Báo cáo khoa học: Role of DptE and DptF in the lipidation reaction of daptomycin ppt

Role of DptE and DptF in the lipidation reaction
of daptomycin
Melanie Wittmann, Uwe Linne, Verena Pohlmann and Mohamed A. Marahiel
Department of Chemistry ⁄ Biochemistry, Philipps-University Marburg, Germany
Daptomycin is a clinically important semi-synthetic
derivative of the A21978C branched cyclic lipopeptide
antibiotics produced by Streptomyces roseosporus [1] .
Acidic lipopeptide antibiotics present a new class of
therapeutic agents that includes compounds such as
calcium dependent antibiotic (CDA) [2], A54145 [3,4]
and friulimicin [5,6] with a unique mechanism of
action. Daptomycin binds to Gram-positive cell
membranes via its lipid moiety, followed by calcium-
dependent insertion and oligomerization. Subsequently,
oligomers form ion channels that disrupt the bacterial
membrane potential, leading to rapid cell death [7,8].
Daptomycin comprises a 13-amino acid peptide core
coupled to a fatty acid moiety (Fig. 1). The peptide
core is assembled nonribosomally by dptA and dptBC.
The thioesterase DptD of the daptomycin biosynthetic
gene cluster catalyses the cyclization reaction between
the hydroxyl group of Thr4 and the C-terminal
Kyn13, resulting in a ten-membered ring [8]. More-
over, several ORFs localized within the gene cluster
are associated with the biosynthesis of non-proteino-
genic amino acids and incorporation of the fatty acid
moiety [1].
All acidic lipopeptides (except CDA) produced
in vivo show some flexibility with respect to the length
and branching of their N-terminally attached fatty acid
groups (Fig. 1). The activity of lipopeptide antibiotics

as well as the toxicity towards eukaryotic cells strongly
depends on the nature of the acyl moiety [9,10]. The
fine tuning between these two features is of consider-
able importance for the development of selective
potent drugs.
The biosynthesis of the peptide core of these acidic
lipopeptides via nonribosomal peptide synthetases
(NRPSs) is well understood, but little is known about
the incorporation of the acyl residue into the final
product [11,12]. As revealed by sequence comparison,
the initiation modules of such NRPSs contain unique
Keywords
acidic lipopeptide antibiotics; AMP ligase;
daptomycin; lipidation reaction;
nonribosomal peptide synthetases
Correspondence
M. A. Marahiel, Department of
Chemistry ⁄ Biochemistry, Philipps-University
Marburg, Hans-Meerwein-Strasse, D-35043
Marburg, Germany
Fax: +49 6421 2822191
Tel: +49 6241 2825722
E-mail:
(Received 4 June 2008, revised 29 August
2008, accepted 1 September 2008)
doi:10.1111/j.1742-4658.2008.06664.x
Daptomycin and A21987C antibiotics are branched, cyclic, nonribosomally
assembled acidic lipodepsipeptides produced by Streptomyces roseosporus.
The antibacterial activity of daptomycin against Gram-positive bacteria
strongly depends on the nature of the N-terminal fatty acid moiety. Two

genes, dptE and dptF, localized upstream of the daptomycin nonribosomal
peptide synthetase genes, are thought to be involved in the lipidation of
daptomycin. Here we describe the cloning, heterologous expression, purifi-
cation and biochemical characterization of the enzymes encoded by these
genes. DptE was proven to preferentially activate branched mid- to
long-chain fatty acids under ATP consumption, and these fatty acids are
subsequently transferred onto DptF, the cognate acyl carrier protein. Addi-
tionally, we demonstrate that lipidation of DptF by DptE in trans is based
on specific protein–protein interactions, as DptF is favored over other acyl
carrier proteins. Study of DptE and DptF may provide useful insights into
the lipidation mechanism, and these enzymes may be used to generate
novel daptomycin derivatives with altered fatty acids.
Abbreviations
CDA, calcium dependent antibiotic; PKS, polyketide synthase.
FEBS Journal 275 (2008) 5343–5354 ª 2008 The Authors Journal compilation ª 2008 FEBS 5343
condensation (C
III
) domains that are thought to cata-
lyse N-acylation of the first amino acid in the peptide
chain [13]. However, the fatty acid moiety must be
activated prior to being incorporated into the
product. Two classes of enzymes are known to
catalyse such reactions. One class, acyl CoASH
synthetases, recognize and activate fatty acids as acyl
adenylates (acyl AMPs), and subsequently couple
them to coenzyme A (CoASH). The second class,
fatty acyl ACP ligases, activate and transfer fatty
acids from acyl AMP to cognate acyl carrier proteins
(ACPs) [14,15].
The genes dptE and dptF are localized immediately

upstream of the NRPSs of A21987C. The resulting
proteins DptE and DptF were predicted to be
involved in the lipidation reaction based on sequence
similarity [1]. DptE is similar to other adenylate-
forming enzymes such as acyl CoASH synthetases,
and DptF is a putative ACP. Both proteins are
thought to be important for the initiation of dapto-
mycin biosynthesis [1,16].
In this study, we describe the biochemical character-
ization of DptE as an acyl ACP ligase, and demon-
strate transfer of various fatty acids onto the ACP
encoded by dptF (Fig. 2). This biochemical character-
ization of the lipidation mechanism during acidic
lipopeptide biosynthesis may facilitate engineering of
new derivatives with altered activities.
Results
Initial biochemical characterization of DptE and
DptF
DptE shares approximately 20% sequence identity with
several members of the acyl AMP ⁄ CoASH ligase super-
family [17]. These enzymes catalyse the formation of fatty
acyl AMP ⁄ CoASH from a fatty acid substrate, ATP and
CoASH in a Mg
2+
-dependent two-step reaction [17–19].
In general, a fatty acyl adenylate intermediate is formed
in the first step, followed by conversion of the fatty acyl
adenylate to fatty acyl CoA with release of AMP.
Fig. 1. Chemical structures of the lipopeptide antibiotics daptomycin, A54145 and CDA, and their natural fatty acid moieties. Daptomycin
and A54145 are naturally produced with various fatty acid side chains. For daptomycin, the major fatty acids are shown. CDA is produced

with the epoxidized hexanoyl moiety exclusively.
Lipidation of daptomycin M. Wittmann et al.
5344 FEBS Journal 275 (2008) 5343–5354 ª 2008 The Authors Journal compilation ª 2008 FEBS
DptE was cloned into the pBAD102 ⁄ D-TOPO
Ò
vector and overexpressed in Escherichia coli
BL21(DE3). The C-terminally His6-tagged and N-ter-
minally thioredoxin-fused protein was purified, yielding
4.4 mgÆL
)1
of culture. The identity of the protein was
confirmed by SDS–PAGE (Fig. 3) and mass spectro-
metry (Table 1). An initial fatty acid-dependent
ATP ⁄ PP
i
exchange assay according to functionally
related adenylation domains of NRPSs showed no
activity (data not shown). To determine whether
CoASH is the physiological substrate of DptE and
required for enzyme activity, we determined the
activity of DptE with ATP, MgCl
2
and CoASH under
various conditions. However, no acyl CoA was detect-
able by HPLC-MS (data not shown).
As we were not able to detect any in vitro activity of
DptE using ATP ⁄ PP
i
exchange assays, and no lipidation
of CoASH was observed in the presence of fatty acids,

we next focused on the transcriptionally coupled dptF,
which encodes a stand alone putative ACP [20]. ACPs
contain the modestly conserved motif GxDS(I ⁄ L), in
which the serine residue is post-translationally modified
by covalent attachment of a 4¢-phosphopantethein
group [21,22]. The motif present in DptF is GLDSV,
indicating that this putative ACP domain is one of the
few ACPs in which valine replaces isoleucine (I) or
leucine (L) in the conserved sequence. To determine
whether DptF is the putative partner of DptE, we
expressed dptF using the pQTev vector in E. coli and
purified the resulting ACP as an N-terminal His7 fusion
protein (Fig. 3) with a yield of 9.5 mgÆL
)1
of culture.
The identity of the protein was proven by SDS–PAGE
+
decanoic acid
DptE
+ATP
PP
i
O
O
–
7
SH
holo-ACP
DptF
DptA

DptBC
DptD
daptomycin
DptF
S
O
decanoyl-S-ACP
7
Mg
2+
AMP
DptE
O
O
7
AMP
Fig. 2. Proposed mechanism for the
lipidation of daptomycin by DptE and DptF.
Decanoic acid is activated by the putative
adenylating enzyme DptE under ATP con-
sumption. The fatty acid is then transferred
onto the acyl carrier protein DptF. The C
domain of DptA is predicted to catalyse the
condensation reaction between the fatty
acid and tryptophan.
kDa
DptE
aDptF
hDptF
aLipD

kDa
hLipD
hAcpK
80
25
20
15
30
40
50
60
100
150
Fig. 3. Coomassie blue-stained SDS–PAGE gel of purified apo-DptF
(aDptF, 13.5 kDa), holo-DptF (hDptF, 13.8 kDa), apo-LipD (aLipD,
11.1 kDa), holo-LipD (11.5 kDa), hAcpK (B. subtilis, holo form;
10.9 kDa) and DptE (80.5 kDa). SDS–PAGE was performed using a
NuPAGE 4-12% Bis-Tris gel (Invitrogen). The protein ladder was
from New England Biolabs (P7703, 10-250 kDa).
Table 1. [M+H]
+
mass values for the proteins, substrates and
products.
[M+H]
+
(Da)
Sample Mass observed Mass calculated
apo-DptF 13 491.6 13 491.9
holo-DptF 13 831.7 13 831.9
apo-LipD 11 140.2 11 140.4

holo-LipD 11 480.4 11 480.5
apo-AcpK 10 561.5 10 561.0
holo-AcpK 10 901.6 10 901.0
decanoyl-DptF 13 986.9 13 986.9
decanoyl-LipD 11 635.6 11 635.7
decanoyl-AcpK 11 056.7 11 056.8
M. Wittmann et al. Lipidation of daptomycin
FEBS Journal 275 (2008) 5343–5354 ª 2008 The Authors Journal compilation ª 2008 FEBS 5345
and tryptic digestion followed by mass spectrometry.
Subsequently, DptF was incubated with the promiscu-
ous 4¢-phosphopantetheinyl transferase Sfp from Bacil-
lus subtilis and fluoresceinyl CoA [23]. The successful
4¢-phosphopantetheinylation of DptF was monitored by
the in-gel fluorescence of the reaction mixture (Fig. 4).
For subsequent acylation studies, holo-DptF was
produced in the sfp-containing E. coli strain HM0079
[24]. The in vivo modification of DptF by Sfp resulted
in 100% conversion of apo-DptF to holo-DptF as
estimated by tandem fourier transform ion cyclotron
resonance-MS (Fig. 5 and Table 1).
Lipidation of DptF by DptE
Initially, 50 lm holo-DptF was incubated with 500 lm
decanoic acid, 10 mm MgCl
2
,1mm ATP and 1 lm
DptE (Fig. 5). The reaction mixture was quenched with
10% formic acid after 10 min and subjected to HPLC-
ESI-MS analysis (Table 1). DptF was quantitatively
acylated with decanoic acid. Subsequently, we deter-
mined the pH and temperature for maximum forma-

tion of decanoyl-S-ACP catalysed by DptE. Suitable
reaction conditions were determined to be pH 7.0 and
37 °C, in agreement with those reported for other acyl
AMP ⁄ ACP ⁄ CoASH ligases [15,25]. Omitting DptE or
ATP abolished the acylation of DptF completely.
These results indicate that decanoic acid is activated as
a fatty acyl AMP and subsequently transferred onto
holo-DptF by the acyl ACP synthetase DptE. To detect
the adenylate intermediate, we repeated the reaction
with apo-DptF rather than holo-DptF, which should
lead to accumulation of the acyl adenylate intermedi-
ate. The reaction was stopped using 10% formic acid
and subjected to LC-MS to detect decanoic AMP (data
not shown). However, we were not able to detect the
adenylate intermediate using this approach. Next, we
performed an ATP ⁄ PP
i
exchange assay with apo-DptF
in the presence of phosphate buffer. Control reactions
were performed without radioactively labelled PP
i,
DptE, apo-DptF, MgCl
2
, or ATP. In the presence of
apo-DptF, we observed an approximately 100-fold
higher activity of DptE compared to the control reac-
tions (Fig. 6). The above-mentioned conditions were
used for determination of steady-state kinetic para-
meters. The K
M

and k
cat
values of DptE for holo-DptF
(with concentrations between 2.5 and 250 lm) were
29.4 lm and 7.4 min
)1
under decanoic acid satura-
tion (500 lm), resulting in a catalytic efficiency of
0.25 min
)1
Ælm
)1
. Addition of CoASH to the reaction
10
15
20
30
Sfp
++––
50
kDa
kDa
apo-DptF
apo-AcpK
SDS-PAGE UV-irradiation at 312 nm
kDa
kDa
apo-DptF
apo-AcpK
+– + –

Fig. 4. In vitro phosphopantetheinylation of apo-DptF and apo-
AcpK. Coomassie blue-stained SDS–PAGE gel (left) and in-gel fluo-
rescence (right) of the fluoresceinyl-ACP. (+) indicates the reaction
with Sfp; ()) indicates the reaction without Sfp.
m/z
13491.6
apo-DptF
+ Na
+ Ka
Relative abundance
13 200 13 300 13 400 13 500 13 600 13 700 13 800 13 900
13 600 13 700 13 800 13 900 14 000
14 100
13 500
Relative abundance
13831.7
holo-DptF
+ Na
+ Ka
m/z
13986.9
decanoyl-DptF
+ Ka
+ Na
Relative abundance
13 500 13 600 13 700 13 800 13 900 14 000 14 100
Sfp
/ CoASH/Mg
2+
-5'-3'-ADP

DptE
-AMP + PPi
+ATP
m/z
Fig. 5. Fourier transform MS spectra of apo-DptF (left), holo-DptF (middle) and decanoic acid-loaded DptF (right).
0
5000
10 000
15 000
20 000
25 000
c.p.m.
Assay -PPi* -DptE -ATP
-MgCl
2
30 000
Fig. 6. ATP ⁄ PP
i
exchange assay of DptE in the presence of apo-
DptF, and control reactions without radioactive labeled PP
i
(PP
i
*),
DptE, ATP or MgCl
2
.
Lipidation of daptomycin M. Wittmann et al.
5346 FEBS Journal 275 (2008) 5343–5354 ª 2008 The Authors Journal compilation ª 2008 FEBS
mixture did not affect the product formation activity

(data not shown). Therefore, the results clearly demon-
strate that holo-DptF is the cognate acceptor substrate
of DptE (Table 2).
Fatty acid specificity of the AMP ligase DptE
Having proven a functional interaction of DptE and
DptF utilizing decanoic acid as a standard substrate,
we addressed the important question of DptE specific-
ity. We systematically utilized a range of linear and
branched chain fatty acids as well as hydroxy-fatty
acids with various chain lengths and varied the concen-
trations between 2.5 and 500 lm. Kinetic constants
were determined by Michaelis–Menten fitting of the
data sets. The summarized kinetic data, which were
obtained under ATP and holo-DptF saturation, are
presented in Table 2. As expected, the fatty acids
(branched and linear, between 10 and 12 carbon units)
that are known to be present in naturally produced
A21987C lipopeptides and in the drug CubicinÒ (dap-
tomycin formulated for injection) were observed to be
excellent substrates, with K
M
values ranging from 8 to
20 lm and k
cat
values between 3.4 and 18.3 min
)1
.
Catalytic efficiencies were 0.29–0.95 min
)1
Ælm

)1
. These
values are in good agreement with those observed for
other systems in which a fatty acyl ACP synthetase
lipidates a cognate holo-ACP in trans [26]. Octanoic
acid, tetradecanoic acid and the 3-hydroxy fatty acid,
which have not been reported as occurring in the
natural compound, were relatively poor substrates,
with K
M
values 2–13-fold higher than those for fatty
acids naturally found in A21987C. Hexanoic acid,
palmitic acid and 15-methylhexadecanoic acid were not
accepted by DptE.
In summary, DptE is capable of transferring a
variety of fatty acids to the cognate ACP DptF in vitro.
The kinetic data presented in this study indicate that
DptE has a general preference for linear fatty acids
with chain lengths between 8 and 14 carbon units,
particularly iso ⁄ anteiso-branched chain fatty acids and
Table 2. Kinetic parameters for steady-state analysis of the DptE-
catalysed lipidation of DptF determined at varying concentrations of
fatty acids or DptF, LipD and AcpK.
Substrate K
M
(lM) k
cat
(min
)1
) k

cat
⁄ K
M
(min
)1
ÆlM
)1
)
Linear
a
C8 65.0 ± 1.2 7.2 ± 0.5 0.11 ± 0.01
C10 8.2 ± 0.4 3.4 ± 0.2 0.42 ± 0.04
C12 10.9 ± 0.3 3.1 ± 0.1 0.29 ± 0.01
C14 26.6 ± 0.9 1.3 ± 0.2 0.05 ± 0.01
Branched
b
iso-C10 19.3 ± 0.5 17.9 ± 0.5 0.93 ± 0.05
iso-C12 19.2 ± 0.4 18.3 ± 0.5 0 .95 ± 0.05
iso-C13 16.1 ± 0.6 15.3 ± 0.7 0.95 ± 0.08
anteiso-C12 14.1 ± 0.8 13.1 ± 0.2 0.93 ± 0.08
Hydroxylated
3OH-C12 114.2 ± 4.2 5.1 ± 0.4 0.04 ± 0.01
ACPs
holo-DptF 29.4 ± 0.4 7.4 ± 0.2 0.25 ± 0.01
holo-LipD 135.0 ± 0.5 6.3 ± 0.3 0.05 ± 0.03
holo-AcpK ND ND ND
a
Substrates C6 and C16 were not activated.
b
Substrate anteiso-

C16 was not activated.
+ Na
10901.6
holo-AcpK
10 600 10 500 10 700 10 800 10 900 11 000
Relative abundance
m/z
10901.6
holo-AcpK
+ Na
10561.5
apo-AcpK
m/z
10 600 10 700 10 800 10 900 11 000 11 100 11 200 11 300
Relative abundance
-5'-3'-ADP
Sfp
/ CoASH/
Mg
2+
Fig. 7. AcpK expressed in its active holo form in M15 ⁄ pRep4-gsp
cells (HM404). Only approximately 40% of AcpK is expressed in
the holo form (upper). Phosphopantetheinylation of apo-AcpK with
Sfp after expressing in M15 ⁄ pRep4-gsp cells (HM404) (lower).
M. Wittmann et al. Lipidation of daptomycin
FEBS Journal 275 (2008) 5343–5354 ª 2008 The Authors Journal compilation ª 2008 FEBS 5347
decanoic acid, while long chain fatty acids such as
palmitic acid or 15-methylhexadecanoic acid are not
recognized at all. Hydroxylated fatty acids are
accepted, but with lower efficiencies.

ACP specificity of the acyl ACP ligase DptE
The results presented above confirm that DptE acti-
vates various fatty acids and transfers them onto
DptF. To address the question of the specificity of
DptE towards ACPs, we utilized as alternative ACPs
LipD, an ACP that is involved in friulimicin biosyn-
thesis and shows approximately 31% sequence identity
with DptF, and holo-AcpK (Fig. 7) from B. subtilis,
which shares approximately 13% sequence identity
with DptF. Mass spectrometry analysis of the assayed
holo-AcpK showed no product formation. In a
reaction mixture containing both DptF and AcpK,
acylation of DptF exclusively was observed (data not
shown). LipD was only partially acylated in presence
or absence of DptF. For better comparison of
the reaction velocities obtained with DptF and LipD,
we performed kinetic studies. To determine kinetic
data for LipD, this protein was expressed in vivo in its
active holo form (see Experimental procedures). The
reaction mixtures contained 1 mm ATP, 10 mm
MgCl
2
, 2–250 lm holo-LipD, 1% dimethylsulfoxide
and 500 lm decanoic acid. Michaelis–Menten fitting of
the experimental data set resulted in a K
M
of 135 lm
and a k
cat
of 6.3 min

)1
. The catalytic efficiency of the
transfer reaction to LipD (0.047 min
)1
Ælm
)1
) was
approximately five times lower than that for DptF
(0.25 min
)1
Ælm
)1
) (Table 2). In conclusion, these
results suggest that there is specific recognition
between DptE and DptF.
Discussion
Daptomycin is a prominent member of the pharmaco-
logically important class of antimicrobial acidic lipo-
peptides. It has been commercialized as CubicinÒ
(Cubist Pharmaceuticals Inc., Lexington, PA, USA)
for the treatment of serious infections caused by
Gram-positive bacteria [27]. Recently, it has been
shown that the activity of these acidic lipopeptides is
significantly influenced by the length and structure of
their fatty acid moieties [9,10]. In the fermentation of
these natural products, some flexibility with respect to
the length and branching of the lipid side chain has
been observed [10]. Complete biochemical characteri-
zation of the lipidation reaction may allow the
engineering of lipopeptides with modified fatty acid

moieties, which could lead to new antibiotics active
against a wide range of bacteria, preventing damage to
eukaryotic cells. For incorporation of the fatty acid
moiety into nonribosomal peptides, condensation of
the fatty acid with the N-terminal tryptophan of the
nonribosomally synthesized peptide is necessary.
Here, we report the results of a steady-state kinetic
analysis of DptE. The aim of this kinetic study was to
determine the specificity of DptE for various fatty
acids and noncognate ACPs. The Michaelis–Menten
kinetic values indicate catalysis of the two-step
reaction with one substrate (fatty acid or ACP) under
saturating or non-saturating conditions. The kinetic
data for the various fatty acids transferred onto DptF
by DptE reported here indicate the preference of DptE
for those found in the naturally produced daptomycin
derivatives. Additionally, it was observed that long-
chain (16 carbon units or more) and short-chain fatty
acids (six carbon units or fewer) are not accepted by
DptE. The observation that DptE is able to activate
and transfer a broad range of fatty acids fits well with
results for other fatty acid CoASH synthetases such as
Faa1p from Saccaromyces cerevisiae [28] or CpPKS1-
AL from Cryptosporidium parvum [26]. Faa1p func-
tions in the vectorial acylation of exogenous long-chain
fatty acids, and has a preference for fatty acid sub-
strates with 10–18 carbons. The K
M
value of Faa1p
for oleate is 71.1 lm. The CpPKS1-AL domain has

been proposed to be involved in the biosynthesis of a
yet undetermined polyketide. This domain also shows
broad substrate acceptance but with a preference for
long-chain fatty acids, particularly arachidic acid. The
actual substrates for the fatty acid CoASH ⁄ ACP
synthetases will be limited by the availability of fatty
acids in the host organism.
Interestingly, comparison of the k
cat
⁄ K
M
values for
DptE revealed that it is five times more active with the
physiologically relevant ACP DptF than with to LipD
(Table 2), and is inactive with AcpK. Therefore, the
in trans lipidation of DptF appears to be the result of
specific protein–protein communication [29].
Faa1p, which functions by a common ‘ping pong
BI-BI’ mechanism [30–32], showed a K
M
of 18.3 lm
for its cognate ACP. In the case of CpPKS1-AL, the
K
M
for the lipidation of ACP was 3.53 lm. These
findings are in good agreement with those for DptE,
which has a K
M
of 29.4 lm for its cognate ACP.
In microorganisms, various strategies exist for the

activation of fatty acids. Gokhale et al. [14,33,34]
found several enzymes for fatty acid activation in
Mycobacterium tuberculosis. These putative enzymes
were cloned and expressed in E. coli, and two distinct
classes were found, namely fatty acyl AMP ligases and
fatty acyl CoASH ligases. The AMP ligases activate
Lipidation of daptomycin M. Wittmann et al.
5348 FEBS Journal 275 (2008) 5343–5354 ª 2008 The Authors Journal compilation ª 2008 FEBS
metabolic fatty acids as acyl adenylates, which are sub-
sequently transferred to a cognate holo-ACP domain.
In contrast, the acyl CoASH ligases catalyse transfer
onto CoASH, forming an acyl thioester, which
subsequently undergoes transthiolation with the
HS-phosphopantetheine group of an ACP [14,33,34].
The loading module of the polyketide synthase (PKS) ⁄
NRPS hybrid mycosubtilin was recently characterized
[35,36]. It was shown that priming of ACP
1
with a
fatty acid occurs via an acyl AMP ligase domain in cis.
The latter type of fatty acid activation and loading
was exclusively reported for PKS systems [14].
Recently, lipidation of the acidic lipopeptide CDA
was investigated in vivo and in vitro [16]. However,
CDA is an exception within the acidic lipopeptides, as
only 2,3-epoxy-hexanoic acid is incorporated into the
final product, and two specific enzymes encoded by
fabH3 and fabH4 are thought to synthesize hexanoic
acid directly on an ACP. Two additional proteins
encoded in the CDA fab operon, HxcO and HcmO,

are responsible for the subsequent epoxidation of hexa-
noyl S-ACP [37].
Interestingly, in the case of the lipopeptide surfactin,
neither an acyl CoASH ligase-like domain nor an ACP
could be identified within the biosynthetic gene cluster
using bioinformatic tools [38]. Previously, an unknown
40 kDa protein was thought to be the candidate for
lipidation. However, it has been suggested that the
activated 3-hydroxymyristoyl CoA substrate is bio-
synthesized by the primary metabolism. Recently, it
was reported that the acyl CoA substrate is transferred
to the initiation module SrfA-A1. This transfer is
stimulated by the surfactin thioesterase II SrfD [38].
However, the reaction also took place in the absence
of the thioesterase, but with reduced turnover. To
date, no additional enzyme such as an acyltransferase
or an acyl CoASH ligase has been reported to be
involved in the surfactin initiation process.
Another possibility for lipidation of secondary
metabolites could be the interaction of fatty acid
synthase-like enzymes or substrates from the primary
metabolism with NRPSs or PKSs, as shown for afla-
toxin produced by the fungi Asparagillus parasiticus
and A. flavus [39,40]. In this example, the fatty acid
synthase-like enzymes HexA and HexB synthesize
hexanoic acid from acetyl CoA and two units of
malonyl CoA. This hexanoic acid serves as a precursor
for initiation of the PKS of aflatoxin biosynthesis.
As shown here, the acyl ACP ligase DptE of the
daptomycin biosynthetic gene cluster appears to

directly select and activate cytosolic fatty acids from
primary metabolism as fatty acyl adenylates in a mech-
anism analogous to the adenylation domains of
NRPSs [41]. Subsequently, the fatty acids are trans-
ferred in trans onto holo-DptF to generate fatty acyl
S-ACP. No lipidation was observed without ATP,
confirming our conclusion that the fatty acid has to be
activated as an adenylate prior to esterfication by the
cognate ACP.
Interestingly, we detected a 100-fold higher activity
over background in the ATP ⁄ PP
i
exchange assay with
DptE when it was performed in the presence of nonre-
active apo-DptF (approximately 26 500 c.p.m.). In the
absence of DptE we found only a marginal activity
(approximately 250 c.p.m.). This leads to the conclu-
sion that DptE requires DptF for its activity. We sug-
gest that the reason that a fatty acid adenylate
intermediate was not detected using apo-DptF in an
LC-MS approach is that the back reaction was too
fast or the amount of product was below the detection
limit.
Summarizing, the present study focuses on the bio-
chemical characterization of DptE and DptF. To
date, we cannot rule out the possibility that similar
fatty acid CoA derivatives will also be recognized by
the C domain of the initiation module of dapto-
mycin. That DptE and DptF are involved in the
lipidation process of daptomycin was first shown by

Miao et al. [1]. In their work, the daptomycin gene
cluster was heterologously expressed in Streptomyces
lividans. Only authentic daptomycin derivatives were
found and no derivatives with common fatty acids
of the S. lividans organism. Studies utilizing deletion
mutants or biochemical studies involving the initia-
tion module of daptomycin synthetase are required
to prove whether DptE and DptF are essential for
lipidation or whether there are additionally alterna-
tive pathways.
In conclusion, DptE was observed to recognize a
variety of fatty acid moieties. After activation of the
fatty acids under ATP consumption, most likely as
fatty acyl AMPs, DptE subsequently catalyses specific
transfer onto the 4¢-phosphopantethein group of DptF.
The observed substrate tolerance for loading a variety
of fatty acids onto the ACP will facilitate future pro-
jects on the manipulation and combinatorial biosyn-
thesis of acidic lipopeptides. Hopefully, the recognition
and efficient transfer of new building blocks can be
achieved using DptE and DptF. This is important, as
the fatty acid moiety has been proven to have a high
impact on the bioactivity and bioselectivity of these
antibiotics [9,10]. It remains to be clarified whether all
of the fatty acids activated by DptE can be incorpo-
rated into the final product or whether there is an
interfering specificity of the C
III
domain of the initia-
tion module.

M. Wittmann et al. Lipidation of daptomycin
FEBS Journal 275 (2008) 5343–5354 ª 2008 The Authors Journal compilation ª 2008 FEBS 5349
Experimental procedures
Materials
Electrocompetent Top10 and BL21 (DE3) E. coli cells were
purchased from Invitrogen (Carlsbad, CA, USA). All
restriction endonucleases and T4 DNA ligase were obtained
from New England Biolabs (NEB GmbH, Hilden,
Germany). Oligonucleotides were purchased from Operon
(Operon Biotechnologies GmbH, Cologne, Germany).
Plasmid DNA isolation was performed using a Qiagen spin
miniprep kit (Qiagen GmbH, Hilden, Germany). DNA
sequencing was performed at GATC Biotech AG
(Konstanz, Germany). The plasmid pBAD102 ⁄ D-TOPO
Ò
was purchased from Invitrogen. The pQTev vector, which
is a derivative of pQE60, was purchased from Qiagen.
Fatty acids were purchased from Larodan (LARODAN
Fine Chemicals AB, Malmoe, Sweden). All other materials
were purchased from Sigma-Aldrich (Sigma Aldrich Chemie
GmbH, Munich, Germany).
DNA isolation
S. roseosporus NRLL 11379 was inoculated in nutrient broth
and grown at 37 °C for 48 h with agitation. Genomic DNA
was isolated using a DNeasy Blood and Tissue kit (Qiagen).
Cloning and expression of DptF
The 270 bp dptF gene was amplified by PCR from S. roseosp-
orus NRLL 11379 genomic DNA using high-fidelity Phusion
DNA polymerase (Finnzymes, Espoo, Finland) and primers
dptF-for (5¢-TAT

GGATCCAACCCGCCCGAAGC GGTC-3¢)
and dptF-rev (5¢-ATA
GCGGCCGCGGTGCGGTCGGCC
AACTG-3¢) (underlining indicates artificial BamHI and NotI
restriction sites). The amplified product was purified on a
1.2% agarose gel using a PCR gel extraction kit (Qiagen),
digested with BamHI and NotI, and ligated into the same
sites of the pQTev vector to yield the plasmid pQTev-dptF.
The integrity of the plasmid was confirmed by sequencing.
The resulting plasmid was used to transform E. coli BL21
(DE3) or E. coli HM0079 [24] for gene expression. The cul-
tures were grown in LB medium supplemented with
100 lgÆmL
)1
ampicillin. Cultures were grown at 37 °Ctoan
attenuance at 600 nm of 0.5, and then the temperature was
decreased to 30 °C and gene expression was induced by addi-
tion of 0.1 mm isopropyl thio-b-d-galactoside (IPTG, final
concentration). Cultures were grown for an additional 4 h
and then harvested by centrifugation (4000 g,4°C, 15 min).
Cloning and expression of DptE
The 1795 bp dptE gene was amplified from Strepto-
myces roseosporus NRLL 11379 genomic DNA using high-
fidelity Phusion DNA polymerase (Finnzymes) and primers
dptE-for (5¢-
CACCATGAGTGAGAGCCGCTGTGCCG
G-3¢; underlining indicates the sequence overhang for the
TOPO cloning) and dptE-rev (5¢-CGCGGGGTGCGGA
TGTGGAG-3¢). The amplified product was purified from a
0.8% agarose gel using a PCR gel extraction kit (Qiagen),

and ligated into pBAD102 ⁄ D-TOPOÒ (Invitrogen) accord-
ing to manufacturer’s instructions to yield the plasmid
pBAD102 ⁄ D-TOPO-dptE. The integrity of the plasmid was
confirmed by sequencing. The resulting plasmid was used
to transform E. coli BL21 (DE3) for gene expression. The
cultures were grown at 37 °C in LB medium supplemented
with 100 lgÆmL
)1
ampicillin to an attenuance at 600 nm of
0.5. The temperature was then decreased to 28 °C, and gene
expression was induced by addition of 0.1 m m IPTG (final
concentration). Cultures were grown for an additional 4 h
and then harvested by centrifugation (4000 g,4°C, 15 min).
Purification of recombinant expressed proteins
DptE and DptF
For purification of DptE and DptF, cell pellets from 1 litre
of culture were resuspended in 10 mL of buffer A (50 mm
phosphate buffer, 300 mm NaCl, pH 7.0) and disrupted
using a French press (SLM Aminco; Thermo French
Ò
press,
G. Heinemann Labortechnik, Schwaebisch Gemuend, Ger-
many). Insoluble cell debris was removed by centrifugation
(17 000 g,4°C, 45 min). Purification of the His-tagged
fusion proteins using Ni
2+
-NTA superflow resin (Qiagen)
was performed on an FPLC system (Amersham Pharmacia
Biotechnology, Amersham, UK) according to manufac-
turer’s standard protocol. Briefly, fractions containing the

recombinant proteins were monitored by SDS–PAGE,
pooled, and dialysed against phosphate buffer with 100 mm
NaCl using HiTrapÔ desalting columns (GE Healthcare Eur-
ope GmbH, Freiburg, Germany). The recombinant proteins
were then concentrated using membrane-based Amicon
Ò
Ultra-15 concentrators (Millipore GmbH, Schwalbach,
Germany) with a molecular mass cut-off of 10 kDa (DptF)
and 50 kDa (DptE). Protein concentrations were determined
by NanoDropÒ spectrophotometer ND-1000 (PeqLab
Biotechnologie GmbH, Erlangen, Germany) measurements.
The affinity-purified proteins were stored at )80 °C.
In vitro 4¢-phosphopantetheinylation of apo-DptF
A reaction mixture containing 200 lm fluoresceinyl CoA or
CoASH [42], 50 lm DptF, 10 mm MgCl
2
and 0.5 lm recom-
binant Bacillus subtilis 4¢-phosphopantetheine transferase
Sfp in assay buffer (50 mm phosphate buffer, 100 mm
NaCl, pH 7.0) was incubated at 37 °C for 5–30 min and
analysed on an SDS–PAGE gel by measuring the in-gel
fluorescence. The Sfp substrate fluoresceinyl CoA
was generated as previously described [23]. The CoASH
Lipidation of daptomycin M. Wittmann et al.
5350 FEBS Journal 275 (2008) 5343–5354 ª 2008 The Authors Journal compilation ª 2008 FEBS
modification of DptF was verified by ESI-MS using
an LTQ-FT mass spectrometer (Thermo Fisher Scientific,
Bremen, Germany).
ATP-pyrophosphate exchange assay
The ATP ⁄ PP

i
exchange reaction was used to determine the
activity and substrate specificity of DptE. For all assays,
the enzyme concentration varied from 300 nm to 1 mm,
and the ATP concentration was at a saturating level of
2mm. All reactions were performed at 37 °C. ATP ⁄ PP
i
reactions were performed for 30 s to 1 min. Reaction
mixtures contained 50 mm Hepes, pH 8.0, 100 mm NaCl,
10 mm MgCl
2
, 500 nm decanoic acid and 300 nm to 1 lm
DptE (in a final volume of 100 lL). The reaction was
initiated by addition of ATP, 50 lm tetrasodium pyrophos-
phate (NaPP
i
) and 0.15 lCi (16 CiÆmmol
)1
) of tetrasodium
pyrophosphate (radioactive labeled PP
i
, Perkin Elmer,
Waltham, MA, USA). The reactions were quenched by
adding 500 lL of a stop mix containing 1.2% w ⁄ v acti-
vated charcoal, 0.1 m tetrasodium pyrophosphate and
0.35 m perchloric acid. Subsequently, the charcoal was
pelleted by centrifugation (4000 g,4°C, 3 min), washed
twice with 1 mL water (vortexed for 30 s), and once with
0.5 mL water. After addition of 0.5 mL water and 3.5 mL
of liquid scintillation fluid (Rotiscint Eco Plus, CarlRoth

GmbH and Co. KG, Karlsruhe, Germany), the charcoal-
bound radioactivity was determined by liquid scintillation
counting using a 1900CA Tri-carb liquid scintillation
analyser (Packard Instruments, Meriden, CT, USA).
Activity assay of DptE with CoASH
Acyl CoASH synthetases ⁄ ligases are thought to catalyse the
thioesterification of a fatty acid with CoASH. In this study,
we showed that DptE was not able to react with CoASH
as a substrate. However, a typical reaction mixture
(100 lL) was composed of 50 mm phosphate buffer,
100 mm NaCl, 10 mm MgCl
2
,1mm ATP, 300 lm CoASH,
500 lm decanoic acid, 1% dimethylsulfoxide and 1 mm
DptE. After incubation at 37 °C for 30 min, reactions were
stopped with 10 lL formic acid. The product formation
was measured by HPLC-MS. Separation of the reaction
products was achieved on a 250 ⁄ 3 Nucleosil C8 column
(3 lm, Macherey-Nagel GmbH & Co. KG, Du
¨
ren,
Germany) by applying the following gradient at a flow rate
of 0.3 mLÆmin
)1
[buffer A: 2mm triethylamine ⁄ water; buffer
B: 2mm triethylamino ⁄ 80% acetonitrile ⁄ 20% water (v ⁄ v)],
column temperature 30 °C: loading 5% buffer B, after
5 min linear gradient up to 95% buffer B in 37 min, and
then holding 100% buffer B for 5 min. The product was
identified by UV detection at 215 nm and by on-line

ESI-MS analysis with an Agilent 1100 MSD (Agilent
Technologies Deutschland GmbH, Boeblingen, Germany)
in the negative single ion monitoring (SIM) mode.
DptE-mediated transfer of long-chain fatty acids
to holo-DptF
For this reaction, we used holo-DptF that was heterolo-
gously expressed in sfp-containing E. coli HM0079 cells. A
typical reaction mixture contained 50 lm holo-DptF,
250 lm fatty acid, 10 mm MgCl
2
,1mm ATP, 1% dimethyl-
sulfoxide and 1 lm DptE in a total volume of 25 lL
50 mm phosphate buffer (pH 7.0) with 100 mm NaCl. After
incubation at 37 °C for 0–30 min, the reaction was
quenched by addition of 7.5 lL formic acid and directly
analysed by mass spectrometry using an LTQ-FT instru-
ment (Thermo Fisher Scientific), with desalting using an
8 ⁄ 2 Nucleodur C4 pre-column (Macherey & Nagel). The
solvents used were water with 0.05% formic acid and
acetonitrile with 0.045% formic acid. The following
gradient was applied at a flow rate of 0.2 mL Æ min
)1
and a
column temperature of 40 °C. The sample was loaded with
95% buffer A for 3 min, followed by a linear gradient
down to 60% buffer A in 15 min, followed by a linear
gradient down to 5% buffer A in 2 min. 5% buffer A was
held for an additional 2 min and followed by a linear
gradient up to 95% buffer A in 6 min.
Determination of the acyl adenylate intermediate

LC-MS approach
To identify decanoic AMP by LC-MS, reactions (100 lL)
containing decanoic acid (500 lm), ATP (1 lm), MgCl
2
(10 mm), apo-DptF (50 lm), 1% dimethylsulfoxide and
phosphate buffer (pH 7.0, 50 mm) were performed at
37 °C. Reactions were initiated by addition of DptE (5 lm)
and stopped after 1 h by addition of 30 lL formic acid.
Samples were analysed by HPLC-MS as described above.
ATP/PP
i
-exchange approach
For activity measurements, DptE (1 lm) was rapidily mixed
with 0.15 lCi (16 CiÆmmol
)1
) hot PP
i
in the presence of
500 lm decanoic acid, 1% dimethylsulfoxide, 10 mm
MgCl
2
,1mm ATP, 10 lm apo-DptF and 5 mm NaPP
i
phosphate buffer (pH 7.0, 50 mm)at37°C. The enzyme
activity was also checked in the absence apo-DptF, hot PP
i
,
DptE or MgCl
2
as control reactions. The reactions were

stopped after 60 min by addition of 500 lL stop mix. Sam-
ples were washed and analysed as described above.
Determination of the kinetic parameters of DptF
lipidation by DptE
To determine the kinetic parameters for holo-DtpF lipida-
tion by DptE, we performed the reactions under ACP satu-
ration and varied the fatty acid concentrations. Depending
on the substrate, we varied the reaction time between 30 s
M. Wittmann et al. Lipidation of daptomycin
FEBS Journal 275 (2008) 5343–5354 ª 2008 The Authors Journal compilation ª 2008 FEBS 5351
and 4 min. The reactions were carried out at 37 °Cina
total volume of 25 lL. Unless otherwise indicated, the
reaction mixtures contained 50 mm phosphate buffer,
100 mm NaCl, pH 7.0, 10 mm MgCl
2
,1mm ATP, 1 mm
DptE, 50 lm holo-DptF, 1% dimethylsulfoxide and various
concentrations of fatty acids (10–250 lm). The reactions
were stopped by the addition of 7.5 lL acetic acid. The
conversion rate of holo-DptF into fatty acyl S-DptF was
analysed by LC-ESI-MS as described above. The steady-
state parameters k
cat
and k
cat
⁄ K
M
and their standard errors
were determined using nonlinear regression with sigmaplot
8.0 (Systat Software GmbH, Erkrath, Germany) to fit the

data to the Michaelis–Menten equation.
Determination of DptE specificity towards other
ACPs
E. coli HM404 cells (E. coli M15 ⁄ pREP4-gsp transformed
with pQE60-acpK) [43] were a gift from H. D. Mootz
(Fachbereich Chemische Biologie, Technische Universita
¨
t
Dortmund, Germany). The expression The E. coli HM404
cells were grown in the presence of 25 lgÆmL
)1
kanamy-
cin, induced, harvested and disrupted, and the crude cell
extract was centrifuged as described above for DptF. Pro-
tein purification was performed as described previously
[43]. The yield of purified protein was 5.5 mgÆL
)1
of
culture (Fig. 7).
The lipD gene was amplified from genomic DNA using
Phusion DNA polymerase (Finnzymes) and the synthetic
oligonucleotide primers 5¢-AAAAAA
GAATTCATGTCA
GACCTCAGCACCGC-3¢ and 5¢-AAAAA
AAGCTTTCA
GGCGGAACGCAGCTC-3¢ (EcoRI and HindIII restric-
tion sites are underlined). The resulting 291 bp PCR frag-
ment was purified, digested with EcoRI and HindIII, and
ligated into a pET28a(+) derivative (Novagen, Merck
KGaA, Darmstadt, Germany), digested with the same

enzymes. The identity of the resulting plasmid pCB28a(+)-
lipD with an N-terminal hexahistidine tag was confirmed by
DNA sequencing.
The plasmid was used to transform E. coli strain
BL21(DE3) (Novagen) and the enzyme was overproduced
in LB medium supplemented with kanamycin (50 lgÆmL
)1
).
The cultures were grown to an absorbance of 0.3 at 30 °C.
The cultures were cooled to 18 °C and protein production
was induced by the addition of IPTG to a final concentra-
tion of 0.1 mm. The cultures were incubated for a further
18 h. After harvesting by centrifugation (6500 g, 15 min,
4 °C) and resuspension in 50 mm Hepes, pH 8.0, 300 mm
NaCl, purification of the recombinant protein was per-
formed as previously described [44]. Fractions containing
LipD (11.1 kDa) were identified by 15% SDS–PAGE anal-
ysis, pooled, and dialysed against 10 mm Tris ⁄ HCl, pH 8.0,
using HiTrap desalting columns (Amersham Pharmacia
Biotechnology). Protein concentration was determined
spectrophotometrically using the calculated extinction
coefficient at 280 nm. The yield of purified protein was
2mgÆL
)1
of culture.
In vitro 4¢-phosphopantetheinylation of apo-AcpK and
apo-LipD was performed as described above for apo-DptF.
In vivo 4¢-phosphopantetheinylation of apo-LipD was car-
ried out in BL21(DE3)-pRep4-gsp. The transfer assays to
holo-LipD and holo-AcpK and determination of the kinetic

parameters for the DptE-mediated transfer to holo-LipD
were performed as described above (see Determination of
the kinetic parameters of DptF lipidation by DptE).
Acknowledgements
We thank Dr Georg Scho
¨
nafinger, Dr Christoph Mahl-
ert and Thomas Knappe (Department of Chemistry ⁄
Biochemistry, Philipps-University Marburg, Germany)
for helpful discussions and critical comments on the
manuscript. Dr Henning D. Mootz provided the
HM0079 and HM404 strains. This work was supported
by the Deutsche Forschungsgemeinschaft and the Fonds
der Chemischen Industrie.
References
1 Miao V, Coeffet-Legal MF, Brian P, Brost R, Penn J,
Whiting A, Martin S, Ford R, Parr I, Bouchard M et al.
(2005) Daptomycin biosynthesis in Streptomyces roseosp-
orus: cloning and analysis of the gene cluster and revision
of peptide stereochemistry. Microbiology 151, 1507–1523.
2 Hojati Z, Milne C, Harvey B, Gordon L, Borg M, Flett
F, Wilkinson B, Sidebottom PJ, Rudd BA, Hayes MA
et al. (2002) Structure, biosynthetic origin, and engi-
neered biosynthesis of calcium-dependent antibiotics
from Streptomyces coelicolor. Chem Biol 9 , 1175–1187.
3 Fukuda DS, Debono M, Molloy RM & Mynderse JS
(1990) A54145, a new lipopeptide antibiotic complex:
microbial and chemical modification. J Antibiot 43,
601–606.
4 Miao V, Brost R, Chapple J, She K, Gal MF &

Baltz RH (2006) The lipopeptide antibiotic A54145
biosynthetic gene cluster from Streptomyces fradiae.
J Ind Microbiol Biotechnol 33, 129–140.
5 Heinzelmann E, Berger S, Muller C, Hartner T, Poralla
K, Wohlleben W & Schwartz D (2005) An acyl-CoA
dehydrogenase is involved in the formation of the Delta
cis3 double bond in the acyl residue of the lipopeptide
antibiotic friulimicin in Actinoplanes friuliensis. Microbi-
ology 151, 1963–1974.
6 Vertesy L, Ehlers E, Kogler H, Kurz M, Meiwes J, Sei-
bert G, Vogel M & Hammann P (2000) Friulimicins:
novel lipopeptide antibiotics with peptidoglycan synthe-
sis inhibiting activity from Actinoplanes friuliensis sp.
nov. II. Isolation and structural characterization. J Anti-
biot 53, 816–827.
Lipidation of daptomycin M. Wittmann et al.
5352 FEBS Journal 275 (2008) 5343–5354 ª 2008 The Authors Journal compilation ª 2008 FEBS
7 Baltz RH, Miao V & Wrigley SK (2005) Natural prod-
ucts to drugs: daptomycin and related lipopeptide anti-
biotics. Nat Prod Rep 22, 717–741.
8 Kopp F, Grunewald J, Mahlert C & Marahiel MA
(2006) Chemoenzymatic design of acidic lipopeptide
hybrids: new insights into the structure–activity
relationship of daptomycin and A54145. Biochemistry
45, 10474–10481.
9 Counter FT, Allen NE, Fukuda DS, Hobbs JN, Ott J,
Ensminger PW, Mynderse JS, Preston DA & Wu CY
(1990) A54145 a new lipopeptide antibiotic complex:
microbiological evaluation. J Antibiot 43, 616–622.
10 Debono M, Abbott BJ, Molloy RM, Fukuda DS,

Hunt AH, Daupert VM, Counter FT, Ott JL, Carrell
CB, Howard LC et al. (1988) Enzymatic and chemical
modifications of lipopeptide antibiotic A21978C: the
synthesis and evaluation of daptomycin (LY146032).
J Antibiot 41, 1093–1105.
11 Schwarzer D, Finking R & Marahiel MA (2003)
Nonribosomal peptides: from genes to products. Nat
Prod Rep 20, 275–287.
12 Kopp F & Marahiel MA (2007) Where chemistry meets
biology: the chemoenzymatic synthesis of nonribosomal
peptides and polyketides. Curr Opin Biotechnol 18, 513–
520.
13 Rausch C, Hoof I, Weber T, Wohlleben W & Huson
DH (2007) Phylogenetic analysis of condensation
domains in NRPS sheds light on their functional evolu-
tion. BMC Evol Biol 7, 78.
14 Trivedi OA, Arora P, Sridharan V, Tickoo R, Mohanty
D & Gokhale RS (2004) Enzymic activation and trans-
fer of fatty acids as acyl-adenylates in mycobacteria.
Nature 428, 441–445.
15 Ray TK & Cronan JE Jr (1976) Activation of long chain
fatty acids with acyl carrier protein: demonstration of a
new enzyme, acyl-acyl carrier protein synthetase, in
Escherichia coli. Proc Natl Acad Sci USA 73, 4374–4378.
16 Powell A, Borg M, Amir-Heidari B, Neary JM,
Thirlway J, Wilkinson B, Smith CP & Micklefield J
(2007) Engineered biosynthesis of nonribosomal
lipopeptides with modified fatty acid side chains. JAm
Chem Soc 129, 15182–15191.
17 Black PN, Zhang Q, Weimar JD & DiRusso CC (1997)

Mutational analysis of a fatty acyl-coenzyme A synthe-
tase signature motif identifies seven amino acid residues
that modulate fatty acid substrate specificity. J Biol
Chem 272, 4896–4903.
18 Bar-Tana J, Rose G, Brandes R & Shapiro B (1973)
Palmitoyl-coenzyme A synthetase. Mechanism of reac-
tion. Biochem J 131, 199–209.
19 Bar-Tana J, Rose G & Shapiro B (1973) Palmitoyl-
coenzyme A synthetase. Isolation of an enzyme-bound
intermediate. Biochem J 135, 411–416.
20 Coeffet-Le Gal MF, Thurston L, Rich P, Miao V & Baltz
RH (2006) Complementation of daptomycin dptA and
dptD deletion mutations in trans and production of hybrid
lipopeptide antibiotics. Microbiology 152, 2993–3001.
21 Tang Y, Koppisch AT & Khosla C (2004) The acyl-
transferase homologue from the initiation module of
the R1128 polyketide synthase is an acyl-ACP thioester-
ase that edits acetyl primer units. Biochemistry 43,
9546–9555.
22 Sanchez C, Du L, Edwards DJ, Toney MD & Shen B
(2001) Cloning and characterization of a phosphopantet-
heinyl transferase from Streptomyces verticillus
ATCC15003, the producer of the hybrid peptide–polyke-
tide antitumor drug bleomycin. Chem Biol 8
, 725–738.
23 Stein DB, Linne U, Hahn M & Marahiel MA (2006)
Impact of epimerization domains on the intermodular
transfer of enzyme-bound intermediates in
nonribosomal peptide synthesis. Chembiochem 7,
1807–1814.

24 Gruenewald S, Mootz HD, Stehmeier P & Stachelhaus
T (2004) In vivo production of artificial nonribosomal
peptide products in the heterologous host Escherichia
coli. Appl Environ Microbiol 70, 3282–3291.
25 Morgan-Kiss RM & Cronan JE (2004) The Escherichia
coli fadK (ydiD) gene encodes an anerobically regulated
short chain acyl-CoA synthetase. J Biol Chem 279,
37324–37333.
26 Fritzler JM & Zhu G (2007) Functional characteriza-
tion of the acyl-[acyl carrier protein] ligase in the Cryp-
tosporidium parvum giant polyketide synthase. Int J
Parasitol 37, 307–316.
27 Sauermann R, Rothenburger M, Graninger W &
Joukhadar C (2008) Daptomycin: a review 4 years after
first approval. Pharmacology 81, 79–91.
28 Li H, Melton EM, Quackenbush S, DiRusso CC &
Black PN (2007) Mechanistic studies of the long chain
acyl-CoA synthetase Faa1p from Saccharomyces
cerevisiae. Biochim Biophys Acta 1771, 1246–1253.
29 Tang GL, Cheng YQ & Shen B (2007) Chain initiation
in the leinamycin-producing hybrid nonribosomal
peptide ⁄ polyketide synthetase from Streptomyces
atroolivaceus S-140. Discrete, monofunctional
adenylation enzyme and peptidyl carrier protein that
directly load d-alanine. J Biol Chem 282, 20273–20282.
30 Hisanaga Y, Ago H, Nakagawa N, Hamada K, Ida K,
Yamamoto M, Hori T, Arii Y, Sugahara M, Kuramitsu
S et al. (2004) Structural basis of the substrate-specific
two-step catalysis of long chain fatty acyl-CoA synthe-
tase dimer. J Biol Chem 279, 31717–31726.

31 Wu R, Cao J, Lu X, Reger AS, Gulick AM & Dunaway-
Mariano D (2008) Mechanism of 4-chlorobenzoate:coen-
zyme A ligase catalysis. Biochemistry 47, 8026–8039.
32 Reger AS, Wu R, Dunaway-Mariano D & Gulick AM
(2008) Structural characterization of a 140 degrees
domain movement in the two-step reaction catalyzed by
4-chlorobenzoate:CoA ligase. Biochemistry 47, 8016–
8025.
M. Wittmann et al. Lipidation of daptomycin
FEBS Journal 275 (2008) 5343–5354 ª 2008 The Authors Journal compilation ª 2008 FEBS 5353
33 Arora P, Vats A, Saxena P, Mohanty D & Gokhale RS
(2005) Promiscuous fatty acyl CoA ligases produce
acyl-CoA and acyl-SNAC precursors for polyketide
biosynthesis. J Am Chem Soc 127, 9388–9389.
34 Gokhale RS, Sankaranarayanan R & Mohanty D
(2007) Versatility of polyketide synthases in generating
metabolic diversity. Curr Opin Struct Biol 17, 736–743.
35 Hansen DB, Bumpus SB, Aron ZD, Kelleher NL &
Walsh CT (2007) The loading module of mycosubtilin:
an adenylation domain with fatty acid selectivity. JAm
Chem Soc 129, 6366–6367.
36 Aron ZD, Fortin PD, Calderone CT & Walsh CT
(2007) FenF: servicing the Mycosubtilin synthetase
assembly line in trans. Chembiochem 8, 613–616.
37 Kopp F, Linne U, Oberthur M & Marahiel MA (2008)
Harnessing the chemical activation inherent to carrier
protein-bound thioesters for the characterization of
lipopeptide fatty acid tailoring enzymes. J Am Chem
Soc 130, 2656–2666.
38 Steller S, Sokoll A, Wilde C, Bernhard F, Franke P &

Vater J (2004) Initiation of surfactin biosynthesis and
the role of the SrfD-thioesterase protein. Biochemistry
43, 11331–11343.
39 Sakuno E, Kameyama M, Nakajima H & Yabe K
(2008) Purification and gene cloning of a dehydrogenase
from Lactobacillus brevis that catalyzes a reaction
involved in aflatoxin biosynthesis. Biosci Biotechnol
Biochem 72, 724–734.
40 Hitchman TS, Schmidt EW, Trail F, Rarick MD,
Linz JE & Townsend CA (2001) Hexanoate synthase,
a specialized type I fatty acid synthase in aflatoxin B1
biosynthesis. Bioorg Chem 29, 293–307.
41 Linne U, Schafer A, Stubbs MT & Marahiel MA
(2007) Aminoacyl-coenzyme A synthesis catalyzed by
adenylation domains. FEBS Lett 581, 905–910.
42 La Clair JJ, Foley TL, Schegg TR, Regan CM &
Burkart MD (2004) Manipulation of carrier proteins in
antibiotic biosynthesis. Chem Biol 11, 195–201.
43 Mootz HD, Finking R & Marahiel MA (2001) 4’-phos-
phopantetheine transfer in primary and secondary
metabolism of Bacillus subtilis. J Biol Chem 276,
37289–37298.
44 Pohlmann V & Marahiel MA (2008) Delta-amino group
hydroxylation of l-ornithine during coelichelin
biosynthesis. Org Biomol Chem 6, 1843–1848.
Lipidation of daptomycin M. Wittmann et al.
5354 FEBS Journal 275 (2008) 5343–5354 ª 2008 The Authors Journal compilation ª 2008 FEBS