gra
¨
f S, Lescoute A, Nellen W, Westhof
E, Steger G & Hammann G (2005) Functional hammer-
head ribozymes naturally encoded in the genome of
Arabidopsis thaliana. Plant Cell 17, 1877–1885.
9 Taylor JM (1999) Replication of human hepatitis delta
virus: influence of studies on subviral plant pathogens.
Adv Virus Res 54, 45–60.
10 Cochrane JC & Strobel SA (2008) Riboswitches effec-
tors as protein enzyme cofactors. RNA 14, 993–1002.
11 Maurel MC (1992) RNA in evolution. J Evol Biol 5,
173–188.
12 Maurel MC & Haenni AL (2005) The RNA world:
hypothesis, facts and experimental results. In Lectures
in Astrobiology (Barbier B, Gargaud M, Martin H &

Reisse J, eds), pp. 557–581. Springer-Verlag, Berlin.
13 Kun A, Maurel MC, Santos M & Szathmary E (2005)
Fitness landscapes, error thresholds, and cofactors in
aptamer evolution. In The Aptamer Handbook (Kluss-
mann S, ed.), pp. 54–92. Wiley-VHC Verlag GmbH &
Co, Weinheim.
14 Meli M, Vergne J, Decout JL & Maurel MC (2002)
Adenine–aptamer complexes: a bipartite RNA site that
binds the adenine nucleic base. J Biol Chem 277, 2104–
2111.
15 Maurel MC & Ninio J (1987) Catalysis by a prebiotic
nucleotide analog of histidine. Biochimie 69, 551–553.
16 Meli M, Vergne J & Maurel MC (2003) In vitro selec-
tion of adenine-dependent hairpin ribozymes. J Biol
Chem 278, 9835–9842.
17 Oro J (1961) Mechanism of synthesis of adenine from
hydrogen cyanide under possible primitive earth condi-
tions. Nature 191, 1193–1194.
18 Walter NG & Burke JM (1998) The hairpin ribozyme:
structure, assembly and catalysis. Curr Opin Chem Biol
2, 24–30.
19 Fedor MJ (2002) The catalytic mechanism of the hair-
pin ribozyme. Biochem Soc Trans 30, 1109–1115.
20 Zhuang X, Kim H, Pereira MJ, Babcock HP, Walter
NG & Chu S (2002) Correlating structural dynamics
and function in single ribozyme molecules. Science 296,
1473–1476.
21 Feldstein PA & Bruening G (1993) Catalytically active
geometry in the reversible circularization of ‘mini-
monomer’ RNAs derived from the complementary

strand of tobacco ringspot virus satellite RNA. Nucleic
Acids Res 21, 1991–1998.
22 Komatsu Y, Kanzaki I, Koizumi M & Ohtsuka E
(1995) Construction of new hairpin ribozymes
with replaced domains. Nucleic Acids Symp Ser 34,
223–224.
23 Siwkowski A, Shippy R & Hampel A (1997) Analysis
of hairpin ribozyme base mutations in loops 2 and 4
and their effects on cis-cleavage in vitro. Biochemistry
36, 3930–3940.
24 Siwkowski A, DeYoung MB, Anderson P & Hampel A
(1997) Mutagenesis and modeling of the hairpin ribo-
zyme family. Methods Mol Biol 74, 357–363.
25 Rupert PB & Ferre-D’Amare AR (2001) Crystal
structure of a hairpin ribozyme–inhibitor complex
with implications for catalysis. Nature 410, 780–
786.
26 Rupert PB, Massey AP, Sigurdsson STh & Ferre
´
-
D’Amre
´
AR (2002) Transition state stabilization by a
catalytic RNA. Science 298, 1421–1424.
M. Ztouti et al. Adenine-dependent ribozyme under pressure
FEBS Journal 276 (2009) 2574–2588 ª 2009 The Authors Journal compilation ª 2009 FEBS 2587
27 Kuzmin YI, Da Costa CP, Cottrell JW & Fedor MJ
(2005) Role of an active site adenine in hairpin ribo-
zyme catalysis. J Mol Biol 349, 989–1010.
28 Siwkowski A, Humphrey M, De-Young MB & Hampel

A (1998) Screening for important base identities in the
hairpin ribozyme by in vitro selection for cleavage. Bio-
Techniques 24, 278–284.
29 Hampel A, DeYoung MB, Galasinski S & Siwkowski A
(1997) Design of the hairpin ribozyme for targeting spe-
cific RNA sequences. Methods Mol Biol 74, 171–177.
30 Wilson TJ & Lilley DM (2002) Metal ion binding and
the folding of the hairpin ribozyme. RNA 8, 587–600.
31 DeYoung MB, Siwkowski A & Hampel A (1997) Deter-
mination of catalytic parameters for hairpin ribozymes.
Methods Mol Biol 74, 209–220.
32 Tobe S, Heams T, Vergne J, Herve
´
G & Maurel MC
(2005) The catalytic mechanism of hairpin ribozyme
studied by hydrostatic pressure. Nucleic Acids Res 33,
2557–2564.
33 Vergne J, Cognet JA, Szathmary E & Maurel MC (2006)
In vitro selection of halo-thermophilic RNA reveals two
families of resistant RNA. Gene 371, 182–193.
34 Nisbet EG & Sleep NH (2001) The habitat and nature
of early life. Nature 409, 1083–1091.
35 Orgel LE (2004) Prebiotic chemistry and the origin of
the RNA world. Crit Rev Biochem Mol Biol 39, 99–
123.
36 Bada JL & Lazcano A (2002) Origin of life – some like
it hot, but not the first biomolecules. Science 296 , 1982–
1983.
37 Kawamura K (2004) Behavior of RNA under hydro-
thermal conditions and the origins of life. Int J Astrobi-

ol 3, 301–309.
38 Zhao ZY, McLeod A, Harusawa S, Araki L, Yamagu-
chi M, Kurihara T & Lilley DM (2005) Nucleobase
participation in ribozyme catalysis. J Am Chem Soc
127, 5026–5027.
39 Parsegian VA, Rand RP & Rau DC (1995) Macromole-
cules and water: probing with osmotic stress. Methods
Enzymol 259, 43–94.
40 Dixon M & Webb EC (1964) Enzyme kinetics. In
Enzymes (Green LA, ed.), pp. 84–87. Longmans, Green
and Co Ltd, London.
41 Macgregor RB (2002) The interactions of nucleic acids
at elevated hydrostatic pressure. Biochim Biophys Acta
1595, 266–276.
42 Giel-Pietraszuk M & Barciszewski J (2005) A nature of
conformational changes of yeast tRNA(Phe). High
hydrostatic pressure effects. Int J Biol Macromol 37,
109–114.
43 Fedoruk-Wyszomirska A, Wyszko E, Giel-Pietraszuk
M, Barciszewska MZ & Barciszewski J (2007) High
hydrostatic pressure approach proves RNA catalytic
activity without magnesium. Int J Biol Macromol 41,
30–35.
44 Girard E, Prange T, Dhaussy AC, Migianu-Griffoni E,
Lecouvey M, Chervin JC, Mezouar M, Kahn R &
Fourme R (2007) Adaptation of the base-paired dou-
ble-helix molecular architecture to extreme pressure.
Nucleic Acids Res 35, 4800–4808.
45 Rupert PB & Ferre-D’Amare AR (2004) Crystallization
of the hairpin ribozyme: illustrative protocols. Methods

Mol Biol 252, 303–311.
46 Salter J, Krucinska J, Alam S, Grum-Tokars V &
Wedekind JE (2006) Water in the active site of an
all-RNA hairpin ribozyme and effects of Gua8 base
variants on the geometry of phosphoryl transfer.
Biochemistry 45, 686–700.
47 MacElrevey C, Salter JD, Krucinska J & Wedekind JE
(2008) Structural effects of nucleobase variations at key
active site residue Ade38 in the hairpin ribozyme. RNA
14, 1600–1616.
48 Nam K, Gao J & York DM (2008) Electrostatic inter-
actions in the hairpin ribozyme account for the majority
of the rate acceleration without chemical participation
by nucleobases. RNA 14, 1501–1507.
49 Walter NG (2007) Ribozyme catalysis revisited: is water
involved? Mol Cell 28, 923–929.
50 Hui Bon Hoa GH, Hamel G, Else A, Weill G & Herve
´
G (1990) A reactor permitting injection and sampling
for steady state studies of enzymatic reactions at high
pressure: tests with aspartate transcarbamylase. Anal
Biochem 187, 258–261.
51 Heremans K (1982) High pressure effects on proteins
and other biomolecules. Annu Rev Biophys Bioeng 11,
1–21.
Adenine-dependent ribozyme under pressure M. Ztouti et al.
2588 FEBS Journal 276 (2009) 2574–2588 ª 2009 The Authors Journal compilation ª 2009 FEBS