Báo cáo khoa học: Isocitrate dehydrogenase of Plasmodium falciparum Energy metabolism or redox control? doc

Isocitrate dehydrogenase of
Plasmodium falciparum
Energy metabolism or redox control?
Carsten Wrenger and Sylke Mu¨ ller
Division of Biological Chemistry and Molecular Microbiology, School of Life Sciences, University of Dundee, UK
Erythrocytic stages of the malaria parasite Plasmodium fal-
ciparum rely on glycolysis for their energy supply and it is
unclear whether they obtain energy via mitochondrial res-
piration albeit enzymes of the tricarboxylic acid (TCA) cycle
appear to be expressed in these parasite stages. Isocitrate
dehydrogenase (ICDH) is either an integral part of the
mitochondrial TCA cycle or is involved in providing
NADPH for reductive reactions in the cell. The gene enco-
ding P. falciparum ICDH was cloned and analysis of the
deduced amino-acid sequence revealed that it possesses a
putative mitochondrial targeting sequence. The protein is
very similar to NADP
+
-dependent mitochondrial counter-
parts of higher eukaryotes but not Escherichia coli. Expres-
sion of full-length ICDH generated recombinant protein
exclusively expressed in inclusion bodies but the removal of
27 N-terminal amino acids yielded appreciable amounts of
soluble ICDH consistent with the prediction that these res-
idues confer targeting of the native protein to the parasites’
mitochondrion. Recombinant ICDH forms homodimers of
90 kDa and its activity is dependent on the bivalent metal
ions Mg
2+
or Mn
2+

with apparent K
m
values of 13 l
M
and
22 l
M
, respectively. Plasmodium ICDH requires NADP
+
as
cofactor and no activity with NAD
+
was detectable; the
K
app
m
for NADP
+
was found to be 90 l
M
and that of
D
-isocitrate was determined to be 40 l
M
. Incubation of
P. falciparum under exogenous oxidative stress resulted in
an up-regulation of ICDH mRNA and protein levels indi-
cating that the enzyme is involved in mitochondrial redox
control rather than energy metabolism of the parasites.
Keywords: isocitrate dehydrogenase; redox control; mito-

chondrion; malaria; energy metabolism; oxidative stress.
Isocitrate dehydrogenase (ICDH) occurs in multiple iso-
forms in eukaryotes, whereas Escherichia coli possesses a
single NADP
+
-dependent ICDH [1–4]. The eukaryotic
enzymes are not only structurally distinct but they also rely
on different cofactors for catalysis and are localized in
different compartments of the cell [5–8]. The reaction of
ICDH generates NAD(P)H and 2-oxoglutarate. The latter
is shuttled either into the tricarboxylic acid cycle (TCA
cycle) or is metabolized to glutamate, depending on the
localization of the respective isoform of ICDH. NAD
+
-
dependent ICDH are localized in the mitochondria and are
an essential part of the TCA cycle [3,6]. They form octamers
consisting of three different subunits [3,9] and are allosteri-
cally responsive to the energy charge (adenine nucleotides
andNADH)ofthecell[10].NADP
+
-dependent ICDH
have been found in mitochondria, cytosol and peroxisomes.
They generally are homodimers and their physiological role
is less well understood. It is believed that they are important
to provide NADPH essential for reductive reactions such as
lipid biosynthesis and reduction of hydroperoxides [11–14].
Plasmodium falciparum is the causative agent of malaria
tropica, one of the most devastating tropical diseases. The
parasites go through a complex life cycle and the erythro-

cytic stages of P. falciparum are responsible for the patho-
logy in humans. In order to survive the pro-oxidant
environment within the human erythrocytes, the parasites
possess efficient antioxidant and redox systems such as the
glutathione and thioredoxin cycles [15–18]. Both redox
systems require NADPH, which usually is provided by
the pentose phosphate shunt via glucose-6-phosphate
dehydrogenase. This enzyme is present in P. falciparum
but its activity was found to be low and is probably not the
major source of NADPH in the parasites [19]. It was
postulated that in P. falciparum NADPH is mainly provi-
ded by glutamate dehydrogenase and potentially a
NADP
+
-dependent ICDH [19–21]. ICDH from P. falcipa-
rum was partially purified previously and some of its
characteristics were determined but the physiological rele-
vance of the enzyme was not entirely understood because
the source of isocitrate appeared to be unknown [19].
However, recently a gene encoding for an aconitase-like
protein was isolated from the parasites possibly providing
the substrate for P. falciparum ICDH [22].
It is well established, that the erythrocytic stages of the
malaria parasite rely mainly on glycolysis for their energy
supply rather than on mitochondrial respiration [23,24].
However, the release of the entire P. falciparum genome
sequence revealed that the parasites possess the genes for the
enzymes involved in the TCA cycle [25] but whether this
route of energy metabolism is essential for the erythrocytic
stages of the parasites remains unclear. As no homologous

genes for an NAD
+
-dependent ICDH could be identified
Correspondence to S. Mu
¨
ller, Division of Biological Chemistry and
Molecular Microbiology, School of Life Sciences, University of
Dundee, Dundee DD1 5EH, UK.
Fax: + 44 1382 345764, Tel.: + 44 1382 345760,
E-mail:
Abbreviations: ICDH, isocitrate dehydrogenase; ICDH-1, full length
ICDH of P. falciparum; ICDH-2, truncated ICDH of P. falciparum;
SOD, superoxide dismutase; TCA cycle, tricarboxylic acid cycle.
(Received 11 December 2002, revised 17 February 2003,
accepted 25 February 2003)
Eur. J. Biochem. 270, 1775–1783 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03536.x
in the parasite genome it is possible that NADP
+
-dependent
ICDH in P. falciparum is involved in both, energy metabo-
lism and redox control. In this study we have cloned and
recombinantly expressed ICDH of P. falciparum,estab-
lished its biochemical characteristics and propose a possible
function for the parasite enzyme.
Materials and methods
Materials
Cloning vectors pASK-IBA 7 and pASK-IBA 3, Strep-
Tactin–Sepharose, anhydrotetracycline and desthiobiotine
were from IBA, Go
¨

ttingen, Germany. Oligonucleotides
were from Hybaid, UK. Enhanced Avian HS RT-PCR-20
kit was purchased from, Sigma, UK. [a-
32
P]dATP
(6000 CiÆmmol
)1
) was from Amersham, UK.
Cloning of
P. falciparum
ICDH
The ICDH sequence was identified on chromosome 13 of
P. falciparum using the human ICDH sequence (accession
no. P48735) for a
TBLASTN
search of the PlasmoDB
database (). After we identified
the gene, the Plasmodium genome consortium published the
identical sequence under accession numbers CAD 52580
and NP_705343 [26]. According to nucleotide and deduced
amino-acid sequences there are no introns within the ICDH
gene so that the full-length gene was amplified by PCR using
genomic DNA as a template. In order to verify this
prediction, a reverse transcriptase PCR was also performed
to isolate the cDNA encoding ICDH. Using the specific
oligonucleotides (sense 5¢-GCGCGCGGTCTCCGCGCA
TGGGAAAGCATATACGAATTTTAAAAAATCAAT
ACC-3¢ and antisense 5¢-GCGCGCGGTCTCTATCA
TTATGTTGAATGTTCTTGGGGAGC-3¢) containing
BsaI restriction sites and Pfu polymerase (Stratgene), ICDH

was amplified from both templates using the following PCR
protocol: 3 min at 95 °C for 1 cycle followed by 35 cycles of
1 min at 95 °C, 1.5 min at 42 °C and 4 min at 60 °C. The
approximately 1.4 kb PCR fragment, designated ICDH-1
was digested with BsaI and subcloned into pASK-IBA-7
previously digested with the same enzyme. The expression
plasmid possesses an N-terminal Strep-tag that allows one-
step purification of recombinant protein via Strep-Tactin–
Sepharose that specifically binds the recombinant fusion
protein [27]. An N-terminal truncated version (residue 82–
1404) of P. falciparum ICDH was amplified using the
sequence specific oligonucleotides sense 5¢-GCGCGCG
GTCTCGAATGAACATATGCGGTAAAATTAACGT
AG-3¢ and antisense 5¢-GCGCGCGGTCTCAGCGCT
TGTTGAATGTTCTTGGGGAGC-3¢ containing BsaI
restriction sites and ICDH-1 as a template and the following
PCR programme: 3 min at 95 °C for 1 cycle followed by 35
cycles of 1 min 95 °C, 1.5 min 42 °Cand4min68°C. The
truncated 1.32 kb PCR fragment was designated ICDH-2
and was subcloned into pASK-IBA 3, an expression
plasmid conferring recombinant expression of the protein
with a C-terminal Strep-tag [28]. The nucleotide sequences
of all PCR fragments and clones were determined by
automated nucleotide sequencing using the automatic
sequencer ABI 377 (Bio-Rad). Nucleotide and amino-acid
analyses were performed using Vector NTI (Informax) or
Generunner.
Expression and purification of ICDH
ICDH-1 and ICDH-2 were transformed into E. coli BLR
(DE3) (Novagen) and a single colony of each was used to

set up an overnight culture in Luria–Bertani medium
containing 50 lgÆmL
)1
ampicillin. The overnight cultures
were diluted 1 : 50 into fresh Luria–Bertani medium
containing the antibiotic and grown at 37 °C until the
D
600
reached 0.5. Expression of the recombinant proteins
was induced by addition of 200 ng of anhydrotetracycline.
The bacteria were grown for an additional 4 h at 37 °C
before they were harvested by centrifugation at 3480 g
(Beckman J6-MC, JS-4.2). The bacterial pellets were
resuspended in buffer W (100 m
M
Tris/HCl pH 8.0
containing 150 m
M
NaCl), the suspension was sonified
(Soniprep 150, MSE) and subsequently centrifuged at
50 000 g for 1 h 30 min (Beckman Avanti J-25, JA 25.50).
The resulting supernatants were applied to 1 mL of
Strep-Tactin–Sepharose resin previously equilibrated with
buffer W, washed with 10–15 column volumes of the
same buffer before the specifically bound proteins were
eluted using 5 mL of buffer W containing 5 m
M
desthio-
biotine. The purity of the eluted proteins was assessed by
SDS/PAGE.

In order to analyse the oligomeric state of P. falciparum
ICDH, recombinant ICDH-2 was applied to a Superdex
S-200 gel sizing column (1.6 · 60 cm, Amersham)
previously equilibrated with 50 m
M
potassium phosphate
pH 8.0 containing 1 m
M
MgCl
2
(buffer A), buffer A
containing 150 m
M
KCl or buffer A containing 150 m
M
KCl and 1 m
M
dithiothreitol using an A
¨
kta FPLC system
(Amersham). The column was previously calibrated with
the following gel filtration standards (Bio-Rad): thyro-
globulin (670 kDa), bovine c-globulin (158 kDa), chicken
ovalbumin (44 kDa), equine myoglobin (17 kDa) and
vitamin B
12
(1.3 kDa), so that the apparent size of the
Plasmodium protein could be assessed.
Protein concentrations were estimated by the Bradford
method using bovine serum albumin as a standard [29].

Characterization of recombinant ICDH-2
ICDH enzyme assays were performed at 30 °Cin25m
M
Mops buffer pH 8.0, containing 5 m
M
MgCl
2
and 100 m
M
NaCl, 2 m
M
NADP
+
and 4 m
M
D,
L
-isocitrate as described
by [30]. The assay was initiated by addition of 0.3–1 lg
recombinant enzyme and the increase in absorbance at
340 nm was followed spectrophotometrically (UV—2041
PC, Shimadzu).
In order to determine the pH-optimum for the reaction,
50 m
M
Bicine/Bis Tris Propane/Mes buffers in the range
between pH 5.5 and 10.0 were used and the standard assay
was performed. As there are reports that the specific
activity of ICDH is dependent on the buffer system used
in vitro, the pH-optimum in 50 m

M
Mops buffer pH 7.0–
8.5 was also determined. It is known that ICDH requires
bivalent metal ions for catalytic activity [31]. In order
to establish which metals support enzymatic activity of
P. falciparum ICDH, MgCl
2
, MnSO
4
,CoCl
2
,CuCl
2
,
1776 C. Wrenger and S. Mu
¨
ller (Eur. J. Biochem. 270) Ó FEBS 2003
NiSO
4
, ZnSO
4
or CaCl
2
, respectively, were used in the
assay at 5 m
M
.
The apparent K
m
values for NADP

+
,
D
-isocitrate, Mg
2+
and Mn
2+
were determined by using a rapid kinetics device
attached to the spectrophotometer which allows to deter-
mine time points every 10 ms. The assays were performed
by varying the concentration of NADP
+
from 2 l
M
to
2m
M
at constant isocitrate concentration of 4 m
M
and
Mg
2+
at 5 m
M
and varying the
D
,
L
-isocitrate concentration
from 2 l

M
to 4 m
M
at 2 m
M
NADP
+
and Mg
2+
at 5 m
M
as well as varying the concentrations of Mg
2+
or Mn
2+
(4 l
M
to 150 l
M
) at saturating concentrations of the other
two substrates. The results were analysed using GraphPad
PRISM
(GraphPad software) and the apparent K
m
values
were derived from the reciprocal Lineweaver–Burk plots.
Isolation of nucleic acids from
P. falciparum
3D7
erythrocytic stages

Erythrocytic stages of P. falciparum at 4% haematocrit and
10–15% parasitaemia were isolated by saponin lysis
according to [32]. Genomic DNA was isolated from the
parasites according to Krnajski et al. 2002 [33]. Total RNA
was isolated from the parasites using Trizol (Gibco BRL)
or Tri-reagent (Sigma) according to the manufacturer’s
instructions.
Expression of ICDH in erythrocytic stages
of
P. falciparum
According to previous reports [18] ICDH is expressed in
erythrocytic stages of P. falciparum. In order to confirm
these reports, a reverse transcriptase PCR was performed
with total RNA of P. falciparum 3D7 as a template and
specific oligonucleotides using the one-step procedure
recommended for the Enhanced Avian HS RT-PCR-20
kit. To validate that no traces of genomic DNA were
present in the RNA isolated from the parasites, a gene
containing several introns (superoxide dismutase 2; acces-
sion number: NP_703892) was also amplified as a control
from RNA and genomic P. falciparum 3D7 DNA.
Effect of oxidative stress on ICDH expression
in
P. falciparum
erythrocytic stages
Erythrocytic stages of P. falciparum (3D7) were cultured
according to [34] with RPMI 1640 medium containing
Hepes, 11 m
M
glucose (Invitrogen), 0.1% Albumax II

(Invitrogen), 27.2 mgÆL
)1
hypoxanthine and 20 mgÆL
)1
gentamycin in A
+
human erythrocytes under a reduced
oxygen atmosphere. Parasites were synchronized using 5%
sorbitol according to [35]. 48 h after synchronization
trophozoites (approximately 30–36 h) were oxidatively
stressed with 50 mUÆmL
)1
glucose oxidase for 3 h. In order
to analyse whether the transcription levels of ICDH were
increased, parasites were freed of erythrocytes by saponin
lysis [32], the parasite pellet was resuspendend in Tri-reagent
and total RNA was isolated as described above. Northern
Blot analysis was performed as described by [36]. Ten
micrograms of total RNA were separated by electrophoresis
using a 1.5% agarose-gel containing 5 m
M
guanidine
thiocyanate and subsequently transferred to a positively
charged nylon membrane (Roche) with 7.5 m
M
NaOH as
transfer buffer. The blot was hybridized with a radiolabelled
ICDH-2 probe (Random Primed DNA Labeling Kit,
Roche) in 7% SDS/0.5
M

NaH
2
PO
4
,pH7.2/2%dextran
sulfate at 55 °C overnight. The membrane was washed three
times in 75 m
M
NaCl, 7.5 m
M
sodium citrate, pH 7.0/0.1%
SDS for 10 min at 55 °C. The signals were visualized by
exposure to Hyperfilm (Amersham) overnight. Subse-
quently the blot was re-probed with a superoxide dismutase
2 probe (accession no. NP_703892) and an 18-S rRNA
probe as a loading control.
In order to analyse whether protein levels were simulta-
neously altered with mRNA levels in oxidatively stressed
parasites, an aliquot of the parasite pellet obtained after
saponin lysis was resuspended in NaCl/P
i
containing
EDTA-free protease inhibitor cocktail (Roche) and lysed
by freeze-thawing. Protein concentration was determined
using the Bradford method [29]. Fifteen micrograms of
protein extract of control and treated parasites was separ-
ated on a 4–12% SDS/PAGE (Invitrogen) and subse-
quently blotted onto nitrocellulose (Schleicher and Schuell).
The blots were hybridized with polyclonal antibodies
directed against ICDH-2 (1 : 400) and after incubation

with a secondary anti rabbit horseradish peroxidase coupled
antibody (Scottish Antibody Production Unit) (1 : 10 000)
the blot was developed using the ECL
+
system from
Amersham, according to manufacturer’s instructions.
Results
Analysis of
P. falciparum
ICDH sequence
The BLAST search for an ICDH homologue in the
P. falciparum genome database using a mammalian mito-
chondrial NADP
+
-dependent ICDH sequence recognized
a single sequence in the parasite genome located on chro-
mosome 13. Recently the genome sequence of P. falciparum
was released and the ICDH gene was annotated by the
Plasmodium sequencing consortium [26]. According to their
predictions and to our analyses, P. falciparum possess only
one ICDH gene unlike other eukaryotes where several genes
encoding ICDH are frequently found [1–3]. The open
reading frame of the P. falciparum ICDH gene was cloned
from genomic and cDNA of P. falciparum 3D7. It consists
of 1407 nucleotides and encodes for a polypeptide of
468 amino acids. The deduced amino-acid sequence of
P. falciparum ICDH shows a high degree of identity to the
mitochondrial NADP
+
-dependent ICDH of mammals

(55.3% to 57.7%) and yeast (46.6%) (Fig. 1) but has only
little identity to E. coli ICDH (10.3%). Analysis of the
deduced amino-acid sequence using the prediction pro-
grammes available on the ExPaSy website (asy.
org/tools/) revealed that the Plasmodium protein possesses a
putative mitochondrial targeting sequence (residues 1–27)
suggesting that it is localized in the parasite mitochondrion
[37]. All residues that are known to be involved in structure
and catalytic activity of mammalian ICDH appear to be
conserved in P. falciparum ICDH. In porcine ICDH the
positive charges of the arginine residues Arg101, Arg110
and Arg133 are responsible for the binding of the isocitrate-
metal ion complex to the protein and these residues
correspond to Arg129, Arg138 and Arg161 in P. falciparum
Ó FEBS 2003 Plasmodium falciparum isocitrate dehydrogenase (Eur. J. Biochem. 270) 1777
ICDH [38]. In addition Asp252 and Asp275 were found to
be important for the binding of the binary isocitrate-Mn
2+
complex in the mitochondrial porcine ICDH as shown by
mutagenesisaswellasstructuralanalyses[39,40].The
equivalent residues in P. falciparum ICDH are Asp281 and
Asp301. The histidine and lysine residues equivalent to
His315 and Lys374 of the porcine ICDH (His343 and
Lys402 in P. f. ICDH) are also conserved in the parasite
protein and these residues have been shown to be involved
in interacting with the cofactor NADP
+
[41,42].
Recombinant expression of
P. falciparum

ICDH
Two expression constructs of ICDH were generated and
recombinantly expressed in E. coli BLR (DE3) cells. The
full-length construct ICDH-1 conferred expression of
recombinant ICDH exclusively in the bacterial pellet
whereas construct ICDH-2 was expressed as a soluble
protein in the bacteria. These results are consistent with our
suggestion that the 27 N-terminal amino acid, which are
lacking in construct ICDH-2, represent a mitochondrial
targeting sequence which cannot be cleaved by the bacterial
expression system and therefore results in miss folding of the
recombinant protein. The yield of soluble recombinant
ICDH-2 was 2 mgÆL
)1
of bacterial cells. Affinity chroma-
tography on Strep-Tactin–Sepharose resulted in 98%
homogeneous protein that was used for all subsequent
analyses (Fig. 2). The P. falciparum ICDH-2 monomer has
a molecular mass of 51 kDa in agreement with the
theoretical molecular mass of 51.6 kDa. In order to
determine the oligomeric state of the protein it was subjected
to gel filtration on Superdex S-200. Interestingly, it eluted in
Fig. 1. Alignment of P. falciparum isocitrate dehydrogenase deduced amino-acid sequence. The deduced amino-acid sequence of P. falciparum ICDH
(Pf) (accession number: NP_705343/CAD 52580) is aligned with those of Sus scrofa (Ss) (accession number: P33198), Homo sapiens (Hs) (accession
number: 57499) and Saccharomyces cerevisiae (Sc) (accession number: P21954). Identical amino acids are shaded in black; homologous amino acids
are shaded in grey. An arrowhead indicates the potential cleavage site for the mitochondrial target sequence in the P. falciparum sequence. Amino
acids known to be involved in the binding and interaction of ICDH with cofactors and substrates are indicated by *.
1778 C. Wrenger and S. Mu
¨
ller (Eur. J. Biochem. 270) Ó FEBS 2003

two peaks: one corresponding to a homodimer of 90 kDa
and one corresponding to a homotetramer of 210 kDa
(Fig. 3). Both peaks were found to contain active ICDH-2
enzyme. In order to test whether hydrophobic interactions
with the column matrix were responsible for the delayed
elution of a portion of the protein, 150 m
M
KCl was added
to the equilibration and elution buffer. The enzyme activities
still eluted in two peaks at 90 and 210 kDa. Only addition
of 1 m
M
dithiothreitol to the buffer led to elution of the
protein in a single peak suggesting that the reducing agent
releases sulfhydryl bonds that have formed between the
homodimers during the purification procedure (Fig. 3).
Therefore we presume that P. falciparum ICDH-2 forms
homodimers as has been reported for the native enzyme
partially purified from P. falciparum [19], which also tend to
form enzymatic active tetramers in the absence of reducing
agents.
Characteristics of
P. falciparum
ICDH
P. falciparum ICDH-2isspecificforNADP
+
and does not
accept NAD
+
at detectable rates. The K

m
app
for NADP
+
was determined to be 90 l
M
and that for
D
-isocitrate was
found to be 40 l
M
(Table 1). In order to determine the
apparent K
m
for
D
-isocitrate, the concentration for
Fig. 2. SDS/PAGE of recombinant P. falciparum isocitrate dehydro-
genase. P. falciparum ICDH-2 was expressed in BLR (DE3) and
subsequently purified as described in Materials and methods. Purity of
the recombinant protein was assessed by SDS/PAGE. 1, 10 lgof
bacterial pellet; 2, 10 lg of bacterial supernatant prior to loading to
Strep-Tactin–Sepharose; 3, 10 lg of flow-through after Strep-Tactin–
Sepharose; 4, 3 lg of ICDH-2 after Strep-Tactin–Sepharose; 5, 1 lgof
ICDH-2 after gel filtration on Superdex S-200.
Fig. 3. Oligomeric state of P. falciparum
isocitrate dehydrogenase. (A) Recombinant
ICDH-2 was separated on a Superdex S-200
gel sizing column using buffer A without (—)
and with addition of 1 m

M
dithiothreitol (––).
Enzyme activity (j) corresponds to both, the
210 kDa and 90 kDa peaks. (B) Twenty
microlitres of the elution fractions indicated
were analysed by Western blotting and the
results confirm the presence of recombinant
proteininbothpeakfractionsthatalsocon-
tain enzyme activity.
Ó FEBS 2003 Plasmodium falciparum isocitrate dehydrogenase (Eur. J. Biochem. 270) 1779
D
-isocitrate in the commercially available mixture of
D
,
L
-isocitrate was established prior performing the assay
according to [30]. The specific activity of ICDH-2 at
saturation of all three substrates and cofactors was found to
be 162.5 ± 22.1 UÆmg
)1
with a k
cat
of 138 s
)1
(Table 1),
which is about 2–4 times higher than that reported for other
eukaryotic NADP
+
-dependent ICDH [38,41] but in the
same range as the bacterial ICDH [30]. The recombinant

protein had a pH-optimum of 8.0 in both, Bicine/Bis Tris
Propane/Mes and Mops buffer, which is higher than that
determined for the native enzyme, which was reported to be
at pH 7.5 [19]. As all other ICDH the Plasmodium enzyme is
dependent on bivalent metal ions such as Mg
2+
and Mn
2+
.
A number of metal ions were tested with the parasite ICDH
and Mg
2+
was found to stimulate activity most efficiently
followed by Mn
2+
. All other tested metal ions had no or
only marginal effects on the enzyme activity. Therefore the
K
app
m
for Mg
2+
and Mn
2+
were determined and found to be
13 l
M
and 21 l
M
, respectively, which is about 10 times

higher than that determined for Mn
2+
for the pig mito-
chondrial enzyme [41].
Expression of ICDH in erythrocytic stages
of
P. falciparum
In order to establish that ICDH is indeed expressed in the
erythrocytic stages of P. falciparum, a reverse-transcriptase
PCR was performed using total RNA isolated from
P. falciparum 3D7. As a quality control for the RNA
preparation the gene and cDNA of superoxide dismutase 2,
which contains several introns were also amplified. As
shown in Fig. 4, the PCR resulted in amplification of 1.4 kb
bands from cDNA and genomic DNA indicating that the
ICDH gene is expressed in erythrocytic stages of P. falci-
parum and that it indeed does not contain any introns as
also verified by sequence analysis of the PCR product
obtained from cDNA. Further the control PCR verifies that
the RNA preparation used for this PCR was not contami-
nated with traces of DNA, as only the 0.7 kb band
expected for the amplification of superoxide dismutase 2
cDNA is visible whereas in the control lane with genomic
DNA the superoxide dismutase 2 PCR product is larger
(1.5 kb) consistent with the presence of introns in the gene
(Fig. 4).
Expression of
P. falciparum
ICDH under enhanced
oxidative stress

Northern and Western blot analyses of P. falciparum total
RNA and protein extracts clearly show, that the ICDH
transcript as well as protein level are elevated when parasites
were stressed with glucose oxidase for a 3-h period (Fig. 5).
These results strongly indicate that in P. falciparum mito-
chondrial ICDH is involved in the protection of the parasite
mitochondria from oxidative injury by providing reducing
equivalents for antioxidant processes required to prevent
damage of the organelle.
Table 1. Properties of P. falciparum isocitrate dehydrogenase. The properties of recombinant P. falciparum ICDH were determined as described in
the Materials and methods section. For native ICDH the data was from reference [19], no standard deviations are given in this reference. For pig
mitochondrial ICDH the data was from [38,48]. ND, not determined.
Recombinant ICDH Native ICDH Pig mitochondrial ICDH
K
app
m
NADP
+
(l
M
) 90 ± 8 80 5.6 ± 0.4
K
app
m
D
-isocitrate (l
M
) 40 ± 8 150 8.4 ± 0.9
K
app

m
Mg
2+
(l
M
)13±1 ND ND
K
app
m
Mn
2+
(l
M
) 21 ± 2 ND 0.33 ± 0. 02
NAD
+
>2 m
M
ND
Specific activity (UÆmg
)1
) 162 ± 22 0.0096 37.8 ± 4.7
k
cat
(s
)1
) 138 ND 29.4
Metal Mg
2+
>Mn

2+
>Co
2+
Mg
2+
>Mn
2+
Mn
2+
>Cd
2+
>Zn
2+
>Co
2+
>Mg
2+
pH optimum 8.0 7.5 7.4
Subunit size (kDa) 51 40 46.6
Oligomeric state Homodimer Homodimer Homodimer
Fig. 4. Reverse transcriptase PCR. In order to verify that P. falcipa-
rum ICDH is expressed in erythrocytic stages of P. falciparum 3D7, a
reverse transcriptase PCR using total RNA isolated from these para-
site stages was performed as described in Materials and methods.
SOD + DNA, PCR was performed using the SOD-2 primers with
P. falciparum genomic DNA as template; SOD + RNA, PCR was
performed using the SOD-2 primers with RNA as template; ICDH –
DNA, PCR was performed without any template DNA or RNA
(negative control); ICDH + RNA, PCR was performed using ICDH
primers with RNA as template; ICDH + DNA, PCR was performed

using ICDH primers with DNA as template.
1780 C. Wrenger and S. Mu
¨
ller (Eur. J. Biochem. 270) Ó FEBS 2003
Discussion
The malaria parasite P. falciparum appears to possess only
one NADP
+
-dependent ICDH with very little homology to
the E. coli but a high degree of amino-acid identity to
NADP
+
-dependent ICDH from eukaryotes. There appear
to be no genes present in the parasite’s genome encoding for
the subunits of an NAD
+
-dependent ICDH [25,26] repre-
senting the enzyme form responsible for providing
2-oxoglutarate in the TCA cycle in eukaryotes [3,6]. The
precise physiological roles of NADP
+
-dependent ICDH in
eukaryotes are not entirely clear but there are several reports
that the enzymes are responsible for the supply of reducing
equivalents for a variety of reductive reactions [11–14].
Peroxisomal ICDH provides NADPH for enzymes
involved in the oxidation of unsaturated fatty acids such as
2,4-dienoyl-CoA reductase [11,12], hydroxymethylglutaryl-
CoA reductase [43] and acyl-CoA reductase [44]. In addition
2-oxoglutarate in peroxisomes is required by phytanoyl-

CoA a-hydroxylase [45]. In mitochondria ICDH is thought
to provide NADPH for antioxidant enzymes such as
glutathione reductase and thioredoxin reductase, which
are pivotal parts of the cell’s antioxidant defence system [13].
The N-terminal 27 amino acids of P. falciparum ICDH
were predicted to encode a mitochondrial targeting
sequence. Consistent with this prediction it was necessary
to remove these amino acids before obtaining soluble
recombinant protein in the E. coli expression system used in
this study. However, further studies are required to
unambiguously show that the enzyme localizes to the
parasite’s mitochondrion considering reports about the
localization of proteins such as DNA ligase III which
possesses a mitochondrial targeting sequence but also is
found in the cytosol and nucleus of the cell [46].
Fig. 5. Expression levels of ICDH in oxidatively stressed P. falciparum. (A) Northern blot analysis of P. falciparum ICDH. (a) 10 lgoftotalRNA
from control parasites (b) 10 lg of total RNA from parasites treated with 50 mUÆmL
)1
glucose oxidase for 3 h. The blot was hybridized with
radiolabelled ICDH-2 or superoxide dismutase 2 (B), respectively, and exposed for 48 h. (C) The 18 S rRNA loading control shows that the same
amount of RNA of both (a) untreated and (b) treated parasites was loaded onto the gel. (D) Western blot of parasite proteins probed with anti-
ICDH antiserum at 1 : 400 dilution detected by the ECL
+
system; (a) untreated parasites and (b) treated parasites.
Ó FEBS 2003 Plasmodium falciparum isocitrate dehydrogenase (Eur. J. Biochem. 270) 1781
The recombinant truncated P. falciparum ICDH shows a
clear preference for NADP
+
as a cofactor although its K
app

m
wasratherhighwith90l
M
. This low affinity for the
cofactor NADP
+
was also observed for one of the human
isoenzymes and the E. coli ICDH also appears to show a
lower affinity for NADP
+
[8,11,47]. The K
app
m
for NADP
+
determined for the native enzyme is in the same range as
that of the recombinant protein [19]. Interestingly the
specific activity of the recombinant P. falciparum ICDH is
about 4 fold higher than that reported for the porcine
mitochondrial enzyme but in the same range as the bacterial
enzyme [30,38,41]. P. falciparum ICDH shows preference
for Mg
2+
and Mn
2+
and apart from Co
2+
, none of the
other metal ions tested had any effect on the enzyme
activity. In contrast porcine ICDH is activated by a wide

range of metal ions with Mn
2+
having the most pronounced
effect on the enzyme activity [31]. Similar to other NADP
+
-
dependent ICDH, the P. falciparum protein forms dimers as
shown by gel filtration of recombinant ICDH on Sephadex
S-200 although without addition of reducing agents homo-
tetrameric forms of the enzyme were also observed. As
P. falciparum ICDH is clearly NADP
+
-dependent and
shows no activity with NAD
+
it is unlikely that it is an
essential part of the parasite’s TCA cycle. This suggestion is
consistent with the finding that in yeast the disruption of the
NAD
+
-dependent ICDH gene could not be compensated
by overexpressing the mitochondrial NADP
+
-dependent
enzyme in the null mutants [6] indicating distinct roles for
both enzymes. If the parasite ICDH is not or only
marginally involved in energy metabolism, it is an attractive
hypothesis that its major role is the maintenance of the
intramitochondrial redox balance as it was shown for
mouse mitochondrial NADP

+
-dependent ICDH [13]. In
order to analyse this potential function of the P. falciparum
enzyme, parasites were exposed to oxidative stress followed
by Northern blot and Western blot analyses of the ICDH
mRNA and protein levels. Interestingly both, ICDH
transcript and protein levels are up-regulated in oxidatively
stressed parasites suggesting that NADP
+
-dependent
ICDH in P. falciparum erythrocytic stages is a mitochon-
drial protein that is important for the maintenance of the
organelle’s redox state and that it is most likely not crucially
involved in energy metabolism during the erythrocytic life
stages of P. falciparum.
Acknowledgements
C. W. is a Wellcome Trust Travelling Research Fellow (067363/Z/02/Z)
andS.M.isaWellcomeTrustSeniorFellow.
References
1. Plaut, G.W. & Aogaichi, T. (1967) The separation of DPN-linked
and TPN-linked isocitrate dehydrogenase activities of mammalian
liver. Biochem. Biophys. Res. Commun. 28, 628–634.
2. Giorgio, N.A. Jr, Yip, A.T., Fleming, J. & Plaut. G.W. (1970)
Diphosphopyridine nucleotide-linked isocitrate dehydrogenase
from bovine heart. Polymeric forms and subunits. J. Biol. Chem.
245, 5469–5477.
3. Ramachandran, N. & Colman, R.F. (1980) Chemical character-
ization of distinct subunits of pig heart DPN-specific isocitrate
dehydrogenase. J. Biol. Chem. 255, 8859–8864.
4. Borthwick, A.C., Holms, W.H. & Nimmo, H.G. (1984) Isolation

of active and inactive forms of isocitrate dehydrogenase from
Escherichia coli ML 308. Eur. J. Biochem. 141, 393–400.
5. Reeves, H.C., Daumy, G.O., Lin, C.C. & Houston, M. (1972)
NADP
+
-specific isocitrate dehydrogenase of Escherichia coli.I.
Purification and characterization. Biochim. Biophys. Acta 258,
27–39.
6. Haselbeck, R.J. & McAlister-Henn, L. (1993) Function and
expression of yeast mitochondrial NAD- and NADP-specific
isocitrate dehydrogenases. J. Biol. Chem. 268, 12116–12122.
7. Zhao, W.N. & McAlister-Henn, L. (1996) Assembly and function
of a cytosolic form of NADH-specific isocitrate dehydrogenase in
yeast. J. Biol. Chem. 271, 10347–10352.
8. Geisbrecht, B.V. & Gould, S.J. (1999) The human PICD gene
encodes a cytoplasmic and peroxisomal NADP (+) -dependent
isocitrate dehydrogenase. J. Biol. Chem. 274, 30527–30533.
9. Keys, D.A. & McAlister-Henn, L. (1990) Subunit structure,
expression, and function of NAD (H) -specific isocitrate dehy-
drogenase in Saccharomyces cerevisiae. J. Bacteriol. 172, 4280–
4287.
10. Barnes, L.D., McGuire, J.J. & Atkinson, D.E. (1972) Yeast
diphosphopyridine nucleotide specific isocitrate dehydrogenase.
Regulation of activity and unidirectional catalysis. Biochemistry
11, 4322–4329.
11. Henke, B., Girzalsky, W., Berteaux-Lecellier, V. & Erdmann, R.
(1998) IDP3 encodes a peroxisomal NADP-dependent isocitrate
dehydrogenase required for the beta-oxidation of unsaturated
fatty acids. J. Biol. Chem. 273, 3702–3711.
12. van Roermund, C.W., Hettema, E.H., Kal, A.J., van den Berg,

M., Tabak, H.F. & Wanders, R.J. (1998) Peroxisomal beta-oxi-
dation of polyunsaturated fatty acids in Saccharomyces cerevisiae:
isocitrate dehydrogenase provides NADPH for reduction of
double bonds at even positions. EMBO J. 17, 677–687.
13. Jo, S.H., Son, M.K., Koh, H.J., Lee, S.M., Song, I.H., Kim, Y.O.,
Lee, Y.S., Jeong, K.S., Kim, W.B., Park, J.W., Song, B.J., Huh,
T.L. & Huhe, T.L. (2001) Control of mitochondrial redox balance
and cellular defense against oxidative damage by mitochondrial
NADP
+
-dependent isocitrate dehydrogenase. J. Biol. Chem. 276,
16168–16176.
14. Minard, K.I. & McAlister-Henn, L. (2001) Antioxidant function
of cytosolic sources of NADPH in yeast. Free Radic. Biol. Med.
31, 832–843.
15. Krauth-Siegel, R.L. & Coombs, G.H. (1999) Enzymes of parasite
thiol metabolism as drug targets. Parasitol. Today 15, 404–409.
16. Lu
¨
ersen, K., Walter, R.D. & Mu
¨
ller, S. (2000) Plasmodium falci-
parum-infected red blood cells depend on a functional glutathione
de novo synthesis attributable to an enhanced loss of glutathione.
Biochem. J. 346, 545–552.
17. Krnajski, Z., Gilberger, T.W., Walter, R.D. & Mu
¨
ller, S.
(2001) The malaria parasite Plasmodium falciparum possesses a
functional thioredoxin system. Mol. Biochem. Parasitol. 112,

219–128.
18. Meierjohann, S., Walter, R.D. & Mu
¨
ller, S. (2002) Glutathione
synthetase from Plasmodium falciparum. Biochem. J. 363, 833–838.
19. Vander Jagt, D.L., Hunsaker, L.A., Kibirige, M. & Campos,
N.M. (1989) NADPH production by the malarial parasite Plas-
modium falciparum. Blood 74, 471–474.
20. Walter, R.D., Nordmeyer, J.P. & Ko
¨
nigk, E. (1974) NADP-spe-
cific glutamate dehydrogenase from Plasmodium chabaudi. Hoppe
Seylers Z. Physiol. Chem. 355, 495–500.
21. Wagner, J.T., Lu
¨
demann, H., Fa
¨
rber, P.M., Lottspeich, F. &
Krauth-Siegel, R.L. (1998) Glutamate dehydrogenase, the marker
protein of Plasmodium falciparum – cloning, expression and
characterization of the malarial enzyme. Eur. J. Biochem. 258,
813–819.
1782 C. Wrenger and S. Mu
¨
ller (Eur. J. Biochem. 270) Ó FEBS 2003
22. Loyevsky, M., LaVaute, T., Allerson, C.R., Stearman, R.,
Kassim, O.O., Cooperman, S., Gordeuk, V.R. & Rouault, T.A.
(2001) An IRP-like protein from Plasmodium falciparum binds to a
mammalian iron-responsive element. Blood 98, 2555–2562.
23. Ginsburg, H. & Atamna, H. (1994) The redox status of malaria-

infectederythrocytes:anoverviewwithanemphasisonunresolved
problems. Parasite 1, 5–13.
24. Krungkrai, J., Prapunwattana, P. & Krungkrai, S.R. (2000)
Ultrastructure and function of mitochondria in gametocytic stage
of Plasmodium falciparum. Parasite 7, 19–26.
25.Gardner,M.J.,Hall,N.,Fung,E.,White,O.,Berriman,M.,
Hyman, R.W., Carlton, J.M., Pain, A., Nelson, K.E., Bowman,
S., Paulsen, I.T., James, K., Eisen, J.A., Rutherford, K., Salzberg,
S.L.,Craig,A.,Kyes,S.,Chan,M.S.,Nene,V.,Shallom,S.J.,Suh,
B.,Peterson,J.,Angiuoli,S.,Pertea,M.,Allen,J.,Selengut,J.,
Haft, D., Mather, M.W., Vaidya, A.B., Martin, D.M., Fairlamb,
A.H., Fraunholz, M.J., Roos, D.S., Ralph, S.A., McFadden, G.I.,
Cummings, L.M., Subramanian, G.M., Mungall, C., Venter, J.C.,
Carucci, D.J., Hoffman, S.L., Newbold, C., Davis, R.W., Fraser,
C.M. & Barrell, B. (2002) Genome sequence of the human malaria
parasite Plasmodium falciparum. Nature 419, 498–511.
26. Hall, N., Pain, A., Berriman, M., Churcher, C., Harris, B., Harris,
D., Mungall, K., Bowman, S., Atkin, R., Baker, S., Barron, A.,
Brooks, K., Buckee, C.O., Burrows, C., Cherevach, I., Chilling-
worth, C., Chillingworth, T., Christodoulou, Z., Clark, L., Clark,
R., Corton, C., Cronin, A., Davies, R., Davis, P., Dear, P.,
Dearden, F., Doggett, J., Feltwell, T., Goble, A., Goodhead, I.,
Gwilliam, R., Hamlin, N., Hance, Z., Harper, D., Hauser, H.,
Hornsby, T., Holroyd, S., Horrocks, P., Humphray, S., Jagels, K.,
James, K.D., Johnson, D., Kerhornou, A., Knights, A., Konfor-
tov, B., Kyes, S., Larke, N., Lawson, D., Lennard, N., Line, A.,
Maddison, M., McLean, J., Mooney, P., Moule, S., Murphy, L.,
Oliver, K., Ormond, D., Price, C., Quail, M.A., Rabbinowitsch,
E., Rajandream, M.A., Rutter, S., Rutherford, K.M., Sanders,
M.,Simmonds,M.,Seeger,K.,Sharp,S.,Smith,R.,Squares,R.,

Squares, S., Stevens, K., Taylor, K., Tivey, A., Unwin, L.,
Whitehead, S., Woodward, J., Sulston, J.E., Craig, A., Newbold,
C. & Barrell, B.G. (2002) Sequence of Plasmodium falciparum
chromosomes 1, 3–9 and 13. Nature 419, 527–531.
27. Krnajski, Z., Gilberger, T.W., Walter, R.D. & Mu
¨
ller, S. (2000)
Intersubunit interactions in Plasmodium falciparum thioredoxin
reductase. J. Biol. Chem. 275, 40874–40878.
28. Wrenger, C., Lu
¨
ersen, K., Krause, T., Mu
¨
ller, S. & Walter, R.D.
(2001) The Plasmodium falciparum bifunctional ornithine
decarboxylase,
S
-adenosyl-
L
-methionine decarboxylase, enables a
well balanced polyamine synthesis without domain–domain
interaction. J. Biol. Chem. 276, 29651–29656.
29. Bradford, M.M. (1976) A rapid and sensitive method for the
quantitation of microgram quantities of protein utilizing the
principle of protein-dye binding. Anal. Biochem. 72, 248–254.
30. Singh, S.K., Miller, S.P., Dean, A., Banaszak, L.J. & LaPorte,
D.C. (2002) Bacillus subtilis isocitrate dehydrogenase. A substrate
analogue for Escherichia coli isocitrate dehydrogenase kinase/
phosphatase. J. Biol. Chem. 277, 7567–7573.
31. Colman, R.F. (1972) Regulation of enzymes by small molecules.

Ann. NY Acad. Sci. 193, 2–13.
32. Umlas, J. & Fallon, J.N. (1971) New thick-film technique for
malaria diagnosis. Use of saponin stromatolytic solution for lysis.
Am. J. Trop. Med. Hyg. 20, 527–529.
33. Krnajski, Z., Gilberger, T.W., Walter, R.D., Cowman, A.F. &
Mu
¨
ller, S. (2002) Thioredoxin reductase is essential for the survival
of Plasmodium falciparum erythrocytic stages. J. Biol. Chem. 277,
25970–25975.
34. Trager, W. & Jensen, J.B. (1976) Human malaria parasites in
continuous culture. Science 193, 673–675.
35. Hoppe, H.C., Verschoor, J.A. & Louw, A.I. (1991) Plasmodium
falciparum: a comparison of synchronisation methods for in vitro
cultures. Exp. Parasitol. 72, 464–467.
36. Kyes, S., Pinches, R. & Newbold, C. (2000) A simple RNA ana-
lysis method shows var and rif multigene family expression pat-
terns in Plasmodium falciparum. Mol. Biochem. Parasitol. 105,
311–315.
37. Claros, M.G. & Vincens, P. (1996) Computational method to
predict mitochondrially imported proteins and their targeting
sequences. Eur. J. Biochem. 241, 779–786.
38. Soundar, S., Danek, B.L. & Colman, R.F. (2000) Identification by
mutagenesis of arginines in the substrate binding site of the por-
cine NADP-dependent isocitrate dehydrogenase. J. Biol. Chem.
275, 5606–5612.
39. Grodsky, N.B., Soundar, S. & Colman, R.F. (2000) Evaluation
by site-directed mutagenesis of aspartic acid residues in the metal
site of pig heart NADP-dependent isocitrate dehydrogenase.
Biochemistry 39, 2193–2200.

40. Ceccarelli, C., Grodsky, N.B., Ariyaratne, N., Colman, R.F. &
Bahnson, B.J. (2002) Crystal structure of porcine mitochondrial
NADP
+
-dependent isocitrate dehydrogenase complexed with
Mn
2+
and isocitrate: Insights into the enzyme mechanism. J. Biol.
Chem. 277, 43454–43462.
41. Huang, Y.C. & Colman, R.F. (2002) Evaluation by mutagenesis
of the roles of His309, His315, and His319 in the coenzyme site of
pig heart NADP-dependent isocitrate dehydrogenase. Biochem-
istry 41, 5637–5643.
42. Zhao, W.N. & McAlister-Henn, L. (1996) Expression and gene
disruption analysis of the isocitrate dehydrogenase family in yeast.
Biochemistry 35, 7873–7878.
43. Kovacs, W.J., Faust, P.L., Keller, G.A. & Krisans, S.K. (2001)
Purification of brain peroxisomes and localization of 3-hydroxy-
3-methylglutaryl coenzyme A reductase. Eur. J. Biochem. 268,
4850–4859.
44. Riendeau, D. & Meighen, E. (1985) Enzymatic reduction of fatty
acids and acyl-CoAs to long chain aldehydes and alcohols.
Experientia 41, 707–713.
45. Wierzbicki, A.S., Lloyd, M.D., Schofield, C.J., Feher, M.D. &
Gibberd, F.B. (2002) Refsum’s disease: a peroxisomal disorder
affecting phytanic acid alpha-oxidation. J. Neurochem. 80, 727–
735.
46. Lakshmipathy, U. & Campbell, C. (1999) The human DNA ligase
III gene encodes nuclear and mitochondrial proteins. Mol. Cell.
Biol. 19, 3869–3876.

47. Hurley, J.H., Dean, A.M., Thorsness, P.E., Koshland, D.E. Jr &
Stroud, R.M. (1990) Regulation of isocitrate dehydrogenase by
phosphorylation involves no long-range conformational change in
the free enzyme. J. Biol. Chem. 265, 3599–3602.
48. Colman, R.F. (1972) Role of metal ions in reactions catalysed
by pig heart triphosphopyridine nucleotide-dependent isocitrate
dehydrogenase. II. Effect on catalytic properties and reactivity of
aminoacidresidues.J. Biol. Chem. 247, 215–223.
Ó FEBS 2003 Plasmodium falciparum isocitrate dehydrogenase (Eur. J. Biochem. 270) 1783