Báo cáo khoa học: Transient potential receptor channel 4 controls thrombospondin-1 secretion and angiogenesis in renal cell carcinoma ppt

Transient potential receptor channel 4 controls
thrombospondin-1 secretion and angiogenesis
in renal cell carcinoma
Dorina Veliceasa
1
, Marina Ivanovic
2
, Frank Thilo-Schulze Hoepfner
1
, Praveen Thumbikat
1
,
Olga V. Volpert
1
and Norm D. Smith
1
1 Department of Urology, Northwestern University Feinberg School of Medicine, Chicago, IL, USA
2 Department of Pathology, Northwestern University Feinberg School of Medicine, Chicago, IL, USA
Keywords
angiogenesis; calcium metabolism; renal
cancer; thrombospondin
Correspondence
O. V. Volpert, Department of Urology,
Northwestern University, 303 East Chicago
Ave., Chicago, IL 60611, USA
Fax: +1 (312) 908 7275
Tel: +1 (312) 503 5934
E-mail:
(Received 4 June 2007, revised 14 Septem-
ber 2007, accepted 18 October 2007)
doi:10.1111/j.1742-4658.2007.06159.x

Angiogenic switch in renal cell carcinoma (RCC) is attributed to the
inactivation of the von Hippel–Lindau tumor suppressor, stabilization of
hypoxia inducible factor-1 transcription factor and increased vascular
endothelial growth factor. To evaluate the role of an angiogenesis inhibitor,
thrombopsondin-1 (TSP1), we compared TSP1 production in human RCC
and normal tissue and secretion by the normal renal epithelium (human
normal kidney, HNK) and RCC cells. Normal and RCC tissues stained
positive for TSP1, and the levels of TSP1 mRNA and total protein were
similar in RCC and HNK cells. However, HNK cells secreted high TSP1,
which rendered them nonangiogenic, whereas RCC cells secreted little
TSP1 and were angiogenic. Western blot and immunostaining revealed
TSP1 in the cytoplasm of RCC cells on serum withdrawal, whereas, in
HNK cells, it was rapidly exported. Seeking mechanisms of defective TSP1
secretion, we discovered impaired calcium uptake by RCC in response to
vascular endothelial growth factor. In HNK cells, 1,2-bis(o-aminophen-
oxy)ethane-N,N,N¢,N¢-tetraacetic acid acetoxymethyl ester, a calcium chela-
tor, simulated TSP1 retention, mimicking the RCC phenotype. Further
analysis revealed a profound decrease in transient receptor potential canon-
ical ion channel 4 (TRPC4) Ca
2+
channel expression in RCC cells. TRPC4
silencing in HNK cells caused TSP1 retention and impaired secretion. Dou-
ble labeling of the secretory system components revealed TSP1 colocaliza-
tion with coatomer protein II (COPII) anterograde vesicles in HNK cells.
In contrast, in RCC cells, TSP1 colocalized with COPI vesicles, pointing to
the retrograde transport to the endoplasmic reticulum caused by misfold-
ing. Our study indicates that TRPC4 loss in RCC leads to impaired Ca
2+
intake, misfolding, retrograde transport and diminished secretion of anti-
angiogenic TSP1, thus enabling angiogenic switch during RCC progression.

Abbreviations
BAPTA-AM, 1,2-bis(o-aminophenoxy)ethane-N,N,N¢,N¢-tetraacetic acid acetoxymethyl ester; bFGF, basic fibroblast growth factor; CEP,
circulating endothelial precursor; CM, conditioned media; COP, coatomer protein; CXCR2, CXC chemokine receptor 2; EGF, epidermal
growth factor; ER, endoplasmic reticulum; ERGIC, ER–Golgi intermediate compartment; FITC, fluorescein isothiocyanate; GAPDH,
glyceraldehyde-3-phosphate dehydrogenase; HIF, hypoxia inducible factor; HMVEC, human microvascular endothelial cell; HNK, human
normal kidney, normal renal epithelial strain; HRP, horseradish peroxidase; HSP, heat shock protein; IL, interleukin; PDGFR, platelet-derived
growth factor receptor; PEDF, pigment epithelial-derived factor; PTEN, phosphatase and tensin analog; RCC, renal cell carcinoma; TIMP,
tissue inhibitor of metalloproteinase; TRPC4, transient receptor potential canonical ion channel 4; TSP1, thrombospondin-1; VEGF, vascular
endothelial growth factor; VHL, von Hippel–Lindau.
FEBS Journal 274 (2007) 6365–6377 ª 2007 The Authors Journal compilation ª 2007 FEBS 6365
The prevailing treatments for kidney cancer are sur-
gery and immunotherapy. Until 2005, only high-dose
interleukin-2 (IL-2) had been approved by the US
Food and Drug Administration (FDA) [1]. As immu-
notherapy has unfavorable side-effects, new targeted
therapies to counter the molecular triggers of renal cell
carcinoma (RCC) are in high demand.
Clear cell RCC is largely caused by inactivation of
the von Hippel–Lindau (VHL) tumor suppressor [2].
The main target of the VHL tumor suppressor is
hypoxia inducible factor-1a (HIF1a), an oxygen-sens-
ing transcription factor, which undergoes regulatory
hydroxylation at normal Po
2
[3]. The VHL tumor
suppressor binds hydroxylated HIF1a, targets it for
proteasome degradation and thus suppresses HIF pro-
angiogenic targets, vascular endothelial growth factor
(VEGF) and erythropoietin, and pro-survival targets,
enabling stress-induced apoptosis [4]. Novel RCC

therapies target VEGF (Avastin) [5] or its receptor
(sunitinib, sorafenib) [6]. The latter also target VEGF-
producing tumor stroma by inactivating another tyro-
sine kinase, platelet-derived growth factor receptor-b
(PDGFRb) [1]. However, VEGF induction by HIF1a
alone is insufficient to promote the growth of RCC
xenografts [7].
The exclusive role of VEGF in RCC progres-
sion ⁄ angiogenesis has been challenged by the studies
of other angiogenic stimuli, including ELR+ CXC
chemokines, such as IL-8, and CXC chemokine recep-
tor 2 (CXCR2) ligands [8,9] or IL-2 via CXCR3 [10]
or basic fibroblast growth factor (bFGF) and epider-
mal growth factor (EGF) [11–14].
In contrast, antiangiogenic proteins in RCC progres-
sion and angiogenesis have been largely ignored. A few
studies have implicated pigment epithelial-derived fac-
tor (PEDF) in Wilms’ tumor [15]; however, there are
no data that link PEDF and RCC. Other studies have
demonstrated that the more aggressive Wilms’ tumors
are characterized by low levels of antiangiogenic
thrombospondin-1 (TSP1) [16]. TSP1 is also secreted
by glomerular mesangial cells [17]. In another study,
small, mildly angiogenic tumors were found to produce
more TSP1 than more aggressive counterparts [18].
We therefore hypothesize that TSP1 supports normal
kidney angiostasis, and that its loss contributes to the
RCC angiogenic phenotype.
TSP1 is a multifunctional extracellular matrix pro-
tein, and a potent and versatile angiogenesis inhibitor

that is critical for the maintenance of the antiangiogen-
ic microenvironment in multiple organ sites, including
breast, brain, colon and skin [19]. Conversely, re-intro-
duction of TSP1 or its active peptides blocks angiogen-
esis in a variety of experimental tumors and metastases
[20]. The tumor suppressor genes p53, phosphatase
and tensin analog (PTEN) and SMAD4 maintain nor-
mal, high levels of TSP1 expression (reviewed in [21]).
Conversely, the oncogenes Id-1, Jun, Myc, Ras and
Src repress TSP1 production and thus flip the angio-
genic switch on and enable tumor growth [21]. TSP1
inhibits multiple endothelial cell functions, such as
migration, proliferation and lumen formation [20]. In
addition, TSP1 causes endothelial cell apoptosis and
thus compromises the integrity of the tumor vascula-
ture [22]. Finally, TSP1 regulates the numbers of circu-
lating endothelial precursor (CEP) cells, and thereby
impinges on VEGF-mediated CEP cell recruitment to
the sites of neovascularization [23]. A knowledge of
the molecular mechanisms that cause TSP1 loss in the
tumor microenvironment is instrumental to determine
a subset of tumors that would benefit from TSP1-
based therapies and to aid in the development of novel
targeted therapies to control them.
In this article, we show that disrupted TSP1 secre-
tion renders RCC cells pro-angiogenic. Seeking under-
lying mechanisms, we found that RCC cells fail to
mount calcium uptake in response to growth factors,
probably as a result of the low expression levels of the
two calcium exchange proteins, calbindin and transient

receptor potential canonical ion channel 4 (TRPC4).
Calcium deficiency is critical for the correct folding
and secretion of TSP1: the calcium chelator 1,2-bis(o-
aminophenoxy)ethane-N,N,N¢,N¢-tetraacetic acid acet-
oxymethyl ester (BAPTA-AM) caused retrograde
transport and retention of TSP1 by otherwise normal
renal epithelium (human normal kidney, normal renal
epithelial strain, HNK). TSP1 misfolding caused by
calcium deficiency led to its retrograde transport, intra-
cellular retention and diminished secretion. Thus, the
loss of TSP secretion as a result of epigenetic changes
may deplete antiangiogenic TSP1 in the tumor envi-
ronment and cause conditions permissive for angio-
genesis.
Results
TSP1 suppresses angiogenesis in normal kidney
epithelium
Seeking a role for TSP1 in the evolution of the angio-
genic response in RCC, we stained 11 human RCC
specimens and six specimens of adjacent normal tissue
for TSP1. Based on the assumption that TSP1 main-
tains angiostasis in the kidney, we expected TSP1 to
be lower in RCC tissues. Surprisingly, RCC and adja-
cent normal tissue showed similar staining intensities
(Fig. 1A; Table 1).
Thrombospondin-1 loss in renal cancer D. Veliceasa et al.
6366 FEBS Journal 274 (2007) 6365–6377 ª 2007 The Authors Journal compilation ª 2007 FEBS
A
BC
D

E
F
Fig. 1. Role of TSP1 in angiogenesis, and
localization in renal cells and tissue. (A) Sec-
tions of RCC tumors and adjacent normal
tissue (HNK) were stained for TSP1 and
counterstained with hematoxylin. (B, C) CM
from HNK and P769 RCC cells were tested
in the mouse corneal assay. TSP1 in HNK
cells was silenced using siRNA; the silenc-
ing was verified by RT-PCR and western
blot of CM (B). VEGF was neutralized with
antibodies (C). Representative corneas are
shown. There was a lack of angiogenic
response to HNK CM and a robust response
to RCC CM. In addition, TSP1 neutralization
restored the angiogenic activity of HNK CM;
VEGF neutralizing antibodies reversed this
effect and abolished the angiogenic activity
of RCC CM. (D) RNA isolated from the indi-
cated cell lines was subjected to semiquan-
titative RT-PCR with TSP1 primers. HNK,
normal cell strain; P769, PRC9, SW839,
ARZ-1 and WT8, RCC cell lines. (E) The
same cell lines were subjected to 24 h
serum deprivation, CM and cell lysates (CM
and L, respectively) were collected and
TSP1 was detected by western blotting.
Note the low TSP1 secretion and higher
intracellular levels in RCC cells. (F) HNK and

P769 cells were cultured for 24 h in full
serum or serum-free medium, fixed and
stained for TSP1. Note the depletion of
TSP1 in the cytoplasm of normal cells.
D. Veliceasa et al. Thrombospondin-1 loss in renal cancer
FEBS Journal 274 (2007) 6365–6377 ª 2007 The Authors Journal compilation ª 2007 FEBS 6367
In contrast, HNK and RCC cell lines differed in
their ability to induce angiogenesis. Conditioned media
(CM) from P769 and other RCC cell lines were
potently angiogenic in rat and mouse corneal assay for
angiogenesis. CM from normal HNK cells was non-
angiogenic; however, it became angiogenic if TSP1
was either neutralized with antibodies or silenced using
siRNA (Fig. 1B,C; Table 2). 786-O-WT8 cells were
weakly angiogenic in vivo and in vitro as a result of the
low levels of secreted VEGF; angiogenesis was only
marginally altered by TSP1 depletion (Table 2).
Both HNK and RCC cells produced VEGF (mea-
sured by ELISA); RCC cells produced three- to four-
fold more VEGF than HNK or 698-O-WT8 cells
(Table 3). In contrast, quantitative western blots
showed that HNK CM were high in TSP1
[ 2.6 lgÆ(100 lg total protein)
)1
], whereas RCC cells
secreted less than 0.12 lgÆ(100 lg protein)
)1
, regardless
of VHL status (Table 3; Fig. 1E). Using human micro-
vascular endothelial cell (HMVEC) chemotaxis as an

in vitro measure of angiogenesis, we determined the
specific activity (ED
50
) of each CM alone and with
VEGF or TSP1 neutralized (Table 3). CM from 786-
O-ARZ, PRC9, SW839 and p769 showed high specific
activity, reflective of the VEGF levels. In contrast, the
HNK CM was nonangiogenic: TSP1 depletion with
neutralizing antibodies revealed underlying angiogenic
activity in HNK cells, which, in turn, was blocked by
VEGF antibodies (Table 3).
RCC, but not normal kidney epithelium, retains
TSP1
Despite the difference in secreted TSP1, TSP1 mRNA
levels were similar in HNK and RCC cells (Fig. 1D).
RCC and HNK cells also produced roughly equal
total TSP1 protein [43 ± 5.3 and 42 ± 7.1 ngÆ(10 lg
protein)
)1
, respectively, P ¼ 0.48], as calculated using
data from Fig. 1E.
However, RCC cells secreted noticeably less TSP1
than did HNK cells (Fig. 1E). In contrast, lysates
of serum-starved HNK cells contained no detectable
TSP1, whereas TSP1 was found at high levels in the
cytoplasm of all RCC lines (Fig. 1E). Immunocyto-
chemistry of fixed cells showed robust cytoplasmic
staining for TSP1 in both HNK and RCC cells cultured
Table 1. TSP1 and VEGF immunostaining of kidney cancer and
normal tissue. Human tumor samples were stained for TSP1 and

VEGF, respectively. The slides were scored by two independent
pathologists (double-blind study).
Tissue or
tumor type
TSP1 VEGF
Case (n)
Staining
intensity Case (n)
Staining
intensity
Normal tissue 4 +++ 5 +
2 ++ 1 +++
RCC, grade 1–2 4 +++ 4 +++
3++2
1
++
+
RCC grade 3–4 1 +++ 2 +++
3++3++
Table 2. Corneal angiogenesis by conditioned media (CM). Media conditioned by the indicated cell lines were tested in rat
a
or mouse
b
cor-
neal neovascularization assay (see Experimental procedures). The results are expressed as positive corneas of the total implanted. To evalu-
ate the statistical significance of the changes in angiogenic activity as a result of inactivation of TSP1 and ⁄ or VEGF, the results were
expressed as the percentage of positive responses, grouped and subjected to Student’s t-test. TSP1 inactivation in the HNK CM (antibody
or siRNA silencing) significantly increased its angiogenic activity (P ¼ 0.023); further addition of VEGF inactivating antibodies returned the
angiogenic activity to levels that were not significantly different from those of the initial HNK CM (P ¼ 0.085); angiogenesis by CM from all
the tumor cell lines was significantly different from that of the HNK cells and WT8 revertant (P ¼ 0.0026). VEGF neutralizing antibody

decreased angiogenesis by P769 to a value that was not significantly different from that of unaltered HNK CM (P ¼ 0.13) and was signifi-
cantly lower than the activity of unaltered tumor CMs (P ¼ 0.0002).
Antibody
Positive responses per total implants for CM
HNK PRC9 P769 SW839 786-O-ARZ 786-O-WT8
None 0 ⁄ 6
a
(0%) 7 ⁄ 8
a
(87.5%) 8 ⁄ 8
a
(100%)
5 ⁄ 6
b
(83.3%)
6 ⁄ 8
a
(75%) 7 ⁄ 8
a
(87.5%) 2 ⁄ 7
a
(28.5%)
TSP1 Ab 5 ⁄ 8
a
(62.5%)
VEGF Ab 1 ⁄ 8
a
(12.5%) 3 ⁄ 8
a
(37.5%)

1 ⁄ 8
b
(12.5%)
2 ⁄ 8
a
(25%) 1 ⁄ 8
a
(12.5%) 0 ⁄ 5
a
(0%)
TSP1 Ab + VEGF Ab 2 ⁄ 9
b
(2.2%)
Scrambled siRNA 1 ⁄ 9
b
(11%)
TSP1 siRNA 8 ⁄ 10
b
(80%)
TSP1 siRNA + VEGF Ab 4 ⁄ 10
b
(40%)
a
Tested in rat.
b
Tested in mouse.
Thrombospondin-1 loss in renal cancer D. Veliceasa et al.
6368 FEBS Journal 274 (2007) 6365–6377 ª 2007 The Authors Journal compilation ª 2007 FEBS
in full serum. After 12–24 h without serum, TSP1 was
depleted from the HNK cytoplasm as a result of secre-

tion, but retained by P769 RCC (Fig. 1F). VHL tumor
suppressor had no effect on secreted TSP1: TSP1 secre-
tion was comparable in 786-O-WT8, 786-O-ARZ and
other RCC lines (Fig. 1C,D).
RCC cells show decreased calcium uptake
Improper folding may cause protein retention. Impor-
tantly, calcium binding strongly affects TSP1 folding
[24]. In the case of pseudoachondroplasia, TSP5 muta-
tions in the calcium-binding cassette alter its ability to
transit endoplasmic reticulum (ER) and to undergo
secretion [25,26]. We hypothesized that different TSP1
secretion may result from different calcium availability
in HNK and RCC cells. We measured calcium uptake
by the cells stimulated by VEGF: 10 ngÆmL
)1
VEGF
caused no measurable intake of Ca
2+
in RCC cells,
whereas HNK cells developed a robust response
(Fig. 2A,B). Moreover, RCC cells responded poorly to
Ionomycin, a potent Ca
2+
ionophore, relative to
HNK (Fig. 2B). In addition, treatment of HNK with
BAPTA-AM, a cell-permeating calcium chelator,
caused a significant increase in cytoplasmic TSP1 and
a concomitant decrease in secreted TSP1 (measured by
western blot and immunostaining; Fig. 2C,D). TSP1
appeared unique in this respect: 10 mm BAPTA-AM

had no effect on the intracellular content and secretion
of VEGF, but induced TSP1 retention and diminished
secretion (Fig. 2E).
RCC expresses low TRPC4 and calbindin
Seeking reasons for the altered calcium metabolism,
we examined TRPCs, which mediate agonist-stimu-
lated Ca
2+
influx [27]. Semiquantitative and real-time
RT-PCR showed significant expression of TRPC1,
TRPC4, TRPC6 and TRPC7 in HNK cells
(Fig. 3A,B). In RCC cells, TRPC4 expression was
decreased four-fold (Fig. 3A,B). TRPC4 expression
and function are established in the vasculature, but
not in the kidney. Importantly, TRPC5, the TRPC4
analog, was not expressed in HNK or RCC cells
(Fig. 3A,B); thus, there was no functional redundancy.
HNK cells expressed high levels of the calcium-bind-
ing protein, calbindin D28K [28] (Fig. 3C). In normal
kidney, calbindins transport calcium ions across the
glomerular epithelium and serve as buffers, to prevent
toxic concentrations of intracellular calcium [29]. Con-
sistent with published data, RCC cells expressed no
calbindin D28K, probably because of their poorly
differentiated state (Fig. 3C).
Functional TRPC4 was indeed critical for TSP1
secretion: TRPC4 siRNA transfection of HNK cells
caused an increase in cytoplasmic and a decrease in
secreted TSP1 (Fig. 3D).
RCC cells retain TSP1 in the ER

One possible consequence of misfolding is protein
‘recall’ to the ER from the ER–Golgi intermediate
compartment (ERGIC), a site for concentrating retro-
grade cargo [30]. Anterograde transport vesicles con-
tain coatomer protein II (COPII), whereas retrograde
vesicles contain COPI [31,32]. In RCC cells and HNK
cells treated with BAPTA-AM, TSP1 colocalized with
ER markers, but not with Golgi, suggesting retrograde
transport (Fig. 4A–E). When HNK and p769 cells were
subjected to 4 h of serum deprivation to prompt secre-
tion, fixed and stained for TSP1 and Sec23 (COPII
component) or c2-Cop (COPI marker), TSP1 colocal-
ized with Sec23 ⁄ COPII in HNK cells; colocalization
with c2-Cop ⁄ COPI was minimal in HNK cells,
Table 3. Angiogenic characteristics of the conditioned media (CM). CM from the indicated cell lines were collected and subjected to the fol-
lowing analyses: (a) VEGF levels were measured by ELISA; (b) TSP1 levels were measured by densitometry analysis of western blots; (c)
ED
50
was measured in the endothelial cell chemotaxis assay; ED
50
of RCC CM was also measured in the presence of VEGF neutralizing
antibody (1 lgÆmL
)1
) and TSP1 neutralizing antibody (2.5 lgÆmL
)1
) where shown; (d) corneal angiogenesis was tested in rat assay (see
Experimental procedures) and scored. Pellets contained 1.25 or 2.5 lg of total protein. The antibodies were added at 2 and 5 lg per pellet
where indicated. N ⁄ A, not assessed.
CM
Secreted

VEGF (pgÆmg
)1
)
Secreted TSP
(lgÆmg
)1
)
ED
50
(lgÆmL
)1
) Corneal angiogenesis
TSP1 Ab No Ab VEGF Ab TSP1 Ab No Ab VEGF Ab
HNK 320 ± 80 2.6 ± 0.46 > 20 N ⁄ A 0.33 – N ⁄ A+
PRC9 1140 ± 310 0.15 ± 0.08 0.10 7.9 N ⁄ A++ – N⁄ A
SW839 830 ± 220 0.07 ± 0.05 0.17 9.2 N ⁄ A++ +⁄ –N⁄ A
P769 1060 ± 270 0.19 ± 0.1 0.12 6.8 N ⁄ A++ +⁄ –N⁄ A
786-O-ARZ 1310 ± 330 0.11 ± 0.4 0.05 12.0 N ⁄ A++ – N⁄ A
786-O-WT8 130 ± 30 0.06 ± 0.03 0.52 > 20 N ⁄ A+⁄ –– +⁄ –
D. Veliceasa et al. Thrombospondin-1 loss in renal cancer
FEBS Journal 274 (2007) 6365–6377 ª 2007 The Authors Journal compilation ª 2007 FEBS 6369
A
B
C
D
Fig. 3. Calcium channels and calbindin in HNK and P769 cells. (A, B) mRNA levels for TRPC1–7 were evaluated in HNK and P769 cells by
semiquantitative RT-PCR (A) or Q-PCR (B), using GAPDH message as control. (C) Western blot for calbindin D28K. (D) HNK cells were trans-
fected with TRPC4 siRNA or scrambled control siRNA and cultured for 12 h in full medium. After an additional 48 h in serum-free medium,
RNA and CM were collected. The silencing was ascertained by semiquantitative RT-PCR (approximately 45% decrease in the message
level). Lysates (L) and CM were analyzed by western blotting for TSP1 content. Note the cytoplasmic retention and decreased TSP1 secre-

tion in HNK-siTRPC4.
AB
C
D
E
Fig. 2. Calcium uptake and mediators in HNK and RCC cells. (A) Ca
2+
uptake in response to VEGF by HNK and RCC cells. HNK and RCC
cells were preloaded with fluo-4 acetoxymethyl ester and treated with 10 ngÆmL
)1
VEGF. Ca
2+
uptake was measured at 10 s intervals by
videofluorescence imaging. (B) Representative images of fluo-4 acetoxymethyl ester-loaded cells prior to and after VEGF exposure. (C, D)
Changes in TSP1 secretion ⁄ retention in response to the calcium chelator BAPTA-AM. HNK cells were cultured for 12 h in serum-free med-
ium with the indicated BAPTA-AM concentrations. (C) The TSP1 content per milligram of protein was calculated using comparison with serial
TSP1 dilutions (standard curve) on western blot. (D) Representative blots of cell lysates (L, top, 20 lg per lane) and CM (CM, bottom, 5 lg
per lane) were collected in parallel experiments. (E) HNK and P769 cells were cultured for 12 h with or without BAPTA-AM (1 n
M). CM and
lysates were collected as above and analyzed by western blotting. Note the retention of TSP1 in the cytoplasm and decreased secretion by
the BAPTA-AM-treated HNK cells. Also note the higher VEGF levels in the cytoplasm and CM of P769 cells, and the lack of response to
BAPTA-AM. C, purified TSP1 or VEGF, respectively.
Thrombospondin-1 loss in renal cancer D. Veliceasa et al.
6370 FEBS Journal 274 (2007) 6365–6377 ª 2007 The Authors Journal compilation ª 2007 FEBS
indicating anterograde transport and secretion (Fig. 5).
By contrast, in p769 cells, TSP1 colocalized with
c2-Cop ⁄ COPI, suggesting retrograde transport (Fig. 5).
Discussion
Normal adult vasculature is quiescent as a result of the
balanced expression of pro- and antiangiogenic factors

[33,34]. Multiple inducers of angiogenesis (VEGF,
bFGF, IL-8, stromal cell-derived factor-1, etc.), when
expressed at high levels, expand tumor vasculature
[35]. Most strategies target angiogenic stimuli, their
receptors or receptor tyrosine kinase activity [36].
However, an expanding pool of natural molecules act
as brakes for angiogenesis [33]. Similar to tumor
suppressors, inhibitors are frequently lost in tumors,
creating a permissive environment for expansion.
Re-expression of such inhibitors in angiogenic tumors
impedes their progression: these include angiostatin,
endostatin, tumstatin, PEDF, SPARC (secreted pro-
tein, acidic and rich in cysteine), tissue inhibitor of
metalloproteinases (TIMPs) and TSP1. An emerging
concept is to view natural angiogenesis inhibitors as
endothelial-specific tumor suppressors [33].
TSP1 is one of the most studied angiogenesis inhibi-
tors [21], both in terms of regulation and mechanism
of action. It is lost in multiple tumor types: fibrosar-
coma, glioblastoma and carcinomas of the breast,
bladder, colon, prostate and thyroid [19]. TSP1 expres-
sion is associated with dormancy of nonangiogenic
tumors, and predicts a favorable outcome in multiple
tumor types [37]. It blocks angiogenesis via endothelial
cell apoptosis, which requires receptors CD36 and Fas,
and Fas ligand [38], and causes CD36-independent cell
cycle arrest [39]. TSP1 suppresses recruitment of the
circulating endothelial progenitors [40] and signaling
by nitric oxide (NO) [41].
The causes of TSP1 loss vary. They include genetic

alterations, e.g. the loss of tumor suppressor genes
C
BAPTA
P769
P769
HNK
HNK
A
B
C
D
E
Fig. 4. TSP1 localization in HNK and P769 cells. (A) HNK cells were
serum-starved to prompt secretion and treated with BAPTA-AM
(1 l
M), where indicated. After 12 h, HNK cells were fixed, stained
for TSP1 (green) and ER marker HSP-70 (red). Note the depletion
of TSP1 from the cytoplasm of untreated cells (C, top) and accumu-
lation in BAPTA-AM-treated cells (BAPTA-AM, bottom). (B–E) P769
and HNK cells were serum-starved for 24 h. HNK cells were trea-
ted with BAPTA-AM to achieve TSP1 retention. The cells were
then stained for TSP1 as in (A), and for either Golgi marker A58 (B,
C) or ER marker HSP-70 (D, E). Note the lack of TSP1 export in
BAPTA-AM-treated HNK cells and colocalization (shown in yellow)
with ER, but not with Golgi, in both RCC and BAPTA-AM-treated
HNK cells.
D. Veliceasa et al. Thrombospondin-1 loss in renal cancer
FEBS Journal 274 (2007) 6365–6377 ª 2007 The Authors Journal compilation ª 2007 FEBS 6371
(APC, p53, PTEN, SMAD-4 and THY-1) [42–46] or
the gain of activated oncogenes (Akt ⁄ PI-3K, Id-1,

Jun, MCT-1, Mts1 ⁄ S100A4, Myc, Ras and Src) [47–
50]. Some of these pathways interact: Ras can acti-
vate c-Myc [51], which acts via microRNA cluster
miR-17-92 [52]. Epigenetic events may also contrib-
ute: TSP1 can be repressed by anoxia [53] or hyper-
glycemia [54]. A knowledge of the pathways altering
TSP1 production may yield therapies to restore
angiogenic balance and reduce or arrest tumor bur-
den.
Our study yielded two findings. First, the loss of
secreted TSP1 contributed to angiogenesis by RCC
cells in cooperation with the increase in VEGF. Sec-
ond, TSP1 secretion, which determines the state of the
angiogenic switch, was impaired in RCC because of
cytoplasmic retention, whilst healthy cells maintained
normal secretion. Seeking molecular causes of failure
to secrete TSP1, we focused on misfolding caused by
limited calcium availability [55]. This was indeed the
case: in RCC or BAPTA-AM-treated normal renal
cells, TSP1 resided in the ER, and not in the Golgi
apparatus. In RCC cells, the analysis of transport
vesicles showed strong TSP1 association with COPI-
positive vesicles responsible for retrograde transport, a
mechanism by which the cells ‘recall’ misfolded pro-
teins from the ERGIC [56]. By contrast, in HNK cells,
TSP1 was localized predominantly in COPII-positive
anterograde vesicles, pointing to Golgi accumulation
prior to secretion.
Seeking reasons for impaired calcium metabolism,
we found that RCC cells expressed lower levels of

TRPC4, which, together with TRPC1, forms hetero-
meric channels [27] that mediate growth factor-stimu-
lated calcium influx [27]. Although TRPC4 expression
in the renal epithelium has been shown, its role in
renal tissue is unknown. Our data indicate that TRPC4
is a key regulator of calcium intake in this tissue. Fur-
ther analysis showed that, in agreement with published
data [57], most RCC cell lines expressed no detectable
calbindin, possibly because of their undifferentiated
state. In addition to transepithelial calcium transport,
calbindin acts as a buffer, absorbing excess calcium
[28,29]. The lack of calbindin increases apoptosis in
response to growth factor-initiated calcium intake [58].
Thus, TRPC4 reduction may be an adaptation of
RCC cells to the lack of calbindin protective function.
The protection from apoptosis despite the lack of cal-
bindin could be explained by the decrease in TRPC4,
or by retention of the Ca
2+
-binding TSP1. However,
TSP1 knockdown with siRNA had no effect on the
viability of P769 cells (see supplementary Fig. S1), sug-
gesting that the loss of TRPC4 was sufficient to com-
pensate for the lack of calbindin.
Therefore, we have demonstrated diminished TSP1
secretion by RCC cells as a result of active retro-
grade transport. This active retrograde transport was
triggered by protein misfolding, which, in turn, was
caused by changes in calcium metabolism. Calcium
intake in response to growth stimuli was reduced

because of the decrease in TRPC4 and the lack of
calbindin. This is a novel pathway by which cancer
cells down-regulate TSP1, an angiogenesis inhibitor,
and flip their angiogenic switch. Further analysis of
calcium metabolism and its modifiers may yield
novel strategies to suppress RCC angiogenesis and
growth.
Experimental procedures
Cells and reagents
Human renal epithelial cells (HNK, P3-8; Clonetics, Walk-
ersville, MD) were grown in keratinocyte growth medium
(Gibco Invitrogen, Carlsbad, CA) with 10% fetal bovine
serum. RCC cells (PRC9, SW839, p769; American Tissue
A
B
Fig. 5. TSP1 association with retro- and anterograde transport vesi-
cles. The cells were starved for 6 h to initiate secretion, fixed and
stained for TSP1 (red) and for COPII component Sec23, a marker
of anterograde vesicles, or with COPI component c2-COP, a mar-
ker of retrograde vesicles (green). Note the predominant TSP1 colo-
calization with Sec23 (anterograde vesicles) in normal HNK and
with c2-COP (retrograde vesicles) in P769 tumor cells.
Thrombospondin-1 loss in renal cancer D. Veliceasa et al.
6372 FEBS Journal 274 (2007) 6365–6377 ª 2007 The Authors Journal compilation ª 2007 FEBS
Type Culture Collection, Manassas, VA) and 786-O RCC
expressing wild-type (WT8) or inactive VHL tumor sup-
pressor (ARZ; a gift from R. Kerbel, Sunnybrook and
Women’s Hospital, Toronto, Canada) were maintained in
keratinocyte growth medium with 10% fetal bovine serum.
HMVECs (Clonetics) were maintained in MDCB131

(Sigma, St Louis, MO) with the endothelial cell bullet kit
(BioWhittaker, Walkersville, MD).
BAPTA-AM, fluo-4 acetoxymethyl ester and Pluronic
F127 were obtained from Molecular Probes (Invitrogen).
VEGF and EGF were purchased from R&D Systems
(Minneapolis, MN).
TSP1 antibodies (Ab-1, Ab-3, Ab-11) were obtained from
NeoMarkers (Fremont, CA). VEGF antibodies were pur-
chased from R&D Systems. A-58 monoclonal antibody was
obtained from Sigma. Antibodies for heat shock protein-70
(HSP-70), c2-Cop and Sec23 were obtained from Santa
Cruz (Santa Cruz, CA, USA) and Calbindin D-28K from
AbCam (Cambridge, MA). Fluorescein isothiocyanate
(FITC)-conjugated goat anti-mouse IgG were purchased
from Sigma. Rhodamine (TRITC)-conjugated, horseradish
peroxidase (HRP)-conjugated and Alexa Fluor-conjugated
antibodies were obtained from Jackson Immunoresearch
(Westgrove, PA). TSP1 was purified from platelets as
described previously [59].
CM preparation
The cells were grown to 70–80% confluence, rinsed twice
and transferred to serum-free medium. After 4 h, this
medium was removed and replaced by fresh medium. After
24–48 h, CM were collected and concentrated in centifugal
filters (3 kDa cut-off; Millipore, Billerica, MA).
Transfection
TRPC4, TSP1, glyceraldehyde-3-phosphate dehydrogenase
(GAPDH) and scrambled siRNA were obtained from
Dharmacon (Lafayette, CO). The cells were seeded in six-
well plates (4 · 10

5
,3· 10
5
and 2 · 10
5
per well) in the
growth medium. siRNA in 200 lL of serum-free medium
(100 nm final concentration) and DharmaFECT reagent
(4 lL in 200 lL of serum-free medium) were incubated for
20 min at room temperature and added to the cells. After
24, 48 and 72 h, CM were collected and the cells were pro-
cessed further (total RNA and ⁄ or cell lysates).
Cell survival ⁄ proliferation assay
The cells were seeded in a 96-well plate. 3-(4,5-Di-
methylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide reagent
(Chemicon, Billerica, MA) was added at 24, 48 and 72 h
and incubated for 4 h at 37 °C. The assay was performed
following the manufacturer’s instructions.
Endothelial cell chemotaxis
HMVECs starved overnight in MDCB131 with 0.1% BSA
were plated at 1.5 · 10
6
mL
)1
on the lower side of porous
membranes (8 mm, Nucleopore Corp., Kent, WA) in modi-
fied Boyden chambers (Neuroprobe, Gaithersburg, MD);
the samples were added to the top. Cells migrating to the
opposite side of the membrane were counted in · 10 400
fields (controls: 0.1% BSA, 10 ngÆmL

)1
bFGF).
Specific activity
CM were tested as above, at 0.01–40 lgÆmL
)1
, to generate
dose–response curves. The ED
50
values (concentrations pro-
ducing 50% maximal response) were extrapolated from the
best-fit curves (sigmaplot, Systat Software, San Jose, CA).
To evaluate VEGF and TSP1 contributions, the appro-
priate neutralizing antibodies were added at 1.0 and
2.5 lgÆmL
)1
, respectively.
Corneal angiogenesis
CM from HNK and RCC cell lines were analyzed in the
rat or mouse corneal assay [60,61]. Briefly, micropockets
were aseptically created in the cornea of female Fisher 344
rats or C57Bl6 mice (Harlan), 1.5–2.0 mm and 0.5–1 mm
from the limbus, respectively. In rats, Hydron (HydroMed,
Cranbury, NJ, USA) implants ( 5 lL, 2 lg CM protein)
were placed in the micropockets and angiogenesis was
scored on day 7. Animals were perfused with colloidal car-
bon, and the corneas were fixed, flattened and photo-
graphed. Vascular growth from the limbus to the pellet
was graded as positive or negative. In mice, Hydron sucral-
fate pellets (1 lL, 0.4 mg protein) were implanted and
angiogenesis was scored on day 5 by slit-lamp microscopy.

All animals were handled following the National Institutes
of Health guidelines and protocols approved by the North-
western University Animal Care and Use Committee.
Statistical evaluation
Quantitative results were evaluated using Student’s t-test.
P < 0.05 was considered to be significant.
Tissue acquisition and staining
Deidentified specimens were obtained from the pathology
department with Institutional Review Board approval
for archived tissues. Five micrometer sections were stained
with hematoxylin–eosin to select the areas of carcinoma
and noncancerous tissue. Sections were deparaffinized, re-
hydrated in graded ethanol solutions, treated for 5 min
with 3% H
2
O
2
, rinsed and blocked for 30 min in 10%
D. Veliceasa et al. Thrombospondin-1 loss in renal cancer
FEBS Journal 274 (2007) 6365–6377 ª 2007 The Authors Journal compilation ª 2007 FEBS 6373
horse serum at room temperature. The sections were incu-
bated with TSP1 antibodies in blocking solution (Ab-1,
1 : 250, 4 °C overnight), followed by rabbit anti-mouse IgG
(Vectastain ABC kit, Vector, Burlingham, CA, 1 : 125, 1 h
at room temperature), rinsed and incubated with avidin–
biotin complex (Vectastain; 1 h, room temperature). Slides
were developed with 2,4-diaminobutyric acid, counterstained
with hematoxylin, rehydrated and mounted.
Western blotting
To detect TSP1, the cells were lysed for 1 h at 4 °Cin1%

Nonidet P-40, 1% sodium deoxycholate, 0.1% SDS and
150 mm NaCl in 10 mm sodium phosphate pH 7.2, with
protease inhibitors. The lysates were loaded at 30 lg per
lane; concentrated CM were loaded at 10 lg per lane. The
blots were probed with TSP1 Ab-11 (1 : 400), and the sig-
nal was detected with a LumiGLO Kit (KPL, Gaithersburg,
MD). Calbindin antibodies (1 : 5000) were applied over-
night (4 °C).
Calcium imaging
Intracellular calcium was detected by videofluorescence
imaging. Cells were grown on chamber slides, rinsed in
Hank’s balanced salt solution, 10 mm Hepes, 11 mm glu-
cose, 2.5 mm CaCl
2
and 1.2 mm MgCl
2
, loaded for 30 min
in 5 lm fluo-4 acetoxymethyl ester, Pluronic F127 (1 : 1,
Molecular Probes), treated and monitored (488 nm excita-
tion, 520 nm emission) with a fluorescent microscope
(Leica, Bannockburn, IL, · 20 objective). Images were
acquired with a Hamamatsu (Bridgewater, NJ) camera
(10 s intervals, openlab software, Improvision, Waltham,
MA) and analyzed with imagej software (minimum of 30
cells per treatment).
RT-PCR
One microgram of total RNA extracted with an RNeasy
kit (Qiagen, Valencia, CA) was used for reverse transcrip-
tion with oligo(dT)
15

primers (protocol and reagents from
Promega, Madison, WI). Serial dilutions of cDNA were
PCR-amplified in a 23-cycle reaction with b-actin primers
(HotStartTaq
TM
, Qiagen). Dilutions yielding similar prod-
uct amounts were chosen for analysis; products were
resolved on 1.5% agarose gels. Primers ⁄ conditions are
given in Table 4.
Immunofluorescence
Cells grown on coverslips were fixed in ice-cold methanol–
acetone (1 : 1) and blocked for 30 min (1% horse serum).
To detect TSP1, the cells were incubated for 1 h at room
temperature with Ab-1 (1 : 50 in blocking solution), fol-
lowed by the Alexa Fluor 488 goat anti-mouse IgM
(5 lgÆmL
)1
in blocking solution). A-58 Golgi protein anti-
body (1 : 500) was followed by goat anti-mouse TRITC-
IgG (1 : 100). ER marker antibody, HSP-70 (1 : 100), was
followed by Alexa Fluor 546 goat anti-mouse IgG
(5 lgÆmL
)1
). To analyze TSP1 localization to transport ves-
icles, the slides were blocked for 30 min in 10% donkey
serum and incubated with TSP1 Ab-3 (1 : 50) and Sec23 or
c2-Cop antibodies (1 : 50) in 2% donkey serum for 1 h at
room temperature. The slides were rinsed three times and
incubated for 1 h with FITC-conjugated donkey anti-mouse
IgG and Texas Red conjugated donkey anti-goat IgG

(1 : 100, 2% donkey serum). The slides were mounted in
Fluoromount-G.
Acknowledgements
This work was funded by National Institutes of Health
(NIH) grant RO1 HL077471 (OV).
References
1 Brugarolas J (2007) Renal-cell carcinoma – molecular
pathways and therapies. N Engl J Med 356, 185–187.
2 Kim WY & Kaelin WG (2004) Role of VHL gene
mutation in human cancer. J Clin Oncol 22, 4991–5004.
3 Kaelin WG Jr (2003) The von Hippel–Lindau gene, kid-
ney cancer, and oxygen sensing. J Am Soc Nephrol 14,
2703–2711.
4 Semenza GL (2003) Targeting HIF-1 for cancer therapy.
Nat Rev Cancer 3, 721–732.
Table 4. Primers used in RT-PCR analysis.
Gene Primers (5¢-to3¢)
Annealing
T (°C)
Cycle
number
Actin TGTTGGCGTACAGGTCTTTGC 60 23
GCTACGAGCTGCCTGACGG
GAPDH TATCGTGGAAGGACTCATGACC 55 20
TACATGGCAACTGTGAGGGG
TSP1 CCGGCGTGAAGTGTACTAGCTA 65 25
TGCACTTGGCGTTCTTGT
TRPC1 GATTTTGGAAAATTTCTTGGGATGT 55 35
TTTGTCTTCATGATTTGCTATCA
TRPC2 CATCATCAT-GGTCATTGTGCTGC 55 35

GGTCTTGGTCAGCTCTGTGAGTC
TRPC3 GACATATTCAAGTTCATGGTCCTC 55 35
ACATCACTGTCATCCTCAATTTC
TRPC4 GCTTTGTTCGTGCAAATTTCC 55 35
CTGCAAATATCTCTGGGAAGA
TRPC5 CAGCATTGCGTTCTGTGAAAC 55 35
CAGAGCTATCGATGAGCCTAAC
TRPC6 GACATCTTCAAGTTCATGGTCATA 55 35
ATCAGCGTCATCCTCAATTTC
TRPC7 CAGAAGATCGAGGACATCAGC 55 35
GTGCCGGGCATTCACGTGGTA
Thrombospondin-1 loss in renal cancer D. Veliceasa et al.
6374 FEBS Journal 274 (2007) 6365–6377 ª 2007 The Authors Journal compilation ª 2007 FEBS
5 Yang JC (2004) Bevacizumab for patients with meta-
static renal cancer: an update. Clin Cancer Res 10,
6367S–6370S.
6 Motzer RJ & Bukowski RM (2006) Targeted therapy
for metastatic renal cell carcinoma. J Clin Oncol 24,
5601–5608.
7 Kurban G, Hudon V, Duplan E, Ohh M & Pause A
(2006) Characterization of a von Hippel Lindau path-
way involved in extracellular matrix remodeling, cell
invasion, and angiogenesis. Cancer Res 66, 1313–1319.
8 Garkavtsev I, Kozin SV, Chernova O, Xu L, Winkler
F, Brown E, Barnett GH & Jain RK (2004) The can-
didate tumour suppressor protein ING4 regulates brain
tumour growth and angiogenesis. Nature 428, 328–332.
9 Mestas J, Burdick MD, Reckamp K, Pantuck A, Figlin
RA & Strieter RM (2005) The role of CXCR2 ⁄ CXCR2
ligand biological axis in renal cell carcinoma. J Immunol

175, 5351–5357.
10 Pan J, Burdick MD, Belperio JA, Xue YY, Gerard C,
Sharma S, Dubinett SM & Strieter RM (2006)
CXCR3 ⁄ CXCR3 ligand biological axis impairs RENCA
tumor growth by a mechanism of immunoangiostasis.
J Immunol 176, 1456–1464.
11 Cenni E, Perut F, Granchi D, Avnet S, Amato I,
Brandi ML, Giunti A & Baldini N (2007) Inhibition
of angiogenesis via FGF-2 blockage in primitive and
bone metastatic renal cell carcinoma. Anticancer Res
27, 315–319.
12 Kedar D, Baker CH, Killion JJ, Dinney CP & Fidler IJ
(2002) Blockade of the epidermal growth factor receptor
signaling inhibits angiogenesis leading to regression of
human renal cell carcinoma growing orthotopically in
nude mice. Clin Cancer Res 8, 3592–3600.
13 Inoue K, Kamada M, Slaton JW, Fukata S, Yoshikawa
C, Tamboli P, Dinney CP & Shuin T (2002) The
prognostic value of angiogenesis and metastasis-related
genes for progression of transitional cell carcinoma of
the renal pelvis. and ureter. Clin Cancer Res 8, 1863–
1870.
14 Slaton JW, Inoue K, Perrotte P, El-Naggar AK, Swan-
son DA, Fidler IJ & Dinney CP (2001) Expression levels
of genes that regulate metastasis and angiogenesis corre-
late with advanced pathological stage of renal cell carci-
noma. Am J Pathol 158, 735–743.
15 Abramson LP, Browne M, Stellmach V, Doll J, Corn-
well M, Reynolds M, Arensman RM & Crawford SE
(2006) Pigment epithelium-derived factor targets endo-

thelial and epithelial cells in Wilms’ tumor. J Pediatr
Surg 41, 1351–1356.
16 Huang J, Soffer SZ, Kim ES, Yokoi A, Moore JT,
Mc Crudden KW, Manley C, Middlesworth W, O’Toole
K, Stolar C et al. (2002) p53 accumulation in favorable-
histology Wilms tumor is associated with angiogenesis
and clinically aggressive disease. J Pediatr Surg 37,
523–527.
17 Raugi GJ & Lovett DH (1987) Thrombospondin secre-
tion by cultured human glomerular mesangial cells. Am
J Pathol 129, 364–372.
18 Miyata Y, Koga S, Takehara K, Kanetake H & Kanda
S (2003) Expression of thrombospondin-derived 4N1K
peptide-containing proteins in renal cell carcinoma
tissues is associated with a decrease in tumor growth.
and angiogenesis. Clin Cancer Res 9, 1734–1740.
19 Lawler J (2002) Thrombospondin-1 as an endogenous
inhibitor of angiogenesis and tumor growth. J Cell Mol
Med 6, 1–12.
20 Volpert OV (2000) Modulation of endothelial cell sur-
vival by an inhibitor of angiogenesis thrombospondin-1:
a dynamic balance. Cancer Metastasis Rev 19, 87–92.
21 Ren B, Yee KO, Lawler J & Khosravi-Far R (2006)
Regulation of tumor angiogenesis by thrombospondin-
1.
Biochim Biophys Acta 1765, 178–188.
22 Jimenez B, Volpert OV, Crawford SE, Febbraio M,
Silverstein RL & Bouck N (2000) Signals leading to
apoptosis-dependent inhibition of neovascularization by
thrombospondin-1. Nat Med 6, 41–48.

23 Bocci G, Francia G, Man S, Lawler J & Kerbel RS
(2003) Thrombospondin 1, a mediator of the antiangio-
genic effects of low-dose metronomic chemotherapy.
Proc Natl Acad Sci USA 100, 12917–12922.
24 Adams JC (2004) Functions of the conserved thrombo-
spondin carboxy-terminal cassette in cell–extracellular
matrix interactions and signaling. Int J Biochem Cell
Biol 36, 1102–1114.
25 Dinser R, Zaucke F, Kreppel F, Hultenby K, Kochanek
S, Paulsson M & Maurer P (2002) Pseudoachondropla-
sia is caused through both intra- and extracellular path-
ogenic pathways. J Clin Invest 110, 505–513.
26 Unger S & Hecht JT (2001) Pseudoachondroplasia and
multiple epiphyseal dysplasia: new etiologic develop-
ments. Am J Med Genet 106, 244–250.
27 Desai BN & Clapham DE (2005) TRP channels and
mice deficient in TRP channels. Pflugers Arch 451,
11–18.
28 Lambers TT, Bindels RJ & Hoenderop JG (2006) Coor-
dinated control of renal Ca
2+
handling. Kidney Int 69,
650–654.
29 Hemmingsen C (2000) Regulation of renal calbindin-
D28K. Pharmacol Toxicol 87 (Suppl. 3), 5–30.
30 Behnia R & Munro S (2005) Organelle identity and the
signposts for membrane traffic. Nature 438, 597–604.
31 Watson P & Stephens DJ (2005) ER-to-Golgi transport:
form and formation of vesicular and tubular carriers.
Biochim Biophys Acta 1744, 304–315.

32 Mancias JD & Goldberg J (2005) Exiting the endoplas-
mic reticulum. Traffic 6, 278–285.
33 Nyberg P, Xie L & Kalluri R (2005) Endogenous inhibi-
tors of angiogenesis. Cancer Res 65, 3967–3979.
34 Sund M, Zeisberg M & Kalluri R (2005) Endogenous
stimulators and inhibitors of angiogenesis in
D. Veliceasa et al. Thrombospondin-1 loss in renal cancer
FEBS Journal 274 (2007) 6365–6377 ª 2007 The Authors Journal compilation ª 2007 FEBS 6375
gastrointestinal cancers: basic science to clinical applica-
tion. Gastroenterology 129, 2076–2091.
35 Carmeliet P (2003) Angiogenesis in health and disease.
Nat Med 9, 653–660.
36 Carmeliet P (2004) Manipulating angiogenesis in medi-
cine. J Intern Med 255, 538–561.
37 Naumov GN, Akslen LA & Folkman J (2006) Role of
angiogenesis in human tumor dormancy: animal models
of the angiogenic switch. Cell Cycle 5, 1779–1787.
38 Volpert OV, Zaichuk T, Zhou W, Reiher F, Ferguson
TA, Stuart PM, Amin M & Bouck NP (2002) Inducer-
stimulated Fas targets activated endothelium for
destruction by antiangiogenic thrombospondin-1 and
pigment epithelium-derived factor. Nat Med 8, 349–357.
39 Armstrong LC & Bornstein P (2003) Thrombospondins
1 and 2 function as inhibitors of angiogenesis. Matrix
Biol 22, 63–71.
40 Shaked Y, Bertolini F, Man S, Rogers MS, Cervi D,
Foutz T, Rawn K, Voskas D, Dumont DJ, Ben-David
Y et al. (2005) Genetic heterogeneity of the vasculogenic
phenotype parallels angiogenesis; implications for cellu-
lar surrogate marker analysis of antiangiogenesis. Can-

cer Cell 7, 101–111.
41 Isenberg JS, Jia Y, Fukuyama J, Switzer CH, Wink DA
& Roberts DD (2007) Thrombospondin-1 inhibits nitric
oxide signaling via CD36 by inhibiting myristic acid
uptake. J Biol Chem 282, 15404–15415.
42 Gutierrez LS, Suckow M, Lawler J, Ploplis VA &
Castellino FJ (2003) Thrombospondin 1 – a regulator
of adenoma growth and carcinoma progression in the
APC (Min ⁄ +) mouse model. Carcinogenesis 24, 199–
207.
43 Dameron KM, Volpert OV, Tainsky MA & Bouck N
(1994) Control of angiogenesis in fibroblasts by p53 reg-
ulation of thrombospondin-1. Science 265, 1582–1584.
44 Wen S, Stolarov J, Myers MP, Su JD, Wigler MH,
Tonks NK & Durden DL (2001) PTEN controls tumor-
induced angiogenesis. Proc Natl Acad Sci USA 98,
4622–4627.
45 Schwarte-Waldhoff I & Schmiegel W (2002) Smad4
transcriptional pathways and angiogenesis. Int J Gastro-
intest Cancer 31, 47–59.
46 Abeysinghe HR, Li LQ, Guckert NL, Reeder J & Wang
N (2005) THY-1 induction is associated with up-regula-
tion of fibronectin and thrombospondin-1 in human
ovarian cancer. Cancer Genet Cytogenet 161, 151–158.
47 Chen J, Somanath PR, Razorenova O, Chen WS, Hay
N, Bornstein P & Byzova TV (2005) Akt1 regulates
pathological angiogenesis, vascular maturation and
permeability in vivo. Nat Med 11, 1188–1196.
48 Mettouchi A, Cabon F, Montreau N, Vernier P, Mer-
cier G, Blangy D, Tricoire H, Vigier P & Binetruy B

(1994) SPARC and thrombospondin genes are repressed
by the c-jun oncogene in rat embryo fibroblasts. Embo J
13, 5668–5678.
49 Levenson AS, et al. (2005) MCT-1 oncogene contributes
to increased in vivo tumorigenicity of MCF7 cells by
promotion of angiogenesis and inhibition of apoptosis.
Cancer Res 65, 10651–10656.
50 Schmidt-Hansen B, et al. (2004) Functional significance
of metastasis-inducing S100A4 (Mts1) in tumor–stroma
interplay. J Biol Chem 279, 24498–24504.
51 Watnick RS, Cheng YN, Rangarajan A, Ince TA &
Weinberg RA (2003) Ras modulates Myc activity to
repress thrombospondin-1 expression and increase
tumor angiogenesis. Cancer Cell 3, 219–231.
52 Dews M, et al. (2006) Augmentation of tumor angio-
genesis by a Myc-activated microRNA. Cluster Nat
Genet 38, 1060–1065.
53 Tenan M, et al. (2000) Thrombospondin-1 is downregu-
lated by anoxia and suppresses tumorigenicity of human
glioblastoma cells. J Exp Med 191, 1789–1798.
54 Sheibani N, Sorenson CM, Cornelius LA & Frazier
WA (2000) Thrombospondin-1, a natural inhibitor of
angiogenesis, is present in vitreous and aqueous humor
and is modulated by hyperglycemia. Biochem Biophys
Res Commun 267, 257–261.
55 Misenheimer TM & Mosher DF (1995) Calcium ion
binding to thrombospondin 1. J Biol Chem 270, 1729–
1733.
56 Lee MC, Miller EA, Goldberg J, Orci L & Schekman R
(2004) Bi-directional protein transport between the ER

and Golgi. Annu Rev Cell Dev Biol 20, 87–123.
57 Bhat HK & Epelboym I (2004) Suppression of calbindin
D28K in estrogen-induced hamster renal tumors.
J Steroid Biochem Mol Biol 92, 391–398.
58 Parkash J, Chaudhry MA & Rhoten WB (2004) Calbin-
din-D28k and calcium sensing receptor cooperate in
MCF-7 human breast cancer cells. Int J Oncol 24,
1111–1119.
59 Volpert OV, Lawler J & Bouck NP (1998) A human
fibrosarcoma inhibits systemic angiogenesis and the
growth of experimental metastases via thrombo-
spondin-1. Proc Natl Acad Sci USA 95, 6343–6348.
60 Good DJ, Polverini PJ, Rastinejad F, Le Beau MM,
Lemons RS, Frazier WA & Bouck NP (1990) A tumor
suppressor-dependent inhibitor of angiogenesis is immu-
nologically and functionally indistinguishable from a
fragment of thrombospondin. Proc Natl Acad Sci USA
87, 6624–6628.
61 Kenyon BM, Voest EE, Chen CC, Flynn E, Folkman J
& D’Amato RJ (1996) A model of angiogenesis in the
mouse cornea. Invest Ophthalmol Vis Sci 37, 1625–1632.
Supplementary material
The following supplementary material is available
online:
Fig. S1. P769 cells in 6-well plates (2500 cells/well)
were transfected with TSP1 siRNA (Dharmacon) or
Thrombospondin-1 loss in renal cancer D. Veliceasa et al.
6376 FEBS Journal 274 (2007) 6365–6377 ª 2007 The Authors Journal compilation ª 2007 FEBS
control (scrambled siRNA). At 24, 48 and 72 h the
number of viable cells was detected using MTT assay.

Note that P769-siTSP (dark blue) does not differ sig-
nificantly from P769-siSCR (pink).
This material is available as part of the online article
from
Please note: Blackwell Publishing is not responsible
for the content or functionality of any supplementary
materials supplied by the authors. Any queries (other
than missing material) should be directed to the corre-
sponding author for the article.
D. Veliceasa et al. Thrombospondin-1 loss in renal cancer
FEBS Journal 274 (2007) 6365–6377 ª 2007 The Authors Journal compilation ª 2007 FEBS 6377