Báo cáo khoa học: Efficient inhibition of b-secretase gene expression in HEK293 cells by tRNAVal-driven and CTE-helicase associated hammerhead ribozymes doc

Efficient inhibition of b-secretase gene expression in HEK293 cells
by tRNA
Val
-driven and CTE-helicase associated hammerhead
ribozymes
Barbara Nawrot
1
, Slawomir Antoszczyk
1
, Maria Maszewska
1
, Tomoko Kuwabara
2
, Masaki Warashina
2
,
Kazunari Taira
2
and Wojciech J. Stec
1
1
Centre of Molecular and Macromolecular Studies, Polish Academy of Sciences, Department of Bioorganic Chemistry, Lodz,
Poland;
2
Gene Function Research Laboratory, National Institute of Advanced Industrial Science and Technology (AIST),
Tsukuba Science City, Japan
The b-amyloid peptide (Ab) is a major component of
toxic amyloid plaques found in the brains of patients with
Alzheimer’s disease. Ab is liberated by sequential cleavage
of amyloid precursor protein (APP) by b-andc-secre-
tases. The level of Ab depends directly on the hydrolytic

activity of b-secretase. Therefore, b-secretase is an excel-
lent target for drug design. An approach based on RNA-
cleaving ribozymes was developed to control expression
of b-secretase. Two sites of mRNA coding b-site APP
cleaving enzyme were chosen as target sequences for
endogenously delivered ribozymes. The ribozyme cassette
was designed to constitute a catalytic hammerhead core
and substrate recognition arms, flanked at the 5¢-terminus
by tRNA
Val
and at the 3¢-terminus by constitutive
transport element sequences. Ribozyme cassettes were
cloned into a pUC19 plasmid and used for transient
transfection of HEK293 cells. We demonstrate that such
ribozymes efficiently inhibit b-secretase gene expression at
both the mRNA (up to 95%) and the protein (up to
90%) levels. Inhibition of b-site APP cleaving enzyme
activity directly influences the intra- and extracellular
population of Ab peptide. Therefore, such ribozymes may be
considered as molecular tools for silencing the b-secretase
activity, and further, as therapeutic agents for anti-amyloid
treatment.
Keywords: Alzheimer’s disease; hammerhead ribozyme;
b-secretase.
Alzheimer’s disease (AD) is a neurodegenerative disorder
characterized by progressive deposition of senile plaques in
the brain. The major component of these aggregates is a
4-kDa b-amyloid peptide (Ab), a product of proteolytic
cleavage of the amyloid precursor protein (APP) [1]. The
processing of the transmembrane precursor glycoprotein

APP in vivo occurs by two different pathways. A conven-
tional nonamyloidogenic pathway occurs via proteolytic
cleavage of APP by a-andc-secretases and results in release
of nontoxic soluble a-APP(s) protein and two other shorter
products P3 and C7 [2,3]. In normal healthy individuals
these products protect neuronal cells against oxidative stress
and participate in wound repair [4–7]. Another kind of APP
processing prevails in the brains of AD patients with ageing-
related dementia. In such cases the cleavage of APP occurs
on the amyloidogenic processing pathway. APP is cleaved at
the N-terminus of the Ab region by b-secretase and at the
C-terminus by c-secretase. The product of these cleavages is
a 39–43-amino acid b-amyloid peptide. The major cleavage
products are Ab40 and Ab42. According to the amyloid
hypothesis, accumulation of Ab in the brain is the primary
influence driving AD pathogenesis [8]. The gene encoding
b-secretase was sequenced recently [9–13]. It is an aspartyl
protease 2 (Asp2), also called b-site APP cleaving enzyme
(BACE) or memapsin 2. Several approaches have been
undertaken to find an effective inhibitor for human
b-secretase activity [9,14–17]. The selectivity of peptidomi-
metic inhibitors, however, is limited due to their affinity
toward other cellular aspartyl proteases [14]. It has been
shown that BACE knockout mice are healthy and show no
phenotypic differences from their wild-type littermates
[18,18a]. Cortical cultures from such mice showed no
detectable b-secretase activity and much less Ab peptide.
Inhibition of Ab generation by lowering the activity of the
b-secretase may be beneficial for AD treatment. Therefore,
Correspondence to B. Nawrot, Centre of Molecular and

Macromolecular Studies, Polish Academy of Sciences, Department of
Bioorganic Chemistry, Sienkiewicza 112, Lodz, Poland.
Fax: + 48 42 681 5483, Tel.: + 48 42 681 6970,
E-mail:
Abbreviations:Ab, b-amyloid peptide/amyloid b-peptide; AD,
Alzheimer’s disease; AP, alkaline phosphatase; APP, human amyloid
precursor protein; BACE, b-site APP cleaving enzyme; CTE,
constitutive transport element; DMEM, Dulbecco’s modified of Eagle
medium; GAPDH, glyceraldehyde-3-phosphate dehydrogenase;
HEK293, human transformed primary embryonal kidney cells;
HEK293sw, HEK293 overexpressing human APP
695
with the
Swedish double mutation; IMR-32, human neuroblastoma cells;
pol III, RNA polymerase III; RNAi, RNA interference;
SiRNA, small interfering RNA.
Dedication: This work is dedicated to Prof. Maciej Wiewiorowski on
the occasion of his 85th birthday.
(Received 15 May 2003, revised 14 July 2003,
accepted 7 August 2003)
Eur. J. Biochem. 270, 3962–3970 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03784.x
b-secretase is an excellent target for anti-amyloid therapeu-
tic drug design [19].
Hammerhead ribozymes are the smallest catalytic nucleic
acids able to promote, in a sequence-specific manner, the
cleavage of phosphodiester bonds in RNA. This ability
makes ribozymes useful molecular tools for very selective
degradation of mRNA and inhibition of expression of the
genes of ÔunwantedÕ proteins. The successful selection of
hammerhead ribozymes, active in human cell lines, allows

application of a molecular approach to the design of novel
therapeutics [20–22]. Up to now it has been demonstrated
that plasmid encoded ribozymes coupled at their 5¢-ends
with a tRNA
Val
gene sequence are expressed intracellularly
with high efficiency [23]. Such ribozymes, when mimicking
the 3¢-immature tRNA molecule, are recognized by the
nuclear protein exportin-t (Xpo-t) and are exported
efficiently from the nucleus to the cytoplasm [24–27].
Conjugation of the 3¢-end of the ribozymes with a consti-
tutive transport element (CTE) sequence, which is an
aptameric sequence for cellular helicases [28–30], leads to
the formation of ribozymes highly active in cellular experi-
ments, independent of the secondary structure of the target
mRNA [31].
The present work demonstrates an application of endo-
genously generated tRNA
Val
-driven and CTE helicase-
associated hammerhead ribozymes as efficient molecular
tools for the inhibition of the biosynthesis of b-secretase and
for the exclusion of the formation of toxic b-amyloid
peptides in HEK293 cells.
Materials and methods
Construction of plasmids for ribozyme expression
Two sites of a b-secretase mRNA (b-site APP cleaving
enzyme, BACE, Gene Bank number: AF190725, start
codon 5¢-AUG
456

-3¢) were chosen as targets for the
hammerhead ribozymes, namely the 5¢-GUC
665
-3¢ and
5¢-CUC
825
-3¢ sequences. Templates containing the hammer-
head catalytic sequence, complementary to the selected
target sites of BACE mRNA, were synthesized chemically.
The sequence of the template encoding ribozyme Rz-1
(directed toward cleavage of the GUC
665
containing
sequence) is 5¢-CGGTTCGAAACCGGGCACTACAAA
AACCAACTTTGCCCTGCCCCCTGATGAGGCCGA
AAGGCCGAAACTTGCCCCTGGTACCCCGGATAT
CTTTTTTTCTATCGCGTCGACCT-3¢ and the template
encoding Rz-2 (targeted toward CUC
825
containing
sequence) is 5¢-CGGTTCGAAACCGGGCACTACAAA
AACCAACTTTCACCCTTCCGCTGATGAGGCCGA
AAGGCCGAAAGGTCCCGGTGGTACCCCGGATA
TCTTTTTTTCTATCGCGTCGACCT-3¢. The ribozyme
templates were PCR amplified with primers P1: 5¢-TTCCC
GGTTCGAAACCGGGCACTAC-3¢ and P2: 5¢-CTGCA
GGTCGACGCGATAGAAAAAAA-3¢. PCR products
were digested with KpnIandCsp45I restriction endonuc-
leases and were ligated with pUC-KE-tRNA-CTE plasmids
that had been digested with both KpnIandCsp45I and

treated with calf intestinal alkaline phosphatase. The
sequencing was carried out on an ABI PRISM instrument
with the PCR primer P7 (5¢-CGCCAGGGTTTTCCCAGT
CACGAC-3¢). Oligonucleotides were synthesized in house
or purchased from ESPEC Custom Oligo Service, Japan.
Plasmids pUC-KE-tRNA-CTE-Rz-1 and pUC-KE-tRNA-
CTE-Rz-2, encoding Rz-1 and Rz-2, respectively, were
obtained on a multimilligram scale. Constructs containing
inactive versions of Rz-1 and Rz-2 were obtained in the
same way by using templates as described above but in
which the guanosine nucleotides, marked in bold, had been
replaced by adenosine nucleotides.
Cell culture, transfection and cell lysis
Human transformed primary embryonal kidney cell lines
HEK293 and HEK293sw (a kind gift from D. Selkoe,
Harvard Medical School, Boston, MA, USA) were cultured
in Dulbecco’s modification of Eagle’s medium (DMEM,
Sigma), supplemented with 10% foetal bovine serum
(Gibco BRL), 100 lgÆmL
)1
streptomycin and 100 UÆmL
)1
penicillin. G418 (200 lgÆmL
)1
, Gibco BRL) was used as
selection antibiotics for HEK293sw cells. Glass wells were
coated with poly
L
-lysine (Sigma-Aldrich Chemie GmbH).
IMR-32 cells were grown in RPMI supplemented with 20%

fetal bovine serum and 1% minimal essential medium non
essential amino acid (Gibco BRL) and antibiotics as above.
Glass wells were coated with fibronectin (2 lgÆcm
)2
,Sigma).
Cells were grown in monolayer, at 37 °C in an atmosphere
of 5% CO
2
in 10-cm plates and transfected at  70%
confluence. Transfection with 40 lg of the ribozyme-
containing plasmid was carried out for 12 h using the
Lipofectin
TM
reagent (Gibco BRL) according to the manu-
facturer’s protocol. Postincubation was carried out in
DMEM for the next 24 h or longer (up to 264 h). Culture
medium was collected and frozen at )70 °C. Cells were
washed three times with Ca
+2
/Mg
+2
-free NaCl/P
i
and
lysed with Tri Pure Isolation Reagent (Boehringer Mann-
heim). Lysates were kept at )70 °C.
Isolation of a total RNA from cell lysates
The total RNA fraction was isolated from cell lysates
according to the Tri Pure Isolation Reagent protocol
(Boehringer Mannheim). The nucleic acid fraction was

then treated with RQ1 RNase-free DNase (Promega)
and isolated by phenol/chloroform extraction followed
by ethanol precipitation. The total RNA was quantified
spectrophotometrically at 260 nm. Samples were kept at
)70 °C for several months without any decomposition of
the RNA.
Determination of the level of BACE mRNA
and ribozyme RNA expression in mammalian cells
The level of BACE mRNA and ribozyme RNA was
monitored by RT/PCR using a OneStep RT/PCR kit
(Qiagen). For determination of the level of ribozyme RNA
the RT/PCR was carried out with two vector primers P1
and P2 (20 l
M
) and total RNA (0.5 lg). For BACE mRNA
level determination the specific BACE gene primers were
designed to give a PCR product 430 nucleotides. RT primer
(5¢-GCCTTCCCAGTTGGAGCCGTTGAT-3¢,P1
BACE
),
PCR primer (5¢-CGCAGCGGCCTGGGGGGCGCCC
C-3¢,P2
BACE
) and total RNA (0.5 lg) were used for the
RT/PCR reaction. PCR was programmed for 30 cycles. The
Ó FEBS 2003 Inhibition of b-secretase gene expression (Eur. J. Biochem. 270) 3963
reaction product was analysed by 3% NuSieve GTG
agarose (FMC BioProducts) gel electrophoresis and stained
with ethidium bromide. For experiments performed in co-
amplification conditions two pairs of primers P1

BACE
and
P2
BACE
,forBACEmRNA(20l
M
), and P1
GAPDH
and
P2
GAPDH
, for the control glyceraldehyde-3-phosphate
dehydrogenase (GAPDH; 1.3 l
M
)wereused.
Western blotting
HEK293 cells that had been transfected with ribozyme-
expression plasmids were lysed with Tri Pure Isolation
Reagent according to the manufacturer’s protocol. The
protein fraction was isolated and 200 lgsamplewas
analysed by SDS/PAGE (12% acrylamide). After electro-
phoresis, protein bands were transferred to a poly(vinylid-
ene difluoride) membrane (Millipore). The membrane was
blocked with 5% nonfat milk in NaCl/Tris containing 0.1%
NaN
3
, probed with primary rabbit polyclonal antibodies
M83 (Santa Cruz) against BACE for 1.5 h at 37 °C
(dilution 1 : 500) and then with secondary anti-rabbit
polyclonal IgG–alkaline phosphatase (AP; Santa Cruz)

for 1.5 h at room temperature (dilution 1 : 500). Bands
were visualized by addition of Nitro Blue tetrazolium and
5-bromo-4-chloroindol-3-yl phosphate (Sigma-Aldrich
Chemie GmbH) in 100 m
M
Tris/HCl pH 9.5 buffer con-
taining 100 m
M
NaCl and 5 n
M
MgCl
2
.
Immunoprecipitation of b-amyloid peptide
and dot blot analysis
The level of b-amyloid peptide in conditioned cultured
medium and in cells was determined by immunoprecipita-
tion and dot blot analysis. Conditioned medium was
collected from the ribozyme-transfected HEK293 cell cul-
ture postincubated for 48 or 60 h. Conditioned medium
from cells transfected with lipofectin only was used as a
control. The conditioned medium (1 mL) was subjected to a
preclearing process by treatment with Protein A Sepharose
4 Fast Flow (50 lL, 50% slurry, Amersham Pharmacia
Biotech AB). Immunoprecipitation of the b-amyloid pep-
tide Ab40 with primary rabbit polyclonal antibody Anti-
b-Amyloid 40 (BioSource International Inc.) was performed
according to the Immunoprecipitation Starter Pack proto-
col (Amersham, Pharmacia Biotech AB). For antigene–
antibody complex precipitation Protein A Sepharose 4 Fast

Flow was added (50 lL, 50% slurry) to the precleared
conditioned medium (500 lL). The complex was washed
three times with lysis buffer (NP-40) and once with wash
buffer (50 m
M
Tris, pH 8.0). The pellet was suspended in
reducing buffer (1% SDS, 100 m
M
dithiothreitol, 50 m
M
Tris pH 7.5), heated for 3 min at 95 °C and centrifuged at
12 000 g for 20 s. Supernatant (5 lL)wasappliedtoa
cellulosenitrate (E) membrane (Schleicher & Schuell). The
membrane was dried, washed in NaCl/Tris and incubated in
5% nonfat milk for 1.5 h at room temperature. After
saturation the membrane was washed twice with NaCl/Tris
and then treated with the secondary anti-rabbit IgG
conjugated with AP (Santa Cruz Biotechnology) for 1.5 h
at room temperature. After three washes in NaCl/Tris
supplemented with 0.04% Tween 20, and once with AP
buffer (100 m
M
Tris pH 9.5, 100 m
M
NaCl), the membrane
was incubated with Nitro Blue tetrazolium and 5-bromo-4-
chloroindol-3-yl phosphate and washed finally with ddH
2
O.
Immunoprecipitation of b-amyloid peptide Ab40 from

the ribozyme-transfected HEK293 cells postincubated for
48 or 60 h was performed as follows. Cultured cells were
lysed with Tri Pure Isolation Reagent according to the
manufacturer’s protocol. The preclearing process of the
cell protein extract (100 lg of protein in 500 lLof
extract) was carried out as described above. Immuno-
precipitation and determination of the intracellular level
of Ab40 was carried out according to the procedure
described above.
Synthetic b-amyloid peptide, fragment 1–40 (Sigma-
Aldrich Chemie GmbH) (100 ng) was used as a control
for the dot blotting process and for quantification of the
immunoprecipitation level. The blots were quantified by
using the
IMAGE QUANT
program.
Results
Design of ribozymes
Ribozymes with a hammerhead catalytic core possess the
ability to cleave substrate RNA after the 5¢-NHH-3¢
sequence, where N is A, U, C or G and H is A, U or C
[32], with the most efficient cleavage of the substrate
possessing the triplet GUC or CUC [23]. The messenger
RNA of BACE, which functions as a b-secretase in the
process of releasing Ab, was selected as our target molecule.
Two sites of the BACE mRNA were chosen for hammer-
head cleavage: 5¢-GUC
665
-3¢ and 5¢-CUC
825

-3¢. The lowest
energy secondary structure of BACE mRNA, generated
with the help of the
MFOLD
program [33] shows that the
5¢-GUC
665
-3¢ target sequence is not involved in hydrogen
bonding. However, the availability of the 5¢-CUC
825
-3¢
triplet, which is the target sequence for Rz-2, as well as the
availability of the recognition arms of both substrates, are
rather poor for hybridization with ribozymes. To overcome
the problem of target/ribozyme involvement within the
intramolecular hydrogen bonding, we took advantage of
our recent achievements in the design of ribozymes with
significantly improved intracellular activity [23–26,31].
First, we applied tRNA
Val
-driven ribozymes. An intra-
cellular transcription of such tRNA
Val
-driven ribozymes is
performed by the RNA polymerase III (pol III) system and
provides a high level of endogenous ribozyme expression.
Moreover, in somatic cells, the transport of tRNA-
mimicking transcripts of ribozymes from nucleus to cyto-
plasm is facilitated by Xpo-t [27]. Such ribozymes exhibit
significantly higher cytoplasmic activity due to their colocal-

ization with the target mRNA. The tRNA-driven ribozymes
were flankedon their5¢-endsby a tRNA
Val
motif [25]. Thelast
seven bases of the wild-type mature tRNA
Val
were replaced by
a linker 5¢-ACUACAAAAACCAAC-3¢ sequence, which
prevents the processing of the 3¢-end of the transcript and
secures cloverleaf secondary structure of the tRNA motif.
Extension of the linker by the three additional uridine
nucleotides allowed us to design ribozymes with the required
secondary structure, as generated by
MFOLD
.
To ensure the efficacy of endogenously generated cata-
lytic nucleic acids our hammerhead ribozymes were exten-
ded at their 3¢-termini with a CTE sequence. The CTE motif
3964 B. Nawrot et al. (Eur. J. Biochem. 270) Ó FEBS 2003
was identified as the aptameric RNA sequence for cellular
RNA helicases [28–30]. It has already been shown that
attachment of a CTE sequence to the ribozyme cassette
results in significant improvement of ribozyme efficacy [31].
The intracellular helicase-associated ribozyme possesses an
ability to unwind double-stranded sequences of the mes-
senger RNA and facilitates the change of mechanism by
which the ribozyme searches for its target site. With such a
hybrid sequence the ribozyme reaches its target site by the
sliding mechanism used by cellular helicases. This pheno-
menon significantly improves the efficacy of protein-hybrid

ribozymes, due to the ability of such complexes to guide the
ribozyme to its target site.
Expression of ribozyme plasmids in mammalian cells
Three cultured cell lines HEK293, HEK293sw and IMR-32
were used to study the expression of ribozymes, which were
cloned into pUC-KE-tRNA-CTE plasmids. Ribozyme
encoding plasmids were transiently transfected into the
tested cells with the aid of lipofectin. Expression of the
ribozymes was observed in the course of time. The nucleic
acid fraction, isolated from cell lysates, was treated with
RNase-free DNase I to remove traces of plasmid DNA,
and the total RNA was used as a reverse transcription
template for semiquantitative RT/PCR analysis of the level
of ribozyme RNA in the cells. Amplification of pUC-KE-
tRNA-CTE-Rz-1 and Rz-2 plasmids gave an expected 295-
bp product (Fig. 1, lanes 2 and 4, respectively). When RT/
PCR was carried out with an exclusion of the reverse
transcription step, the reaction did not yield the corres-
ponding amplification product (lanes 1 and 3). This result
confirmed that the RT/PCR product of the expected length
did originate from the cellular RNA fraction, and not from
plasmid DNA amplification.
Similar results were obtained while monitoring an
expression of ribozyme plasmids pUC-KE-tRNA-CTE-
Rz-1 and Rz-2 in IMR-32 and HEK293sw cells, although
the level of ribozyme RNA present in the lysates was
significantly lower ( 60% and  20%, respectively, data
not shown). This could be caused by decreased transfection
efficiency and/or by a low ribozyme expression efficiency in
the genetically changed HEK293sw cells.

The expression of pUC-KE-tRNA-CTE-Rz-1 in
HEK293 cells was also observed over a longer time interval
(Fig. 2). As expected for transient transfection of the
plasmid, the expression of ribozyme reached its maximum
after 24 h of postincubation. The level of ribozyme signi-
ficantly decreased during the following 24 h, but even after
11 days we could still detect traces of ribozyme RNA (data
not shown).
Activity of ribozymes in HEK293 cells
At first we checked the activity of the ribozymes by
determining the level of the target mRNA in tested cells
transfected with ribozyme encoding plasmids. Two sites
of BACE mRNA, 5¢-GUC
665
-3¢ and 5¢-CUC
825
-3¢,were
selected as target sequences for ribozymes Rz-1 and Rz-2,
respectively. Specific primers for the RT/PCR (P1
BACE
and
P2
BACE
) were designed in such a way that ribozyme
degradation sites were included within the amplified BACE
mRNA sequence. The amplification product was expected
to be 430 bp DNA. As the expression of b-secretase in
HEK293 cells is rather low [12,13] it was necessary to
determine the number of the PCR cycles suitable for
monitoring the changes of the BACE mRNA level. Under

standard RT/PCR conditions (0.5 lgtotalRNAand20l
M
primers) it was possible to observe the appearance of the
Fig. 1. Expression of pUC-KE-tRNA-CTE-Rz-1 and Rz-2 plasmids
in HEK293 cells determined by semiquantitative RT/PCR. Ribozyme
encoding plasmids were transiently transfected into the cells. Thirty-six
hours after transfection, the nucleic acid fraction was isolated from cell
lysates, treated with RNase-free DNase I and used in RT/PCR. The
reaction products were analysed by electrophoresis through 3%
agarose and stained with ethidium bromide. As expected, 295-bp
products of reverse transcription and PCR amplification of Rz-1 and
Rz-2 plasmids with specific vector primers P1 and P2 (see Materials
and methods) were obtained (lanes 2 and 4, respectively). When RT/
PCR was performed without a reverse transcription step, the reaction
did not yield the corresponding amplification product (lanes 1 and 3).
Fig. 2. Semi-quantitative analysis of expression of the pUC-KE-tRNA-
CTE-Rz-1 plasmid in HEK293 cells over time. After transfection with
Rz-1 plasmid, HEK293 cells were lysed 0, 6, 12, 24, 36 and 48 h post
incubation. The total RNA fraction was isolated from the cell lysates,
treated with RNase-free DNase I and used in RT/PCR. At postincu-
bation time 0 h (12 h after the beginning of transfection, see Materials
and methods) only a minimal amount of ribozyme RNA was present
in the cell lysates. The level of ribozyme increased with time and
reached its maximum 24 h after transfection. The expression of
GAPDH mRNA was monitored as internal control.
Ó FEBS 2003 Inhibition of b-secretase gene expression (Eur. J. Biochem. 270) 3965
430-bp product only after more than 25 PCR cycles. With
more than 30 PCR cycles the amount of amplification
product reached a plateau. Thus, in our RT/PCR protocol
we used 30 PCR cycles as the standard. The mRNA of the

GAPDH protein was amplified as a control. Primers for
amplification of GAPDH (P1
GAPDH
and P2
GAPDH
)were
designed to give a 150-bp product. In co-amplification
RT/PCR conditions the concentration of primers P1
GAPDH
and P2
GAPDH
was  15 times lower than primers P1
BACE
and P2
BACE
.
The HEK293 cells were transfected with plasmids
encoding Rz-1, Rz-2 and with their inactive versions
(Rz-1i and Rz-2i). Transfections of the cells with lipofectin
(NO) only or lipofectin and an empty plasmid (EM) were
used as controls. The level of the RT/PCR products was
determined under co-amplification conditions 36 h after
transfection. Figure 3 shows an agarose gel electrophoresis
of the RT/PCR products from different transfection
experiments. While the level of the 150-bp control product
is constant for all six experiments (and below the saturation
of the PCR reaction) we could observe no or very little
BACE mRNA amplification product (430 bp) for experi-
ments where the Rz-1 and Rz-2 plasmids were used.
However, no significant lowering of the BACE amplifica-

tion product was observed for experiments where inactive
forms of ribozymes were used.
The level of BACE mRNA in Rz-1 transfected HEK293
cells was also monitored in the course of time under single
gene amplification RT/PCR conditions (Fig. 4). Cells were
lysed after 6, 12, 24, 36 and 48 h of the postincubation time.
The level of GAPDH mRNA was determined in parallel
separate experiments. The amount of amplification product
decreased for the first 24 h after transfection, when it
reached < 5% of the control BACE mRNA expressed in
the cells transfected with lipofectin only (NO) and lysed
after 48 h. Over the next several hours we observed an
increase of the BACE mRNA level because of the lower
expression of ribozyme. A similar profile of the target
mRNA was obtained for the cells transfected with the Rz-2
plasmid (data not shown).
Effect of ribozyme expression on BACE protein
and b-amyloid peptide levels
To examine whether transiently expressed ribozymes affect
the amount of b-secretase gene expression on the protein
level, Western blotting analyses were performed. The test
cells were transfected with Rz-1 and Rz-2 encoding plasmids
and after 36 h of postincubation the protein fraction was
isolated from the cells and subjected to analysis. As shown
in Fig. 5 the extent of protein expression is much lower in
the HEK293 cells treated with Rz-1 ( 5%) and with Rz-2
( 10%) plasmids in comparison to the amount of BACE
in the control transfected cells. A protein mixture of known
molecular mass was used as a marker to establish the band
of BACE protein with a molecular mass of  70 kDa.

As our ribozyme constructs were active in the cellular
system and efficiently inhibited biosynthesis of b-secretase
Fig. 3. Expression of BACE and GAPDH mRNA in HEK293 cells
transfected with ribozyme plasmids monitored by RT/PCR. Plasmids
encoding Rz-1, Rz-2 and their inactive versions Rz-1i and Rz-2i were
used for cell transfection. As controls, only lipofectin (NO) or lipo-
fectin and an empty plasmid (EM) were used. The level of the RT/PCR
products was determined under co-amplification conditions 36 h after
transfection. An agarose gel electrophoresis of the RT/PCR products
demonstrates that the level of the 150-bp control product is constant
for all six experiments, while no or very little BACE mRNA amplifi-
cation product (430 bp) is observed for experiments where the Rz-1
and Rz-2 plasmids were used.
Fig. 4. The level of BACE mRNA in HEK293 cells transfected with
pUC-KE-tRNA-CTE-Rz-1 monitored over time under noncompetitive
RT/PCR conditions. Cells were lysed 6, 12, 24, 36 and 48 h post
incubation. The level of GAPDH mRNA was determined in parallel
separate experiments. The amount of amplification product decreased
for the first 24 h after transfection, when it reached less than 5% of the
control BACE mRNA expression in the cells transfected with lipo-
fectin only (NO) and lysed after 48 h.
Fig. 5. Effect of ribozyme expression on BACE protein level in HEK293
cells. The test cells were transfected with Rz-1 and Rz-2 encoding
plasmids and 36 h postincubation the protein fraction was isolated
from the cells and subjected to Western blotting analysis. The extent of
protein expression is much lower in the HEK293 cells treated with
Rz-1 ( 5%) and with Rz-2 ( 10%) plasmids relative to the amount
of BACE in the control transfected cells (NO, EM, Rz-1i and Rz-2i).
3966 B. Nawrot et al. (Eur. J. Biochem. 270) Ó FEBS 2003
we asked the question whether we could observe any

difference in the level of extra- and intracellular release of
b-amyloid peptide, which is a product of the catalytic
activity of the target protein. Our efforts to use Western blot
analysis for detection of the presence of 4-kDa b-amyloid
peptide in the cell extracts, or in the conditioned cultured
medium, even using as much as 300 lg of the protein
fraction, were unsuccessful. This was probably because of
the very low level of b-amyloid peptide in the test cells [2,3].
Thus, we performed immunoprecipitation of the b-amyloid
peptide Ab40 either from cell lysates or from conditioned
cultured medium. The immunoprecipitation reaction was
performed with primary rabbit polyclonal antibody (Anti-
b-Amyloid 40). Detection of the Ab/Ab40 complex was per-
formed by treatment of the membrane with the secondary
anti-(rabbit IgG AP) Ig followed by dot blot visualization
with Nitro Blue tetrazolium and 5-bromo-4-chloro-
indol-3-yl phosphate reagents. A synthetic b-amyloid
peptide, fragment 1–40, was used as a control in immuno-
precipitation experiments.
In cell cultures transfected with our ribozyme constructs
the level of extra- and intracellular Ab peptide was
significantly decreased. Figure 6 shows the data for the
extracellular level of the Ab peptide 48 and 60 h after
transfection of the HEK293 cells with the Rz-1 and Rz-2
encoding plasmids. Forty-eight hours after transfection
the amount of Ab peptide reached the level of  65% and
 40%, respectively, for cells transfected with Rz-1 and
Rz-2, in comparison to the level of a control experiment
with lipofectin only transfected cells. A further decrease of
the Ab level up to 20% was observed in the following

12 h. However, the intracellular level of Ab peptide
decreased only up to  60% during 60 h after transfection
with Rz-1 and Rz-2 plasmids in comparison to the control
lipofectin only transfection (data not shown).
Discussion
Engineered ribozymes are of great interest as modern
therapeutic agents due to their potential to specifically and
efficiently inhibit either ÔunwantedÕ proteins or viral RNA
gene expression via catalytic hydrolysis of specific internu-
cleotide bonds of the target RNA. The functional activity of
endogenously delivered ribozymes depends on many factors
including their intracellular concentration, an effective
export from the nucleus to the cytoplasm, a colocalization
of the ribozyme with the target RNA and the availability of
the target sites for enzymatic cleavage. Computer-generated
secondary structures of long messenger RNAs suggest their
poor availability for association with complementary
strands, such as ribozyme and antisense oligonucleotides.
We have used tRNA
Val
-driven CTE-conjugated hammer-
head ribozyme cassettes, recently designed by one of our
laboratories [24–27,31]. These engineered hammerhead
ribozymes fulfil the requirements to be active in a cellular
system independently of the secondary structure of the
target mRNA.
As the target molecule we have chosen the gene for
human b-secretase, which is an aspartyl protease Asp2, also
called BACE protein or memapsin 2 [9–13]. This protein is
involved in proteolytic cleavage of an amyloid precursor

protein APP, and directly influences the release of the toxic
b-amyloid peptide. Ab is thought to be a primary patho-
genic agent in AD [1]. It was found as a main component of
the aggregates leading to ageing dementia.
There are many approaches to reduce the level of the
b-amyloid peptide. It was thought that inhibition of
expression of APP by antisense oligonucleotides might be
of interest for therapeutic application [34]. However,
because of the functional importance of nonamyloidogenic
APP secretion products in healthy individuals this approach
does not seem to be suitable. Another approach to the
reduction of Ab formation utilizes an application of
noncleavable analogues of BACE substrates [14–17]. Several
differently modified short peptides were chemically synthes-
ized and used successfully for inhibition of b-secretase
activity. However, there are several other aspartyl proteases
present in cells [19]. Some of them, e.g. cathepsin D, show
quite remarkable affinity for BACE inhibitors [14]. Thus,
there is still a need for novel molecular tools which would be
able to effectively reduce the level of BACE protein, and in
consequence, to reduce the amount of Ab peptide released in
neuronal cells.
We asked the question whether we can inhibit expres-
sion of the gene of BACE protein using our engineered
ribozymes. In order to check the potential of plasmid
coded ribozymes for cleavage of the target sequence we
performed an in vitro cleavage reaction of the short
5¢-radioactively labelled RNA substrates (25-mers) with
ribozymes obtained by an in vitro transcription. As
expected, both ribozymes transcripts exhibit potential for

cleaving their short complementary RNA targets (data
not shown).
Although the highest level of expression of BACE protein
was identified in the neuronal cells of the brain, for
preliminary experiments we have chosen human embryonal
kidney (HEK293) cells as well as HEK293sw cells overex-
pressing APP with a Swedish mutation and IMR-32 human
Fig. 6. Effect of Rz-1 and Rz-2 activity on the extracellular level of
b-amyloid peptide. b-Amyloid peptide Ab40 was immunoprecipitated
from the conditioned cultured medium collected 48 and 60 h after
transfection of HEK293 cells with the test ribozyme plasmids. Forty-
eight hours after transfection, the amount of Ab peptide reached the
level of  65% and  40%, respectively, for cells transfected with
Rz-1 and Rz-2, relative to the level of a control experiment with
lipofectin only transfected cells (first three bars). Further decrease of
the Ab level, to below 20%, was observed in the following 12 h
(second three bars).
Ó FEBS 2003 Inhibition of b-secretase gene expression (Eur. J. Biochem. 270) 3967
neuroblastoma cells. Ribozyme cassettes were introduced
into the bacterial plasmid pUC-KE and used for transfec-
tion of the test cells. Intracellularly generated ribozyme
transcripts were identified in the cell extracts, as shown in
Figs 1 and 2. Our goal was to downregulate endogenous
BACE mRNA and the target protein as well as to prevent
b-amyloid peptide formation. We were able to demonstrate
by semiquantitative RT/PCR that an increasing amount of
expressed ribozyme directly influences the intracellular level
of endogenous BACE mRNA (Fig. 7). The maximum level
of ribozyme expression occurs 24 h after transfection, while
after that time the expression of BACE mRNA reaches a

minimum ( 5%). Typically, for transient transfection the
level of expressed ribozyme drops down; however, it could
be still detected by RT/PCR even 11 days after transfection.
Expression of ribozymes in the other two test cell lines
was limited to 60% and 20%, respectively, for the IMR-32
and HEK293sw cells. This could be caused by the different
efficiency of the plasmids in the transfection of the test cells
or by low ribozyme expression efficiency in the genetically
changed HEK293sw cells. As a consequence, the low level
of ribozyme expression significantly reduced the efficiency
of the BACE mRNA degradation (data not shown).
Probably a much bigger amount of ribozyme plasmids
should be used for transfection of HEK293sw and IMR-32
cells to reach satisfactory inhibition of BACE expression.
The decreased amount of BACE mRNA in HEK293
cells led to the lower biosynthesis of this protein (up
to 90%), as monitored 36 h after transfection (Fig. 5).
Lowering of BACE amount should directly result in
decreased amount of APP cleavage products (b-amyloid
peptide, N-terminal b-APPs and b-CTF fragment). Immuno-
precipitation of Ab from cell lysates as well as from cell
culture medium 48 and 60 h after transfection showed
significantly decreased amounts of both the intra- and
extracellular b-amyloid peptide in comparison to the Ab
isolated from control lipofectin only transfected cells.
Functional effects of hammerhead ribozymes as well as
their inactive forms were not tested for their influence on the
level of other APP proteolysis products. However, as
reported earlier, lowering of BACE expression results in
lowering of the released amount of Ab, b-APPs and b-CTF

fragments [9,11,18].
Although the downregulation of BACE is only partial
and transient, it is necessary to test whether our ribozyme
constructs are effective for BACE gene silencing and
reduction of the level of the toxic b-amyloid peptides in
neuronal cell lines. Further experiments on APP transgenic
mouse, exhibiting an elevated level of b-amyloid peptide
[35], are needed to demonstrate in vivo activity of such
ribozymes. The tRNA
Val
-driven and CTE-coniugated ribo-
zymes directed toward murine BACE mRNA are under
preparation in our laboratories. Our results kindle some
hopes that such hammerhead ribozymes may be used as
molecular tools for the specific inhibition of b-secretase
activity.
Recently, there is growing interest in RNA interference
(RNAi) phenomena [36,37]. The power of RNAi is
remarkable, because it can serve as a very efficient
sequence-specific tool for gene silencing. RNAi is a valuable
therapeutic tool for drug design and operates in the
cytoplasm. It is induced by small interfering RNAs
(siRNAs), which are the products of a double-stranded
RNA cleavage by a nuclease dicer [38]. Selective inactivation
of genes for BACE1 and BACE2 by siRNA was reported
recently [39]. Up to now several expression systems have
been designed for endogenous generation of siRNA [40–44].
As our tRNA-driven ribozyme transcripts are efficiently
exported from the nucleus to the cytoplasm, where they meet
their target mRNA, this expression system is of interest for

endogenous generation of siRNA and activation of the
RNAi effect in human cells [45]. Studies on an inhibition
of BACE gene expression by endogenously generated
siRNA via tRNA
Val
promotion are in progress in our
laboratories.
Acknowledgements
This work was supported by Polish Committee for Scientific Research
(project PBZ-KBN-059/T09/09) and European Commission (5th
Framework Programme, NAS Complement to the project QLK6-
CT-1999–02112). We thank Wieslawa Goss and Barbara Mikolajczyk
for excellent technical assistance.
References
1. Selkoe, D.J. (1991) The molecular pathology of Alzheimer’s
disease. Neuron 6, 487–498.
2. Hendriks, L. & Van Broeckhoven, C (1996) A beta A4 amyloid
precursor protein gene and Alzheimer’s disease. Eur. J. Biochem.
237, 6–15.
3. Haass, C. & Selkoe, D.J. (1993) Cellular processing of beta-
amyloid precursor protein and the genesis of amyloid beta-
peptide. Cell 75, 1039–1042.
4. Barger,S.W.,Fiscus,R.R.,Ruth,P.,Hofmann,F.&Mattson,
M.P. (1995) Role of cyclic GMP in the regulation of neuronal
calcium and survival by secreted forms of beta-amyloid pre-
cursor. J. Neurochem. 64, 2087–2096.
Fig. 7. Comparison of the level of BACE mRNA and Rz-1 RNA in
HEK293 cells transfected with Rz-1 encoding plasmid as a function of
time. Maximum expression of Rz-1 (white bars) is associated with the
minimal level of BACE mRNA (grey bars) present in transfected cells,

as monitored by RT/PCR. Reaction products were analysed by
agarose gel electrophoresis (Figs 2 and 4, respectively) and computer
assisted quantification.
3968 B. Nawrot et al. (Eur. J. Biochem. 270) Ó FEBS 2003
5. Kummer,C.,Wehner,S.,Quast,T.,Werner,S.&Herzog,V.
(2002) Expression and potential function of beta-amyloid pre-
cursor proteins during cutaneous wound repair. Exp. Cell Res.
280, 222–232.
6. Mattson, M.P., Cheng, B., Culwell, A.R., Esch, F.S., Lieberburg,
I. & Rydel, R.E. (1993) Evidence for excitoprotective and
intraneuronal calcium-regulating roles for secreted forms of the
beta-amyloid precursor protein. Neuron 10, 243–254.
7. Mattson, M.P. & Furukawa, K. (1997) Alzheimer’s disease.
Short precursor shortens memory. Nature 387, 457–458.
8. Hardy, J. & Selkoe, D.J. (2002) The amyloid hypothesis of Alz-
heimer’s disease: progress and problems on the road to thera-
peutics. Science 297, 2209.
9. Vassar,R.,Bennett,B.D.,Babu-Khan,S.,Kahn,S.,Mendiaz,
E.A., Denis, P., Teplow, D.B., Ross, S., Amarante, P., Loeloff,
R.,Luo,Y.,Fisher,S.,Fuller,J.,Edenson,S.,Lile,J.,Jarosinski,
M.A.,Bier,A.L.,Curran,E.,Burgess,T.,Louis,J.C.,Collins,F.,
Treanor, J., Rogers, G. & Citron, M. (1999) Beta-secretase
cleavage of Alzheimer’s amyloid precursor protein by the trans-
membrane aspartic protease BACE. Science 286, 735–741.
10. Hussain,I.,Powell,D.,Howlett,D.R.,Tew,D.G.,Meek,T.D.,
Chapman, C., Gloger, I.S., Murphy, K.E., Southan, C.D., Ryan,
D.M.,Smith,T.S.,Simmons,D.L.,Walsh,F.S.,Dingwall,C.&
Christie, G. (1999) Identification of a novel aspartic protease
(Asp 2) as beta-secretase. Mol. Cell Neurosci. 14, 419–427.
11. Yan, R., Bienkowski, M.J., Shuck, M.E., Miao, H., Tory, M.C.,

Pauley,A.M.,Brashier,J.R.,Stratman,N.C.,Mathews,W.R.,
Buhl, A.E., Carter, D.B., Tomasselli, A.G., Parodi, L.A., Hei-
nrikson, R.L. & Gurney, M.E. (1999) Membrane-anchored
aspartyl protease with Alzheimer’s disease beta-secretase activity.
Nature 402, 533–537.
12. Sinha, S., Anderson, J.P., Barbour, R., Basi, G.S., Caccavello, R.,
Davis, D., Doan, M., Dovey, H.F., Frigon, N., Hong, J.,
Jacobson-Croak,K.,Jewett,N.,Keim,P.,Knops,J.,Lieberburg,
I.,Power,M.,Tan,H.,Tatsuno,G.,Tung,J.,Schenk,D.,Seu-
bert, P., Suomensaari, S.M., Wang, S., Walker, D., John, V. et al.
(1999) Purification and cloning of amyloid precursor protein
beta-secretase from human brain. Nature 402, 537–540.
13. Lin,X.,Koelsch,G.,Wu,S.,Downs,D.,Dashti,A.&Tang,J.
(2000) Human aspartic protease memapsin 2 cleaves the beta-
secretase site of beta-amyloid precursor protein. Proc.NatlAcad.
Sci. USA 97, 1456–1460.
14.Ghosh,A.K.,Shin,D.,Downs,D.,Koelsch,G.,Lin,X.,
Ermolieff, J. & Tang, J. (2000) Design of potent inhibitors for
human brain memapsin2 (b-secretase). J. Am. Chem. Soc. 122,
3522–3523.
15. Ghosh,A.K.,Bilcer,G.,Harwood,C.,Kawahama,R.,Shin,D.,
Hussain,K.A.,Hong,L.,Loy,J.A.,Nguyen,C.,Koelsch,G.,
Ermolieff, J. & Tang, J. (2001) Structure-based design: potent
inhibitors of human brain memapsin 2 (beta-secretase). J. Med.
Chem. 44, 2865–2868.
16.Turner,R.T.,III,Koelsch,G.,Hong,L.,Castanheira,P.,
Ermolieff, J., Ghosh, A.K. & Tang, J. (2001) Subsite specificity of
memapsin 2 (beta-secretase): implications for inhibitor design.
Biochemistry 40, 10001–10006.
17. Hong,L.,Koelsch,G.,Lin,X.,Wu,S.,Terzyan,S.,Ghosh,

A.K., Zhang, X.C. & Tang, J. (2000) Structure of the protease
domain of memapsin 2 (beta-secretase) complexed with inhibitor.
Science 290, 150–153.
18. Roberds, S.L., Anderson, J., Basi, G., Bienkowski, M.J.,
Branstetter, D.G., Chen, K.S., Freedman, S.B., Frigon, N.L.,
Games, D., Hu, K., Johnson-Wood, K., Kappenman, K.E.,
Kawabe,T.T.,Kola,I.,Kuehn,R.,Lee,M.,Liu,W.,Motter,R.,
Nichols, N.F., Power, M., Robertson, D.W., Schenk, D., Schoor,
M.,Shopp,G.M.,Shuck,M.E.,Sinha,S.,Svensson,K.A.,
Tatsuno, G., Tintrup, H., Wijsman, J., Wright, S. & McConlogue,
L. (2001) BACE knockout mice are healthy despite lacking the
primary beta-secretase activity in brain: implications for Alzhei-
mer’s disease therapeutics. Hum. Mol. Genet. 10, 1317–1324.
18a. Luo, Y., Bolon, B., Kahn, S., Bennett, B.D., Babu-Khan, S.,
Denis,P.,Fan,W.,Kha,H.,Zhang,J.,Gong,Y.,Martin,L.,
Louis, J.C., Yan, Q., Richards, W.G., Citron, M. & Vassar, R.
(2001) Mice deficient in BACE1, the Alzheimer’s beta-secretase,
have normal phenotype and abolished beta-amyloid generation.
Nat. Neurosci. 4, 231–232.
19. Citron, M. (2002) Beta-secretase as a target for the treatment of
Alzheimer’s disease. J. Neurosci. Res. 70, 373–379.
20. Lewin, A.S. & Hauswirth, W.W. (2001) Ribozyme gene therapy:
applications for molecular medicine. Trends Mol. Med. 7,
221–228.
21. Christoffersen, R.E. & Marr, J.J. (1995) Ribozymes as human
therapeutic agents. J. Med. Chem. 38, 2023–2037.
22. Sullenger, B.A. & Gilboa, E. (2002) Emerging clinical applica-
tions of RNA. Nature 418, 252–258.
23. Koseki, S., Tanabe, T., Tani, K., Asano, S., Shioda, T., Nagai,
Y., Shimada, T., Ohkawa, J. & Taira, K. (1999) Factors gov-

erning the activity in vivo of ribozymes transcribed by RNA
polymerase III. J. Virol. 73, 1868–1877.
24. Miyagishi, M., Kuwabara, T. & Taira, K. (2001) Transport of
intracellularly active ribozymes to the cytoplasm. Cancer
Chemother. Pharmacol. 48, S96–S101.
25. Kuwabara, T., Warashina, M., Koseki, S., Sano, M., Ohkawa, J.,
Nakayama, K. & Taira, K. (2001) Significantly higher activity of
a cytoplasmic hammerhead ribozyme than a corresponding nu-
clear counterpart: engineered tRNAs with an extended 3¢ end can
be exported efficiently and specifically to the cytoplasm in
mammalian cells. Nucleic Acids Res. 29, 2780–2788.
26. Kato, Y., Kuwabara, T., Warashina, M., Toda, H. & Taira, K.
(2001) Relationships between the activities in vitro and in vivo of
various kinds of ribozyme and their intracellular localization in
mammalian cells. J. Biol. Chem. 276, 15378–15385.
27. Kuwabara, T., Warashina, M., Sano, M., Tang, H., Wong-Staal,
F., Munekata, E. & Taira, K. (2001) Recognition of engineered
tRNAswithanextended3¢ end by Exportin-t (Xpo-t) and
transport of tRNA-attached ribozymes to the cytoplasm in
somatic cells. Biomacromolecules 2, 1229–1242.
28. Braun, I.C., Rohrbach, E., Schmitt, C. & Izaurralde, E. (1999)
TAP binds to the constitutive transport element (CTE) through a
novel RNA-binding motif that is sufficient to promote
CTE-dependent RNA export from the nucleus. EMBO J. 18,
1953–1965.
29. Li,J.,Tang,H.,Mullen,T.M.,Westberg,C.,Reddy,T.R.,Rose,
D.W. & Wong-Staal, F. (1999) A role for RNA helicase A in
post-transcriptional regulation of HIV type. Proc. Natl Acad. Sci.
USA 96, 709–714.
30. Tang, H., Gaietta, G.M., Fischer, W.H., Ellisman, M.H. &

Wong-Staal, F. (1997) A cellular cofactor for the constitutive
transport element of type D retrovirus. Science 276, 1412–1415.
31. Warashina, M., Kuwabara, T., Kato, Y., Sano, M. & Taira, K.
(2001) RNA-protein hybrid ribozymes that efficiently cleave any
mRNA independently of the structure of the target RNA. Proc.
NatlAcad.Sci.USA98, 5572–5577.
32.Kore,A.R.,Vaish,N.K.,Kutzke,U.&Eckstein,F.(1998)
Sequence specificity of the hammerhead ribozyme revisited; the
NHH rule. Nucleic Acids Res. 26, 4116–4120.
33. Zucker, M. (1989) On finding all suboptional foldings of an RNA
molecule. Science 244, 48–52.
34. Kumar, V.B., Vyas, K., Franko, M., Choudhary, V., Buddhiraju,
C., Alvarez, I. & Morley, J.E. (2001) Molecular cloning, expres-
sion, and regulation of hippocampal amyloid precursor protein of
senescence accelerated mouse (SAMP8). Biochem. Cell Biol. 79,
57–67.
Ó FEBS 2003 Inhibition of b-secretase gene expression (Eur. J. Biochem. 270) 3969
35. Irizarry, M.C., McNamara, M., Fedorchak, K., Hsiao, K. &
Hyman, B.T. (1997) APPsw transgenic mice develop age-related
A beta deposits and neuropil abnormalities, but no neuronal loss
in CA1. J. Neuropathol. Exp. Neurol. 56, 965–973.
36. Fire,A.,Xu,S.,Montgomery,M.K.,Kostas,S.A.,Driver,S.E.
& Mello, C.C. (1998) Potent and specific genetic interference by
double-stranded RNA in Caenorhabditis elegans. Nature. 391,
806–811.
37. Elbashir, S., Lendeckel, W. & Tuschl, T. (2001) RNA interference
is mediated by 21- and 22-nucleotide RNAs. Genes Dev. 15,
188–200.
38. Bernstein, E., Caudy, A.A., Hammond, S.M. & Hannon, G.J.
(2001) Role for a bidentate ribonuclease in the initiation step of

RNA interference. Nature 409, 363–366.
39.Basi,G.,Frigon,N.,Barbour,R.,Doan,T.,Gordon,G.,
McConlogue, L., Sinha, S. & Zeller, M. (2003) Antagonistic
effects of BACE1 and BACE2 on Abeta production in cells.
J. Biol. Chem. 278, 31512–31520.
40.Paddison,P.J.,Caudy,A.A.,Bernstein,E.,Hannon,G.J.&
Conklin, D.S. (2002) Short hairpin RNAs (shRNAs) induce
sequence-specific silencing in mammalian cells. Genes Dev. 16,
948–958.
41. Brummelkamp, T.R., Bernards, R. & Agami, R. (2002) A system
for stable expression of short interfering RNAs in mammalian
cells. Science 296, 550–553.
42. Sui,G.,Soohoo,C.,Affar,E.,Gay,F.,Shi,Y.,Forrester,W.C.&
Shi, Y. (2002) A DNA vector-based RNAi technology to sup-
press gene expression in mammalian cells. Proc. Natl Acad. Sci.
USA 99, 5515–5520.
43. Yu, J Y., DeRuiter, S.L. & Turner, D.L. (2002) RNA interference
by expression of short-interfering RNAs and hairpin RNAs in
mammalian cells. Proc. Natl Acad. Sci. USA 99, 6047–6052.
44.Paul,C.P.,Good,P.D.,Winer,I.&Engelke,D.R.(2002)
Effective expression of small interfering RNA in human cells.
Nat. Biotechnol. 19, 505–508.
45. Miyagishi, M. & Taira, K. (2002) U6 promoter-driven siRNAs
with four uridine 3¢ overhangs efficiently suppress targeted gene
expression in mammalian cells. Nat. Biotechnol. 19, 497–500.
3970 B. Nawrot et al. (Eur. J. Biochem. 270) Ó FEBS 2003