Báo cáo khoa học: Biochemical characterization of recombinant dihydroorotate dehydrogenase from the opportunistic pathogenic yeast Candida albicans pot

Biochemical characterization of recombinant
dihydroorotate dehydrogenase from the opportunistic
pathogenic yeast Candida albicans
Elke Zameitat
1
, Zoran Gojkovic
´
2,
*, Wolfgang Knecht
2,†
, Jure Pis
ˇ
kur
2,‡
and Monika Lo
¨
ffler
1
1 Institute for Physiological Chemistry, Philipps-University, Marburg, Germany
2 BioCentrum-DTU, Technical University of Denmark, Lyngby, Denmark
Many fungi, including certain yeasts, have been known
for decades as human pathogens. Candida albicans rep-
resents the major group of yeast species identified in
clinical isolates. This opportunistic pathogen causes
both trivial infections in normal people and serious
infections in immuno-compromised patients, especially
HIV-infected individuals [1]. Yeast infections represent
a severe problem for clinicians, as a limited number of
antifungal agents are available. In addition, these
organisms are becoming resistant to current classes of
antifungal agents, particularly the azoles [2]. Expres-

sion of efflux pumps that reduce drug accumulation,
and mutation or overexpression of antifungal target
proteins are strategies that may be used by the patho-
gens [3]. The clinical consequences of antifungal
resistance can be seen in treatment failures in patients
and in changes in the prevalences of Candida spe-
cies [4].
Keywords
antimycotics; Candida albicans;
dihydroorotate dehydrogenase; pyrimidines;
redoxal
Correspondence
E. Zameitat or M. Lo
¨
ffler, Institute for
Physiological Chemistry, Philipps-University,
Karl-von-Frisch-Str. 1, D-35033 Marburg,
Germany
Fax: +49 6421 2865116
Tel: +49 6421 2865022
E-mail: ;
loeffl
Present address
*AstraZeneca R&D Mo
¨
lndal, SE-431 83
Mo
¨
lndal, Sweden
†ZGene A ⁄ S, Anker Engelundsvej 1, Build-

ing 301, 2800 Lyngby, Denmark
‡Department of Cell and Organism Biology,
Lund University, So
¨
lvegatan 35, SE-223 62
Lund, Sweden
(Received 17 March 2006, revised 16 May
2006, accepted 18 May 2006)
doi:10.1111/j.1742-4658.2006.05327.x
Candida albicans is the most prevalent yeast pathogen in humans, and
recently it has become increasingly resistant to the current antifungal
agents. In this study we investigated C. albicans dihydroorotate dehydroge-
nase (DHODH, EC 1.3.99.11), which catalyzes the fourth step of de novo
pyrimidine synthesis, as a new target for controlling infection. We propose
that the enzyme is a member of the DHODH family 2, which comprises
mitochondrially bound enzymes, with quinone as the direct electron accep-
tor and oxygen as the final electron acceptor. Full-length DHODH and
N-terminally truncated DHODH, which lacks the targeting sequence and
the transmembrane domain, were subcloned from C. albicans, recombinant-
ly expressed in Escherichia coli, purified, and characterized for their kinetics
and substrate specificity. An inhibitor screening with 28 selected com-
pounds was performed. Only the dianisidine derivative, redoxal, and the
biphenyl quinoline-carboxylic acid derivative, brequinar sodium, which are
known to be potent inhibitors of mammalian DHODH, markedly reduced
C. albicans DHODH activity. This study provides a background for the
development of antipyrimidines with high efficacy for decreasing in situ
pyrimidine nucleotide pools in C. albicans.
Abbreviations
DHO,
L-dihydroorotate; DHODH, dihydroorotate dehydrogenase; FeCy, potassium hexacyanoferrate(III); Q

0
, 2,3-dimethoxy-5-methyl-1,4-
benzoquinone; Q
6
, ubiquinone 30; Q
10
, ubiquinone 50; Q
D
, decylubiquinone.
FEBS Journal 273 (2006) 3183–3191 ª 2006 The Authors Journal compilation ª 2006 FEBS 3183
Whereas the pyrimidine metabolism of Saccharomy-
ces cerevisiae has received considerable attention, that
of C. albicans has been addressed only indirectly. For
example, 5-fluorocytosine possesses antifungal activity
in C. albicans but no antineoplastic activity, as does
5-fluorouracil in humans [5]. Expression of the salvage
enzymes cytosine deaminase and uracil phosphoribo-
syltransferase in C. albicans makes pyrimidine salvage
different from that in mammals, because mammals can
only take up pyrimidine nucleosides for recycling [6].
As a prerequisite for development of antipyrimidine
agents that can enter cells through the salvage path-
way, permeases for pyrimidines and purines have been
well studied in yeast species [7].
The enzymes of the de novo pyrimidine synthesis
pathway have been shown to be drug targets, or
potential drug targets, in eukaryotes [8,9]. This biosyn-
thetic pathway results in the formation of UMP and
consists of six enzymatic activities found in all organ-
isms [10,11]. In most eukaryotes studied so far, five of

the corresponding enzymes are located in the cytosol,
whereas the fourth enzymatic reaction catalyzed by
dihydroorotate dehydrogenase takes place at the inner
mitochondrial membrane [10,12]. The reaction mech-
anism of dihydroorotate dehydrogenase (DHODH, EC
1.3.99.11) (Fig. 1) includes the stereospecific oxidation
of (S)-5,6-dihydroorotate to orotate with reduction of
flavin [13,14], and the transfer of electrons to ubiqui-
none, which is part of the respiratory chain. Because
of this connection, pyrimidine formation requires a
sufficient concentration of oxygen in the cells. Whereas
Schizosaccharomyces pombe possesses a mitochondrial
membrane-bound enzyme (classified as family 2
DHODH), S. cerevisiae has a cytosolic DHODH (clas-
sified as family 1 DHODH), the activity of which is
independent of ubiquinone and the presence of oxygen
[15–17]. This feature promotes growth of this yeast
under anaerobic conditions. Saccharomyces kluyveri,a
species relatively closely related to S. cerevisiae, is the
only yeast known to date that contains both enzyme
forms [16,17]. Even though S. cerevisiae is a close rel-
ative of Candida species, and is often used as a model
pathogen, its DHODH of family 1 is unsuitable as a
prototype for the search for enzyme inhibitors in other
yeasts.
We subcloned a gene coding for C. albicans
DHODH (accession number AY230865), overexpressed
and purified the recombinant enzyme, and compared it
with the DHODH from humans and other yeasts
[17,18]. This work evaluates C. albicans DHODH as a

target for the development of highly specific antimycot-
ic drugs against this widespread pathogen.
Results
Genetic code and overexpression
In C. albicans the standard leucine CUG codon is
translated as serine [19]. We found two CUG codons
in the DHODH ORF and changed them to UCG
(L11S and L78S) by site-directed PCR mutagenesis for
gene expression in a bacterial system. By sequence
alignment, we identified C. albicans DHODH as a
family 2 enzyme (Fig. 2). In this class of enzyme, a
catalytic serine residue corresponds to the active-site
cysteine in family 1. A typical bipartite N-terminal
sequence was identified in the sequence consisting of a
targeting sequence that, analogously to the rat and
human enzyme [12], promotes import into mitochon-
dria and a hydrophobic transmembrane domain neces-
sary for the correct insertion into the inner
mitochondrial membrane. Expression vectors were
constructed to produce full-length CaDHODH and an
N-terminally truncated mutant (DNCaDHODH), lack-
ing the putative bipartite mitochondrial targeting motif
and transmembrane domain.
After purification of the full-length and truncated
CaDHODH by affinity chromatography, SDS ⁄ PAGE
(Fig. 3) showed that the purified enzymes were of the
expected molecular mass of 48 kDa for the full-length
enzyme and 42 kDa for the truncated enzyme. The
yield of recombinant proteins purified from 1 L E. coli
BL21 cultures was different for the full-length and

truncated enzyme when cultured under similar condi-
tions: 0.5 mg CaDHODH and 1.2 mg DNCaDHODH.
Compared with other mitochondrial yeast DHODH,
the protein abundancies were in the same range:
Sch. pombe DHODH, 0.4 and 1.8 mg; S. kluyveri
DHODH, 1.4 and 1.8 mg (unpublished data). For the
truncated and full-length human DHODH, the yields
Fig. 1. Scheme of dihydroorotate dehydrogenase (DHODH) reaction
with chemical formulae. Electron transfer from dihydroorotate to
FMN and further on to quinone.
Candida albicans dihydroorotate dehydrogenase E. Zameitat et al.
3184 FEBS Journal 273 (2006) 3183–3191 ª 2006 The Authors Journal compilation ª 2006 FEBS
of purified proteins were approximately 10 times
higher [20]. Obviously, truncated forms of the yeast
DHODH were expressed more efficiently than the full-
size enzymes. It was not possible to increase the yield
of full-length DHODH by changing expression condi-
tions (temperature, oxygen supply, induction point and
period of expression) or using more or less Triton
X-100 as nonionic detergent through the purification
protocol (data not shown).
The Western blot in Fig. 3, performed with human
DHODH antibodies, showed cross-reactivity with the
DHODH protein from C. albicans. Cross-reactivity
was also observed with recombinant DHODH from
Arabidopsis thaliana (unpublished data).
The flavin ⁄ protein ratio (mol ⁄ mol) as estimated
from fluorimetric cofactor analyses of the two recom-
binant enzymes was in the range 0.2–0.3 mol flavin per
mol protein.

Kinetic characterization
Activity measurements of CaDHODH and DNCaD-
HODH in various buffers revealed maximum activity
at pH 8.0–8.5. From the characteristic bell-shaped
activity profile, two pK
a
values could be calculated:
pK
a1
, 6.7 ± 0.05 for both enzymes; pK
a2
, 9.5 ± 0.1
for CaDHODH and 9.9 ± 0.15 for DNCaDHODH.
We compared the activity of CaDHODH and
DNCaDHODH with a variety of native and two artifi-
cial electron acceptors. CaDHODH and DNCaD-
HODH could use the artificial acceptors potassium
hexacyanoferrate(III) (FeCy) and 2,6-dichloroindophe-
nol. FeCy was the best electron acceptor. Studies with
different quinone acceptors [2,3-dimethoxy-5-methyl-
1,4-benzoquinone (Q
0
), ubiquinone 30 (Q
6
), ubiquinone
50 (Q
10
), decylubiquinone (Q
D
)] indicated a better

acceptance of the ubiquinone derivative Q
6
than Q
10
,
which is the ubiquinone of most higher eukaryotes
(Table 1). Fumarate and NAD were inadequate elect-
ron acceptors for CaDHODH and DNCaDHODH.
A
B
Fig. 2. Dihydroorotate dehydrogenase (DHODH) amino-acid sequences. (A) Alignment of the N-termini of the recombinantly expressed
C. albicans DHODH and human DHODH (
CLUSTAL W version 1.8). Amino-acid residues that are identical in the human and C. albicans enzyme
are highlighted in black. L11S and L78S mutations are shown in red. Approximate positions of the domain that direct mitochondrial import
and the hydrophobic, putative transmembrane domain are indicated. In addition, the membrane-association motif forming a hydrophobic tun-
nel for the electron acceptor in DHODH is indicated. Numbers refer to amino-acid residues of the C. albicans protein. (B) Alignment of
the catalytic centre of the recombinantly expressed C. albicans DHODH and amino-acid sequences of different DHODH family 2 enzymes
(
CLUSTAL W version 1.8). The highly conserved serine residue is marked in green.
AB
Fig. 3. Recombinant C. albicans dihydroorotate dehydrogenase
(DHODH). (A) SDS ⁄ PAGE. Lanes: M, molecular mass marker; 1,
CaDHODH; 2, DNCaDHODH. 2 lg protein per lane. (B) Western
blot. Lanes: M, molecular mass marker; 1, CaDHODH; 2, DNCaD-
HODH. 1 lg protein per lane.
E. Zameitat et al. Candida albicans dihydroorotate dehydrogenase
FEBS Journal 273 (2006) 3183–3191 ª 2006 The Authors Journal compilation ª 2006 FEBS 3185
However, the presence of atmospheric oxygen seemed to
promote very low DHODH activity, suggesting that
molecular oxygen may be used as a poor electron accep-

tor. The specific activity of the enzymes using Q
D
and
2,6-dichloroindophenol as acceptor was % 6UÆmg
)1
.
K
m
values for 2,6-dichloroindophenol, dihydroorotate
(DHO), and Q
D
for CaDHODH and DNCaDHODH,
respectively, were similar, as were k
cat
values for both
enzyme forms (Table 2).
Inhibition of the recombinant DHODH
Specific inhibitors for yeast DHODH have not yet
been described. We studied the recombinant enzymes
from C. albicans for their susceptibility to various
compounds, which have already been proven to be
inhibitors of human DHODH or DHODH from other
species or compounds implicated in interfering with
electron transport in mitochondria or pyrimidine meta-
bolism [18,21–23]. Only the dianisidine derivative red-
oxal (0.5 mm) exhibited an inhibitory effect of more
than 50% on CaDHODH and DNCaDHODH com-
pared with the noninhibited reaction. As compounds
such as redoxal may have redox activity, we tested it
as a putative direct electron acceptor for the C. albi-

cans DHODH. Redoxal (up to 100 lm) did not pro-
mote oxidation of dihydroorotate to orotate (data not
shown). Also, 1 mm brequinar reduced the activity by
more than 50% of the full-length enzyme (Table 3).
IC
50
values as a practical reflection of the relative
effects of different substances on enzyme activity
under comparable assay and laboratory conditions
were obtained from dose–response curves. The IC
50
for redoxal was 106 ± 12 lm (CaDHODH) and
102 ± 12 lm (DNCaDHODH), respectively; that for
brequinar was 439 ± 83 lm (CaDHODH).
Discussion
The availability and characterization of recombinant
DHODH from C. albicans in this work permitted the
first screening of compounds as putative enzyme inhib-
itors, with the rationale to interfere with the pyrimid-
ine nucleotide pools of this pathogen.
All DHODH proteins of family 2 must be translo-
cated from the cytosol to the inner membrane of mito-
chondria. The proteins are directed by targeting
sequences, which usually consist of various numbers of
amino acids at the N-terminus [24]. Although no con-
sensus sequence has been identified, the pre-sequences
have a high content of basic, hydrophobic and hydrox-
ylated amino acids, and a length of about 10–80 amino
acids. Generally, the pre-sequence is cleaved on
import, as it is not necessary for protein function [25].

The length of the targeting sequence in the C. albicans
DHODH (37 amino acids) would suggest that there
should be a cleavable site. However, in silico studies
(‘PeptideCutter’, could
not identify cleavage sites of known proteases. Mam-
malian DHODHs have a shorter targeting sequence of
Table 1. Alternative electron-accepting substrates for recombinant
C. albicans dihydroorotate dehydrogenase (DHODH). Activities are
expressed relative to that with FeCy as the electron acceptor, and
mean ± SEM from three determinations is given as a percentage.
All reaction mixtures contained molecular oxygen at atmospheric
pressure (equivalent to about 230 l
M)and1mM DHO. DCIP, 2,6-
dichloroindophenol.
Electron acceptor
Relative velocity (%)
CaDHODH DNCaDHODH
FeCy (1 m
M) 100 100
DCIP (1 m
M) 15.2 ± 3.1 31.7 ± 7.9
DCIP + QD (1 m
M +0.1 mM) 40.8 ± 1.7 50.6 ± 3.1
Q
D
(0.1 mM) 28.8 ± 2.3 36.4 ± 2.4
Q
10
(0.1 mM) 8.8 ± 2.5 3.5 ± 0.3
Q

6
(0.1 mM) 83.9 ± 3.8 73.1 ± 2.5
Q
0
(0.1 mM) 16.8 ± 1.8 28.3 ± 3.9
Fumarate (1 m
M) 2.4 ± 0.4 2.0 ± 1.2
NAD (0.1 m
M) 0.2 ± 0.1 0.3 ± 0.1
None 1.5 ± 0.8 1.9 ± 0.2
Table 2. Kinetic constants of the purified full-length and truncated C. albicans dihydroorotate dehydrogenase (DHODH). All measurements
were performed in triplicate. For K
m
and V
max
, the best fit (± asymptotic SEM) of the Michaelis–Menten equation to all data is given. The
k
cat
values were calculated using the equation V
max
¼ k
cat
[E], where [E] is the total enzyme concentration and is based on one active
site ⁄ monomer. U is the enzyme activity as lmol substrateÆmin
)1
.
DHODH
V
max
(UÆmg

)1
)
K
m
a
(lM DHO)
K
m
b
(lM Q
D
)
K
m
c
(lM DCIP)
k
cat
(s
)1
)
k
cat
⁄ K
m
a
(M DHO
)1
Æs
)1

)
k
cat
⁄ K
m
b
(M Q
À 1
D
Æs
)1
)
k
cat
⁄ K
m
c
(M DCIP
)1
Æs
)1
)
Ca 6.0 ± 1 108 ± 12 42 ± 12 122 ± 13 2.1 1.9 · 10
3
5.0 · 10
4
1.7 · 10
3
DNCa 5.6 ± 0.6 111 ± 18 65 ± 22 40 ± 4 2.2 2.0 · 10
3

3.4 · 10
4
5.5 · 10
4
a
The concentration of DHO was varied (0–1.0 mM) at fixed concentrations of 100 lM Q
D
and 60 lM 2,6-dichloroindophenol (DCIP) as elec-
tron acceptors.
b
The concentration of Q
D
was varied (0–0.2 mM) at a fixed DHO concentration of 1 mM.
c
The concentration of DCIP was
varied (0–0.2 m
M) at a fixed DHO concentration of 1 mM.
Candida albicans dihydroorotate dehydrogenase E. Zameitat et al.
3186 FEBS Journal 273 (2006) 3183–3191 ª 2006 The Authors Journal compilation ª 2006 FEBS
only 11–13 amino acids, which was found not to be
cleaved off after import into the inner mitochondrial
membrane [12]. The targeting sequences of yeast
DHODH possess up to 5 times more amino acids [17];
therefore, proteolytic processing may be possible. The
length of the targeting sequence seems to influence the
recombinant expression rate. All yeast DHODHs have
% 40 amino acids in contrast with 10 amino acids in
the human DHODH [17]. A similar observation was
made with the A. thaliana DHODH, which has a tar-
geting sequence of 57 amino acids. The expression rate

of the truncated plant DHODH was higher than that
of the full-size protein [26].
At the N-terminus, the adjoining hydrophobic
region, which was identified as a transmembrane
domain of 17 amino acids in rat DHODH [12], can be
presumed to be a membrane-spanning a-helix. Here,
we were able to predict a transmembrane domain of
16 amino acids with ‘ProtScale’ (asy.
org/tools) in the C. albicans DHODH amino-acid
sequence (Fig. 2).
As the recombinant CaDHODH and DNCaD-
HODH had the same kinetic parameters, the trunca-
tion seemed not to influence the enzyme activity of
yeast DHODH. However, the specific activity of
C. albicans DHODH was considerably lower than that
obtained with recombinant mammalian DHODH
preparations, which were determined using the same
assay (e.g. human enzyme, 100–150 UÆmg
)1
) [20]. In
comparison with human species (K
m
¼ 6–15 lm for
DHO and K
m
¼ 9–14 lm for Q
D
), the K
m
values for

C. albicans DHODH were 10-fold higher. On the other
hand, C. albicans DHODH was very similar to other
yeast DHODHs with regard to its kinetic properties.
Higher K
m
values for Q
D
were described for full-length
S. kluyveri and Sch. pombe DHODH [17] compared
with the truncated forms.
Two a-helices after the hydrophobic domain at the
N-terminus were predicted by structural alignment
using ‘Swiss-PdbViewer 3.7’ comparing the structures
of human (RCSB PDB-ID, 1D3G) and E. coli (RCSB
PDB-ID, 1F78) with the amino-acid sequence of
C. albicans DHODH (data not shown). They are sim-
ilar to those of human DHODH and are thought to
be essential for membrane association and for facilita-
ting the contact between the ubiquinone from the inner
membrane and the active site of DHODH [23,27].
Although there are some differences in processing and
association in the organization of the fungal and mam-
malian respiratory chain complexes, the assembly
ensures the transfer of electrons from different sources
to oxygen by the respiratory chain complexes and the
coupling of proton uptake from the matrix compart-
ment [28].
The nature of the quinone in C. albicans is not
known. In this study, recombinant C. albicans
DHODH was shown to use several native and two

artificial electron acceptors, FeCy and 2,6-dichloroin-
dophenol. Q
6
, which has been described as a physiolo-
gical electron acceptor in the respiratory chain of
S. cerevisiae [29], was found to be superior to all the
other quinones studied here. Fumarate and NAD
+
,
the physiological acceptors for DHODH of family 1A
and 1B, respectively, were not acceptors for C. albicans
DHODH. This provides functional evidence, addi-
tional to its sequence similarity and catalytic-site
Table 3. Activity of recombinant C. albicans dihydroorotate dehy-
drogenase (DHODH) in the presence of putative inhibitors. Relative
velocities determined in chromogen reduction assays with 1 m
M
DHO, 0.1 mM Q
D
and 0.1 mM 2,6-dichloroindophenol (DCIP) as final
electron acceptor are given. Values are mean ± SEM from three
determinations. The activity of each enzyme without inhibitor was
set as 100%. If not otherwise stated the concentration of the com-
pound was 1 m
M. TTFA, 2-thenoyltrifluoroacetone.
Compound
Relative velocity (%)
CaDHODH DNCaDHODH
Control with dimethyl sulfoxide 100 100
Control with buffer 100 100

3,4-Dihydroxybenzoic acid 98 ± 3 95 ± 2
3,5-Dihydroxybenzoic acid 98 ± 2 98 ± 1
5-Fluorocytosine 108 ± 5 99 ± 10
5-Fluoroorotate 93 ± 6 101 ± 5
5-Fluorouracil 105 ± 7 103 ± 5
A77-1726 98 ± 17 84 ± 8
Acetylsalicylic acid 67 ± 12 104 ± 11
Alloxan (10 m
M)89±9103±6
Amytal 57 ± 14 103 ± 22
Antimycin A (0.5 m
M)53±356±3(1mM)
Atovaquone (0.5 m
M) 106 ± 13 93 ± 5
Brequinar 44 ± 1 80 ± 3
Carboxin 87 ± 2 102 ± 5
Ciprofloxacin 99 ± 4 101 ± 12
Clindamycin 98 ± 4 105 ± 4
Dichloroallyllawson 50 ± 12 58 ± 1
Ectosin 90 ± 12 93 ± 9
Lawson 69 ± 11 95 ± 26
Licochalcone A (0.5 m
M) 100 ± 25 100 ± 5
Menadione 86 ± 17 122 ± 6
Polyporic acid 87 ± 11 87 ± 8
Redoxal 5 ± 3 6 ± 5
Redoxal (0.5 m
M) 25 ± 15 25 ± 21
Salicylhydroxamic acid 97 ± 14 99 ± 5
Salicylic acid 94 ± 17 90 ± 10

4-Trifluoromethylaniline 91 ± 15 100 ± 20
Toltrazuril 96 ± 6 103 ± 9
Tournaire acid 3 (2.5 m
M)98±2107±5
TTFA (2 m
M) 101 ± 10 115 ± 1
E. Zameitat et al. Candida albicans dihydroorotate dehydrogenase
FEBS Journal 273 (2006) 3183–3191 ª 2006 The Authors Journal compilation ª 2006 FEBS 3187
features, that C.albicans DHODH belongs to the
DHODH family 2 enzymes (Fig. 2).
The respiratory chain complexes of fungi have been
shown to be inhibited by standard agents, e.g. rote-
none, myxothiazol, antimycin A, and CN
–
, extensively
used to assay animal mitochondria [30]. In contrast
with this high conservation of sensitivity, drugs that
have been shown to suppress DHODH activity both
in vitro and in vivo were found here not to interfere
with the DHODH of C. albicans, e.g. A77-1726, ato-
vaquone, and licochalcone A. Some of these drugs
(Table 3) are in clinical use today: the antirheumatic
drug leflunomide ⁄ A771726 (Arava
TM
) [31], the antima-
larial drug atovaquone (Malarone
TM
) [22], and the
anticoccidial toltrazuril (Baycox
TM

) [21]. The develop-
ment of effective compounds against Plasmodium falci-
parum and Pneumocystis carinii took advantage of
species-specific differences between DHODH from
family 2. By structure–activity relationship studies,
some of these drugs have been shown to interfere with
the ubiquinone-binding site of mammal DHODH
[23,32] but not with that of E. coli [27]. Detailed kin-
etic investigations of the bisubstrate reaction catalyzed
by full-length rat DHODH revealed a noncompetitive
type of inhibition by brequinar with respect to the co-
substrate Q
D
[33]. LicA was described as a potent
inhibitor of E. coli DHODH, but it affected neither
DHODH-1A and 1B from Lactococcus lactis (M. Han-
sen, University of Copenhagen, personal communica-
tion) nor human DHODH (unpublished data).
Structural alignment using Swiss-PdbViewer 3.7 to
compare the structures of human and E. coli DHODH
[23,27] and the amino-acid sequence of C. albicans
DHODH showed considerable differences between the
inhibitor-binding sites (data not shown). Mainly,
hydrophobic interactions, which are important for the
binding of A771726 and brequinar, were reduced. In
the structural alignment, we found hydrophobic amino
acids, which are important for inhibitor binding,
replaced with smaller or larger residues. This may
explain the difference in binding of these drugs by the
fungal and animal DHODH and again highlights

DHODH as a very species-specific target for potential
intervention and drug discovery.
In this study, considerable interference was observed
in the oxidation of DHO with Q
D
by redoxal. The
IC
50
value of % 100 lm is higher for the fungal enzyme
than for the human (IC
50
¼ 368 nm) and rat (IC
50
¼
214 nm) enzyme [34]. Interestingly, the distinct species-
related efficacy of inhibition of the human and rodent
enzyme observed with isoxazol, cinchoninic acid and
naphthoquinone derivatives seemed to be less obvious
with redoxal. It was concluded that the binding of
o-dianisidines may be divergent from that of the other
classes [34]. As redoxal was superior to all the other
compounds tested here in inhibiting fungi DHODH, it
can be considered an attractive lead for the synthesis
of molecules with higher activity. The high-resolution
X-ray crystallographic structure of C. albicans
DHODH in complex with an o-dianisidine derivative
will be necessary to understand the mode of binding
and interference with enzyme catalysis.
As the inactivation of any enzyme involved in a
metabolic chain will render the whole chain inoperat-

ive, the inactivation of any of the six proteins
involved in pyrimidine de novo synthesis should result
in the same profound effect on the pyrimidine nuc-
leotide pools in C. albicans. However, in mammalian
cell lines, the development of drug resistance was
observed with other agents and other enzymes of the
de novo pathway to a much greater degree than with
DHODH [35]. Therefore, it is reasonable to assume
that the overexpression and proper location of an
integral membrane protein would happen to a limited
extent only. Thus DHODH rather than a cytosolic
enzyme of pyrimidine biosynthesis should be the
preferential target for drug development. The availab-
ility of recombinant DHODH should expedite discov-
ery of more potent agents for growth control
strategies in C. albicans, and permit the screening of
a large number of compounds, the examination of
structure–activity relationships of inhibitors, and
determination of the 3D structure of enzyme–inhib-
itor complexes.
Experimental procedures
Reagents
Unless otherwise stated, the following chemicals were from
Roche Diagnostics (Mannheim, Germany), Serva (Heidel-
berg, Germany), Merck (Darmstadt, Germany) or Sigma
(Sigma-Aldrich, Taufkirchen, Germany) at the purest grade
available: anhydrotetracycline (Acros Organics, Geel, Bel-
gium), DHO, dimethyl sulfoxide, Q
D
,Q

0
,Q
6
,Q
10
, FeCy,
fumarate, NAD, 2,6-dichloroindophenol.
The inhibitors studied were: 2-hydroxyethylidene-cyano-
acetic acid 4-trifluoromethyl anilide (A77-1726; Sanoif-
Aventis, Frankfurt, Germany); trans-2-[4-(chlorophenyl)-
cyclohexyl]-3-hydroxy-1,4-naphthoquinone (atovaquone,
566C80; Wellcome Foundation, Dartford, UK); 6-fluoro-2-
(2¢-fluoro-1,1¢-biphenyl-4yl)-3-me thyl-4-quinoline carboxy-
lic acid (brequinar sodium, NSC 368390; DuPont Pharma
GmbH, Bad Homburg, Germany); licochalcone A [36];
acetylsalicylic acid; alloxan; antimycin A; 3,4 dihydroxy-
benzoic acid; 3,5 dihydroxybenzoic acid; 5-fluorouracil;
Candida albicans dihydroorotate dehydrogenase E. Zameitat et al.
3188 FEBS Journal 273 (2006) 3183–3191 ª 2006 The Authors Journal compilation ª 2006 FEBS
5-fluoroorotate; 5-fluorocytosine; 2-methyl-1,4-naphthoqui-
none; menadione; salicylic acid; salicylhydroxamic acid
(Sigma); amytal (Serva); ciprofloxacin; toltrazuril (Bayer
AG, Leverkusen, Germany); clindamycin; carboxin; ectosin
(Fluka, Buchs, Switzerland); redoxal (NCI 73735) [35]; di-
chloroallyllawson (NIH Drug Synthesis and Chemistry
Branch, Development Therapeutics Program, Division of
Cancer Treatment, Bethseda, MD, USA); lawson (Aldrich);
polyporic acid (Langner, University of Halle, Germany);
4-trifluoromethylaniline (Chemos GmbH, Regenstrauf,
Germany); tournaire acid 3 [37].

Oligonucleotides
ZGCaURA1–5¢, ATGTTTCGTCCAAGTATCAAAT
TC
ZGCaURA1–3¢, TCACTTATCATCAGAGCC
Ca-forlong2, ATGTTTCGTCCAAGTATCAAATTC
AAACAGTCGACTTTGTCC
CaKDHODH-mutfor1, CACAGATGCAGAGTCGG
GACATAAGTTGGGGGTT
CaKDHODH-mutrev1, CCAACTTATGTCCCGACT
CTGCATCTGTGAAAGT
CaDHODH-rev, CCGGAATTCCTTATCATCAGAG
CCAATTAT
Ca-BamHI-for, GCGGATCCCGAATGTTTCGTCC
AAGTATCAAATTCAAACAGTCG
Cak-BamHI-for, GCGGATCCCGAATGTCAAGAT
CAGCAATCCATGAATATGTTTTGTGC
CaDHODH-rev3, CCGGAATTCTCACTTATCATC
AGAGCCAATTATTTGCTCCCATG
Expression plasmids
The C. albicans URA1 gene (accession number AY230865)
was subcloned with the oligonucleotides ZGCaURA1–5¢
and ZGCaURA1–3¢. The 1335-bp ORF was then amplified
from the URA1 PCR fragment with primers Ca-forlong2
and CaDHODH-rev. Mutations were inserted by PCR with
primers Ca-forlong2 and CaKDHODH-mutrev1 for a first
fragment and with primers CaKDHODH-mutfor1 and
CaDHODH-rev for a second fragment. The overlapping
PCR fragments were then used as templates for PCR with
primers Ca-forlong2 and CaDHODH-rev. For subcloning
of the DHODH ORF the restriction sides for BamHI ⁄

EcoRI were created with primers Ca-BamHI-for and
CaDHODH-rev3 for full-length C. albicans DHODH. The
resulting PCR fragment was cut by BamHI ⁄ EcoRI and sub-
sequently ligated into pGEX-6P-3, cut by BamHI ⁄ EcoRI.
The resulting plasmid was named pGEX-6P-3-CaDHODH,
and the recombinant expressed enzyme is referred to as
CaDHODH. A 55-amino acid N-terminal truncated form
of C. albicans DHODH was constructed using CaK-Bam-
HI-for and CaDHODH-rev, cut by BamHI ⁄ EcoRI and
subsequently ligated into corresponding sites of pGEX-6P-
3. The resulting plasmid was named pGEX-6P-3-DNCaD-
HODH, and the recombinant expressed enzyme is referred to
as DNCaDHODH .
Protein expression and purification
All recombinant DHODHs were expressed as fusion pro-
teins containing an N-terminal glutathione S-transferase
(GST) tag. The proteins were expressed in the E. coli strain
BL21 for 24 h at 18 °C after induction (A
600
¼ 0.5–0.6)
with 1 mm isopropyl b-d-thiogalactoside in Luria–Bertani
broth ⁄ ampicillin (100 lgÆmL
)1
) medium plus 0.1 mm FMN.
For purification of the recombinant proteins, the cells were
harvested at 4000 g for 15 min, resuspended in binding buf-
fer (140 mm NaCl, 2.7 mm KCl, 0.1 mm FMN, 10 mm
Na
2
HPO

4
, 1.8 mm KH
2
PO
4
, 1% Triton X-100, pH 7.3),
and disrupted by sonification. After centrifugation for
60 min at 15 000 g, the supernatant was applied to a 1-mL
GSTrapTM FF column (Amersham Biosciences Europe,
Freiburg, Germany). The column was washed with 10 vol.
binding buffer and 10 vol. pre-scission buffer (50 mm
Tris ⁄ HCl, 150 mm NaCl, 1 mm EDTA, 1 mm dithiothrei-
tol, 1% Triton X-100, pH 7). The recombinant proteins
were cut by pre-scission protease (Amersham Biosciences)
at 4 °C overnight. The recombinant proteins without GST
tag were eluted with 5 vol. pre-scission buffer. The
exchange to buffer C [50 mm Tris ⁄ HCl, 150 mm KCl, 10%
(v ⁄ v) glycerol, 0.1% (v ⁄ v) Triton X-100, pH 8] was per-
formed using a PD-10 column (Amersham Biosciences).
Protein determination and SDS ⁄ PAGE were performed as
described previously [17]. For fluorimetric determination of
flavin, 0.5–0.7 lgÆmL
)1
protein was denatured by heating
up to 100 °C for 10 min. After being allowed to cool, the
solution was centrifuged and protected from light until
measurement using a spectrofluorimeter (SFM 25, Bio-Tek
Instruments, Bad Friedrichshall, Germany) at excita-
tion ⁄ emission wavelengths of 465 ⁄ 518 nm, with FMN as
standard marker (0–100 lm).

Immunological methods
Before immunodetection, recombinant C. albicans DHODH
from SDS ⁄ PAGE was transferred on to Immobilon P (Milli-
pore, Schwalbach, Germany) by semidry blotting (1.5 h at
0.8 mAÆcm
)2
; SDS ⁄ polyacrylamide gel). After being blocked
with 5% nonfat dried milk in 10 mm sodium phosphate buf-
fer, pH 7.5, containing 150 mm NaCl, the membrane was
exposed to affinity-purified rabbit antibodies to human
DHODH (diluted 1 : 15000) [38]. As secondary antibodies,
goat anti-rabbit horseradish peroxidase-conjugated IgG
(Sigma), diluted 1 : 10 000, were used. Bound antibodies
were detected with an ECL detection kit (Amersham Bio-
sciences).
E. Zameitat et al. Candida albicans dihydroorotate dehydrogenase
FEBS Journal 273 (2006) 3183–3191 ª 2006 The Authors Journal compilation ª 2006 FEBS 3189
Biochemical analysis of DHODH
The assay to determine enzyme activity and kinetic parame-
ters was performed in 50 mm Tris ⁄ HCl, 150 mm KCl, 10%
(v ⁄ v) glycerol, 0.1% (v ⁄ v) Triton X-100, pH 8 [18]. At 30 °C,
the oxidation of the substrate DHO with the quinone cosub-
strate was coupled to the reduction of the chromogen 2,6-di-
chloroindophenol. The K
m
of DHO was determined by
varying the concentration of DHO (1–1000 lm) at a fixed
concentration (200 lm)ofQ
D
. The K

m
of Q
D
was determined
by varying the concentration of Q
D
(0.1–200 lm) at a fixed
concentration (1 m m) of DHO. The additional K
m
value for
2,6-dichloroindophenol (0.01–200 lm) was determined using
the same assay but without Q
D
. Kinetic data were evaluated
under initial velocity conditions [33]; the Michaelis–Menten
equation v ¼ V[S] ⁄ (K
m
+ [S]) was fitted to all data.
The pH-dependence of initial velocities was measured at
saturating substrate concentrations (1 mm DHO, 0.1 mm
Q
D
) in different buffer systems (Mes ⁄ HCl, Hepes ⁄ HCl,
Tris ⁄ HCl) covering the pH range 5–9, using the chromogen
reduction assay with 2,6-dichloroindophenol as final elec-
tron acceptor. Overlapping pH ranges were measured in
two buffer systems to exclude salt effects. The equation
v ¼ V ⁄ [(10
–pH
⁄ 10

–pKa1
) + (10
–pKa2
⁄ 10
–pH
) +1] was fitted
to the data.
Various natural and artificial electron acceptors were
compared in the optimal Tris ⁄ HCl buffer system at
pH 8.0. Reduction of the electron acceptors was measured at
the indicated wavelength: 2,6-dichloroindophenol (600 nm,
e ¼ 18800 m
)1
Æcm
)1
), FeCy (420 nm, e ¼ 1020 m
)1
Æcm
)1
),
NAD
+
(340 nm, 6200 m
)1
Æcm
)1
). In an alternative
assay, UV absorption of the product orotate was monit-
ored in the presence of the electron acceptor fumarate
(280 nm, e ¼ 7500 m

)1
Æcm
)1
) or oxygen only (280 nm, e ¼
7500 m
)1
Æcm
)1
), and at the appropriate isosbestic wave-
length, with Q
D
(300 nm, e ¼ 2950 m
)1
Æcm-
1
), Q
10
(300 nm,
e ¼ 2950 m
)1
Æcm
)1
), Q
6
(293 nm, e ¼ 4700 m
)1
Æcm
)1
), Q
0

(287 nm, e ¼ 5680 m
)1
Æcm
)1
), respectively.
To determine the inhibitory potency of 28 different com-
pounds, the chromogen reduction assay was used with the
putative inhibitor up to a concentration of 1 mm as des-
cribed above. Stock solutions of all inhibitors were prepared
freshly in Tris ⁄ HCl buffer, pH 8.0, or in dimethyl sulfoxide.
The appropriate controls were run in buffer or in the pres-
ence of dimethyl sulfoxide; 2% dimethyl sulfoxide in the
assays was found not to interfere with the DHODH activity.
All measurements were performed in triplicate. Percentage
of inhibition was related to controls (100% activity).
To determine the IC
50
values for redoxal and breqinar,
the initial velocity of the DHODH reaction was measured
at saturating substrate concentrations of DHO (1 mm) and
Q
D
(0.1 mm) with various concentrations of the putative
inhibitors (redoxal, 1 lm)1mm; brequinar, 1 lm)8mm).
The equation v ¼ V ⁄ {1 + [I] ⁄ IC
50
}, where [I] is the inhib-
itor concentration, was fitted to the initial velocities to find
the drug concentration causing 50% inhibition of the
enzyme activity (IC

50
value).
Acknowledgements
This study was supported by the Deutsche Fors-
chungsgemeinschaft, Marburger Graduiertenkolleg
‘Protein Function at the Atomic Level’ to ML and by
the Danish Research Council to JP. We thank Maria-
Bettina Kowalski and Ute Beck for technical assist-
ance.
References
1 Whiteway M & Oberholzer U (2003) Candida morpho-
genesis and host–pathogen interactions. Curr Microbiol
7, 350–357.
2Lo
¨
ffler J & Stevens DA (2003) Antifungal drug resis-
tance. Clin Infect Dis 36, 31–41.
3 Sanglar D & Odds FC (2002) Resistance of Candida
species to antifungal agents: molecular mechanisms and
clinical consequences. Lancet Infect Dis 2, 73–85.
4 Prasad R & Kapoor K (2005) Multidrug resistance in
yeast Candida. Int Rev Cytol 242, 215–248.
5 Hope WW, Taberno L, Denning DW & Anderson MJ
(2004) Molecular mechanisms of primary resistance to
flucytosine in Candida albicans. Antimicrob Agents
Chemother 48, 4377–4386.
6Lo
¨
ffler M, Fairbanks L, Zameitat E, Marinaki T &
Simmonds HA (2005) Pyrimidine pathways in health

and disease. Trends Mol Med 11, 430–437.
7 Rao TVG, Verme RS & Prasad R (1983) Transport of
purine, pyrimidine bases and nucleosides in Candida
albicans, a pathogenic yeast. Biochem Int 6, 409–417.
8 Knecht W & Lo
¨
ffler M (1998) Species-related inhibition
of human and rat dihydroorotate dehydrogenase by
immunosuppressive isoxazol and cinchoninic acid deri-
vatives. Biochem Pharmacol 56, 1259–1264.
9 Christopherson RI, Lyons SD & Wilson PK (2002)
Inhibitors of de novo nucleotide biosynthesis as drugs.
Acc Chem Res 35, 961–971.
10 Jones ME (1980) Pyrimidine nucleotide biosynthesis in
animals: gene, enzymes and regulation of UMP biosyn-
thesis. Annu Rev Biochem 49, 253–279.
11 Nara T, Hshimoto T & Aoki T (2000) Evolutionary
implications of the mosaic pyrimidine-biosynthetic path-
way in eurkayotes. Gene 257, 209–222.
12 Rawls J, Knecht W, Diekert K, Lill R & Lo
¨
ffler M
(2000) Requirements for the mitochondrial import and
localization of dihydroorotate dehydrogenase. Eur J
Biochem 267, 2079–2087.
13 Blattmann P & Retey J (1972) Stereospecificity of the
dihydroorotate-dehydrogenase reaction. Eur J Biochem
30, 130–137.
Candida albicans dihydroorotate dehydrogenase E. Zameitat et al.
3190 FEBS Journal 273 (2006) 3183–3191 ª 2006 The Authors Journal compilation ª 2006 FEBS

14 Mohsen AA, Rigby SEJ, Jensen KF, Munro AW &
Scrutton NS (2004) Thermodynamic basis of electron
transfer in dihydroorotate dehydrogenase B from
Lactococcus lactis: analysis by potentiometry, EPR
spectroscopy and ENDOR spectroscopy. Biochemistry
43, 6498–6510.
15 Nagy M, Lacroute F & Thomas D (1992) Divergent
evolution of pyrimidine biosynthesis between anaerobic
and aerobic yeast. Proc Natl Acad Sci USA 89, 8966–
8970.
16 Gojkovic
´
Z, Knecht W, Zameitat E, Warneboldt J,
Coutelis JB, Pynyaha Y, Neuveglise C, Møller K, Lo
¨
f-
fler M & Pis
ˇ
kur J (2004) Horizontal gene transfer pro-
moted evolution of the ability to propagate under
anaerobic conditions in yeasts. Mol Genet Genomics
271, 387–393.
17 Zameitat E, Knecht W, Pis
ˇ
kur J & Lo
¨
ffler M (2004)
Two different dihydroorotate dehydrogenases from
yeast Saccharomyces kluyveri. FEBS Lett 568, 129–134.
18 Knecht W, Bergjohann U, Gonski S, Kirschbaum B &

Lo
¨
ffler M (1996) Functional expression of a fragment of
human dihydroorotate dehydrogenase by means of the
baculovirus expression system, and kinetic investigation
of the purified recombinant enzyme. Eur J Biochem 240,
292–301.
19 Santos MAS, Keith G & Tuite MF (1993) Non-stan-
dard translational events in Candida abicans mediated
by an unusual seryl-tRNA with a 5¢-CAG-3¢ (leucine)
anticodon. EMBO J 12, 607–617.
20 Bader B, Knecht W, Fries M & Lo
¨
ffler M (1998)
Expression, purification, and characterization of histi-
dine-tagged rat and human flavoenzyme dihydroorotate
dehydrogenase. Protein Expr Purif 13, 414–422.
21 Haberkorn A (1996) Chemotherapy of human and ani-
mal coccidiosis: state and perspectives. Parasitol Res 82,
193–199.
22 Olliaro P & Wirth D (1997) New targets for antimalar-
ial drug discovery. J Pharm Pharmacol 49, 29–33.
23 Liu S, Neidhardt EA, Grossman TH, Ocain T & Clardy
J (2000) Structures of human dihydroorotate dehydro-
genase in complex with antiproliferative agents. Struc-
ture 8, 25–33.
24 Schatz G & Dobberstein B (1996) Common principles
of protein translocation across membranes. Science 271,
1519–1526.
25 Truscott KN, Brandner K & Pfanner N (2003) Mechan-

isms of protein import into mitochondria. Curr Biol 13,
R326–R337.
26 Ullrich A, Knecht W, Fries M & Lo
¨
ffler M (2001)
Recombinant expression of N-terminal truncated
mutants of the membrane bound mouse, rat and human
flavoenzyme dihydroorotate dehydrogenase. A versatile
tool to rate inhibitor effects? Eur J Biochem 268, 1861–
1868.
27 Nørager S, Jensen KF, Bjo
¨
rnberg O & Larsen S (2002)
E. coli dihydroorotate dehydrogenase reveals structural
and functional distinctions between different classes of
dihydroorotate dehydrogenase. Structure 10, 1211–1223.
28 Joseph-Horne T, Hollomon DW & Wood PM (2001)
Fungal respiration: a fusion of standard and alternative
components. Biochim Biophys Acta 1504, 179–195.
29 Tsai AL, Olsen JS & Palmer G (1987) The kinetics of
reoxidation of yeast complex III. J Biol Chem 262,
8677–8684.
30 Helmerhorst EJ, Murphy MP, Troxler RF & Oppen-
heim FG (2002) Characterization of the mitochondrial
respiratory pathways in Candida albicans. Biochim Bio-
phys Acta 1556, 73–80.
31 Herrmann M, Schleyerbach R & Kirschbaum BJ (2000)
Leflunomide: an immunomodulatory drug for the treat-
ment of rheumatoid arthritis and other autoimmune dis-
eases. Immunopharmacology 47, 273–289.

32 Hansen M, LeNours J, Johansson E, Antal T, Ullrich
A, Lo
¨
ffler M & Larsen S (2004) Inhibitior binding in a
class 2 dihydroorotate dehydrogenase causes variations
in the membrane-associated N-terminal domain. Protein
Sci 13, 1031–1042.
33 Knecht W, Henseling J & Lo
¨
ffler M (2000) Kinetics of
inhibition of human and rat dihydroorotate dehydro-
genase by atovaquone, lawsone derivatives, brequinar
sodium and polyporic acid. Chem Biol Interact 124,
61–76.
34 Knecht W & Lo
¨
ffler M (2000) Redoxal as a new lead
structure for dihydroorotate dehydrogenase inhibitors: a
kinetic study of the inhibition mechanism. FEBS Lett
467, 27–30.
35 Lo
¨
ffler M, Klein A, Hayek-Ouassini M, Knecht W &
Konrad L (2004) Dihydroorotate dehydrogenase
mRNA and protein expression analysis in normal and
drug-resistant cells. Nucleosides, Nucleotides, Nucleic
Acids 23, 1281–1285.
36 Chen M, Christensen SB, Blom J, Lemmich E, Nadel-
mann L, Fich K, Theander TG & Kharazmi A (1993)
Licochalcone A, a novel antiparasitic agent with potent

activity against human pathogenic protozoan species of
Leishmania. Antimicrob Agents Chemother 37, 2550–
2556.
37 Tournaire C, Caujolle R, Payard M, Commenges G,
Bessie
`
res MH, Bories C, Loiseau P & Gayral P (1996)
Synthesis and protozoocidal activities of quinones. Eur
J Med Chem 31, 507–511.
38 Dietz C, Hinsch E & Lo
¨
ffler M (2000) Immunocytochem-
ical detection of mitochondrial dihydroorotate dehydro-
genase in human spermatozoa. Int J Androl 23, 294–299.
E. Zameitat et al. Candida albicans dihydroorotate dehydrogenase
FEBS Journal 273 (2006) 3183–3191 ª 2006 The Authors Journal compilation ª 2006 FEBS 3191