Báo cáo khoa học: Structure and function of N-acetylglucosamine kinase Identification of two active site cysteines pptx

Structure and function of
N
-acetylglucosamine kinase
Identification of two active site cysteines
Markus Berger, Hao Chen, Werner Reutter and Stephan Hinderlich
Institut fu
¨
r Molekularbiologie und Biochemie, Freie Universita
¨
t Berlin, Berlin-Dahlem, Germany
N-Acetylglucosamine is a major component of com-
plex carbohydrates. The mammalian salvage pathway of
N-acetylglucosamine recruitment from glycoconjugate deg-
radation or nutritional sources starts with phosphorylation
by N-acetylglucosamine kinase. In this study we describe the
identification of two active site cysteines of the sugar kinase
by site-directed mutagenesis and computer-based structure
prediction. Murine N-acetylglucosamine kinase contains
six cysteine residues, all of which were mutated to serine
residues. The strongest reduction of enzyme activity was
found for the mutant C131S, followed by C143S. Deter-
mination of the kinetic properties of the cysteine mutants
showed that the decreased enzyme activities were due to a
strongly decreased affinity to either N-acetylglucosamine for
C131S, or ATP for C143S. A secondary structure prediction
of N-acetylglucosamine kinase showed a high homology to
glucokinase. A model of the three-dimensional structure
of N-acetylglucosamine kinase based on the known struc-
ture of glucokinase was therefore generated. This model
confirmed that both cysteines are located in the active site of
N-acetylglucosamine kinase with a potential role in the

binding of the transfered c-phosphate group of ATP within
the catalytic mechanism.
Keywords: N-acetylglucosamine kinase; N-acetylglucos-
amine; aminosugar metabolism; ATP binding domain;
cysteine residue.
N-Acetylglucosamine kinase (GlcNAc kinase; EC 2.7.1.59)
catalyzes the phosphorylation of N-acetylglucosamine
(GlcNAc) to GlcNAc 6-phosphate. GlcNAc, from lysos-
omal degradation of oligosaccharides or nutritional sourc-
es, is a main substrate for the synthesis of UDP-GlcNAc.
This activated nucleotide sugar is then used in the
biosynthesis of N- and O-glycans [1]. UDP-GlcNAc can
be derived either from the salvage pathway involving
GlcNAc kinase, or by de novo synthesis from the fructose-
6-phosphate produced in glycolysis (Fig. 1). UDP-GlcNAc
is the main substrate of the glycoconjugate biosynthesis. It
is used not only in N-/O-glycan biosynthesis, but also as a
substrate of O-GlcNAc transferase, which modifies cyto-
solic and nuclear proteins at serine or threonine residues
by addition of a single GlcNAc. The latter possibly plays a
role in signal transduction as an antagonist of protein
phosphorylation [2]. Finally, it is the key substrate for the
biosynthesis of sialic acids [3].
The function of the salvage pathway of UDP-GlcNAc
biosynthesis is not completely clarified, but there is
evidence that it compensates the de novo pathway. Thus,
tissues with high energy requirements, for example neuro-
nal cells, sperms or the apical zone of transporting
epithelia, convert glucosamine 6-phosphate (GlcN 6-P) to
fructose 6-phosphate by the action of GlcN-6-phosphate

deaminase [4], suggesting that in these tissues UDP-
GlcNAc is provided by the salvage pathway. Furthermore,
GlcN-6-phosphate deaminase is activated by GlcNAc-6-P,
the product of the GlcNAc kinase reaction [5]. In
mice, elimination of GlcN-6-phosphate-N-acetyltransfer-
ase, another enzyme of the de novo pathway (Fig. 1)
resulted in embryonal lethality at embryonic day 7.5 [6].
Fibroblasts derived from these mice displayed a reduced
UDP-GlcNAc pool and consequently a reduced prolifer-
ation. An external supplement of GlcNAc, metabolized by
the salvage pathway, completely normalized the pheno-
type. Finally, it was recently found that the subcellular
localization of GlcNAc kinase in fibroblasts is different
from the localization of the enzymes of the de novo
pathway [7], indicating a spatial separation of the two
pathways, presumably with different regulation.
GlcNAc kinase has been cloned from man [8] and mouse
[9]. Like N-acetylgalactosamine kinase [10] and N-acetyl-
mannosamine kinase, as a part of the bifunctional enzyme
UDP-GlcNAc 2-epimerase/N-acetylmannosamine kinase
[11,12], it is an N-acetylhexosamine kinase. This group is
part of the sugar kinase/heat shock protein 70/actin super-
family. Common to all these proteins is an ATPase domain
of known three-dimensional structure [13]. Sequence align-
ments of GlcNAc kinase with the two most prominent sugar
kinases, hexokinase and glucokinase, revealed a strong
homology of the three enzymes [9]. In the present
study, comparison of GlcNAc kinase with a model of the
three-dimensional structure of glucokinase provides the
first picture of the possible structure of the enzyme.

Furthermore, two active site cysteines were identified by
site-directed mutagenesis, agreeing with the predicted
structureofGlcNAckinase.
Correspondence to M. Berger, Institut fu
¨
r Molekularbiologie
und Biochemie, Freie Universita
¨
t Berlin, Arnimallee 22,
D-14195, Berlin-Dahlem, Germany.
Fax: + 493084451541, Tel.: + 493084451547,
E-mail:
Abbreviations: GlcN 6-phosphate, glucosamine 6-phosphate;
GlcNAc, N-acetylglucosamine.
Enzyme: N-acetylglucosamine kinase (EC 2.7.1.59).
(Received 13 March 2002, revised 29 May 2002, accepted 10 July 2002)
Eur. J. Biochem. 269, 4212–4218 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.03117.x
EXPERIMENTAL PROCEDURES
Materials
[1-
14
C]GlcNAc was from ICN (Eschwege, Germany).
Restriction enzymes were obtained from Gibco BRL
(Gaithersburg, MD, USA). Nitrocellulose membrane was
from Schleicher & Schuell (Dassel, Germany). PCR
primers were from MWG Biotech (Ebersberg, Germany).
All other chemicals were from Sigma (Deisenhofen,
Germany).
Enzyme assays
GlcNAc kinase activity was determined as described [14]. In

brief, the final volume of incubation mixtures was 225 lL,
containing 60 m
M
Tris/HCl, pH 7.5, 20 m
M
MgCl
2
,5m
M
GlcNAc, 50 nCi [1-
14
C]-GlcNAc, 10 m
M
ATP (disodium
salt), 10 m
M
phosphoenolpyruvate, 2.5 U pyruvate kinase
and variable amounts of protein extracts. Incubations were
carried out at 37 °C for 30 min, and reactions were stopped
by addition of 350 lL of ethanol. Radiolabeled compounds
were separated by paper chromatography. Radioactivity
was determined in the presence of Ultima Gold XR
(Packard, Groningen, Netherlands) in a Tri-Carb 1900
CA liquid scintillation analyser (Packard). Protein concen-
tration was measured by the method of Bradford (1976),
using bovine serum albumin as a standard.
K
m
values were determined by Lineweaver–Burk
plots with Ni-nitrilotriacetic acid purified enzymes (see

below). For determination of the K
m
of GlcNAc, different
concentrations of GlcNAc were used in the presence of
10 m
M
ATP. For determination of the K
m
of ATP, different
concentrations of ATP were used in the presence of 5 m
M
GlcNAc.
Site directed mutagenesis
Site directed mutagenesis was performed using the Quick-
Change
TM
site directed mutagenesis kit (Stratagene, Hei-
delberg, Germany). In brief, the expression vector pRSETC
containing mouse GlcNAc kinase cDNA [9] was used as a
template in a PCR-like amplification using Pfu-polymerase
and primers containing the desired mutation. The primers
used to generate the mutated cDNAs are shown in Table 1.
Fig. 1. De novo and salvage pathway of
UDP-GlcNAc biosynthesis.
Table 1. Oligonucleotides used for generation of GlcNAc kinase
cysteine mutants by site-directed mutagenesis. Mismatches with the
template are underlined.
Name Sequence
C45S 5¢-
GGCACAGACCAGAGTGTGGAGAGGATCA ATGAG

C131S 5¢-GGAACAGGCTCCAACAGTAGGCTTATCAACCC
TGATGG
C143S 5¢-GATGGCTCCGAGAGTGGCAGTGGAGGCTGGGG
C211S 5¢-CCCATTTGTATAGGGACTTTGATAAAAGTAAG
TTTGCTGGATTTTGCCAGAAAATTGC
C217S 5¢-GCTGGATTTAGTCAGAAAATTGCAGAAGGTG
CACATCAGGG
C268S 5¢-CCCATTCTGAGTGTGGGCTCAGTGTGG
Ó FEBS 2002 Structure and function of GlcNAc kinase (Eur. J. Biochem. 269) 4213
The parental template is then digested by the restriction
enzyme DpnI, which specifically cuts methylated DNA. The
nicked vector DNA with the desired mutations was
transformed into Escherichia coli InvaF¢ cells. All mutant
constructs were controlled by sequencing with the Sanger
didesoxychain termination reaction for double stranded
DNA.
Expression of GlcNAc kinase and mutants in
E. coli
The vectors were transformed into E. coli BL21 cells
(Invitrogen) following the manufacturer’s instructions. Posi-
tive clones were selected with chloramphenicol and ampi-
cillin. Cells were grown to an absorbance of 0.5, induced with
1m
M
isopropylthio-a-galactoside for 2 h, harvested and
resuspended in 20 m
M
Na
2
HPO

4
, pH 7.5, and then lysed by
freezing/thawing. The lysate was centrifuged at 10 000 g for
15 min and the supernatant was analyzed for GlcNAc kinase
activity and by Western blot analysis as described below. The
supernatant was purified using a Ni-nitrilotriacetic acid
column (Qiagen) as described earlier [9].
Western blot analysis
Supernatants of E. coli lysates were subjected to sodium
dodecyl sulfate-polyacrylamide gel electrophoresis as des-
cribed by Laemmli [15] using 10% acrylamide gels. Separ-
ated proteins were electroblotted onto nitrocellulose
membranes. The membranes were blocked for 3 h in 5%
skim milk in buffer A (0.1% Tween 20, 150 m
M
NaCl,
3m
M
KCl in 9 m
M
NaH
2
PO
4
, pH 7.2) and then incubated
overnight in a 1 : 5000 dilution of Anti-Xpress antibody
(Invitrogen) in buffer A. Detection was performed using a
peroxidase-conjugated goat anti-mouse second Ig (Dianova;
Hamburg, Germany) and an enhanced chemiluminescence
detection kit (Amersham). To normalize different expres-

sion rates the scanned Western blots were analyzed by using
the IPLabGel software.
Multiple sequence alignment
Overall sequence similarities were investigated using the
PSI
-
BLAST
software [16] and the
NR
-
DATABASE
.Protein
sequences were aligned by using the
MULTALIN
software
[17]. The algorithms used for secondary structure prediction
were
PHDSEC
[18],
PSIPRED
[19] and
PROFPREDICTION
[20].
The different algorithms were used to find the lowest
common denominator with regard to a-helices and the
b-sheets. Three-dimensional modelling was performed using
the
RASMOL
software.
RESULTS

Construction of cysteine mutants and functional
expression in
E. coli
BL21
In an earlier study, the use of specific thiol-modifying
chemical reagents revealed the presence of cysteine residues
in or near the active site of GlcNAc kinase [14]. The number
of functionally relevant cysteines was quantified to two, and
dithiol-modifying reagents predicted a structural vicinity of
these cysteines. The amino acid sequences of murine and
human GlcNAc kinase showed six conserved cysteine
residues [8,9]. For functional characterization therefore all
six cysteines were mutated to serines by site-directed
mutagenesis.
Wild-type and mutated GlcNAc kinase cDNAs were
expressed in E. coli BL21 cells. The proteins were fused to
a His-tag, which allowed purification of the proteins by
Ni-nitrilotriacetic acid chromatography and detection by
a specific antibody using Western-blot analysis. GlcNAc
kinase cDNA encodes for a protein with 39 kDa, the
His-tag for a 3 kDa protein part. The analysis of wild-type
and mutated GlcNAc kinases in BL21 cytosols therefore
detected 42 kDa polypeptides in all cases (Fig. 2).
The expression of functionally intact proteins was
checked by determination of GlcNAc kinase activities.
BL21 cells are well suited for the expression of GlcNAc
kinase, because they have negligible background activities
[9]. Figure 3 shows the relative GlcNAc kinase activites of
wild-type and mutated GlcNAc kinases, normalized to the
varying expression levels by analyzing protein expression

with Western blots. All cysteine mutants showed detect-
Fig. 2. Western blot analysis of overexpressed GlcNAc kinase and
cysteine mutants in E. coli BL21. Supernatants after cell lysis were
separated by SDS-polyacrylamide gel electrophoresis and blotted onto
nitrocellulose as described in Experimental procedures. The blot was
stained with the Anti-Xpress Ig recognizing the His-tag fusion part of
the recombinant proteins. Mock, BL21 cells transformed with
pRSETC without GlcNAc kinase cDNA.
Fig. 3. Relative specific activities of GlcNAc kinase and cysteine
mutants. GlcNAc kinase activities were determined in the cytosolic
supernatants of E. coli BL21 cells as described in Experimental proce-
dures. All values are means ± SD of five independent expressions.
4214 M. Berger et al.(Eur. J. Biochem. 269) Ó FEBS 2002
able GlcNAc kinase activities, indicating a successful
functional expression. However, these activities differ
widely among the mutants, in comparison with the wild-
type. The highest reduction of enzyme activity was found
for the mutant C131S, whereas the activity of C45S was
almost unchanged. This was a first hint that distinct
cysteines may have significant roles in substrate binding or
the catalytic mechanism of GlcNAc kinase.
Kinetic characterization of GlcNAc kinase
and cysteine mutants
In order to get a more detailed insight into the functions of
specific cysteine residues of GlcNAc kinase, the K
m
values
for both substrates, GlcNAc and ATP were determined for
all mutants and for the wild-type enzyme (Table 2). In
general, the decrease in enzyme activity of the mutants

correlated with increased K
m
values, suggesting a decreased
affinity to GlcNAc or ATP or both substrates. C131S
showed a 17-fold increased K
m
for GlcNAc, whereas the K
m
for ATP was increased only 2.5-fold. The opposite was
found for C143S, where the respective increases in K
m
were
fivefold for GlcNAc and 10-fold for ATP. Both mutants
therefore displayed a decreased substrate affinity, but the
K
m
values indicate that C131 probably plays a role in
GlcNAc binding, whereas C143 participates in binding of
both substrates.
The mutant C217S showed a sixfold increase in the K
m
for GlcNAc, whereas the K
m
for ATP was unchanged. This
suggests that C217 may have a role in GlcNAc binding. For
C211 and C268 the K
m
values for both substrates were
increased, suggesting that these mutations result in change
that influences the binding of GlcNAc as well as ATP. The

K
m
values of C45S are the same as for the wild-type enzyme,
so that C45 seems to have no role in substrate binding of
GlcNAc kinase.
Structure prediction of GlcNAc kinase
The results from the cysteine mutants suggest that C131
and C143 may be active site cysteines of GlcNAc kinase.
To support this a prediction of the secondary structure
based on the amino acid sequence was performed using
three different algorithms: PHDsec [18], PsiPRED [19]
and ProfPrediction [20]. Figure 4 shows the secondary
structures, which were predicted by all three methods. The
Table 2. Kinetic data of wild-type and mutated GlcNAc. All values are
means of at least three independent experiments.
Mutants K
m
GlcNAc (l
M
) K
m
ATP (l
M
)
Wild-type 230 ± 70 520 ± 100
C45S 240 ± 110 600 ± 270
C131S 3900 ± 600 1300 ± 300
C143S 1150 ± 270 5300 ± 1900
C211S 530 ± 150 1600 ± 250
C217S 1350 ± 310 600 ± 180

C268S 1100 ± 300 1000 ± 350
Fig. 4. Sequence alignment of glucokinase and GlcNAc kinase. The amino acid sequences are numbered beginning with the first amino acid of the
N-terminus. Both amino acid sequences share the ATP binding subdomains (Phosphate1, Connect1, Phosphate2, Adenosine, Connect2), and
secondary structures (I, II, and III). a-helices are indicated in bold, b-sheets are underlined. Mutated cysteine residues of GlcNAc kinase are labeled
with a star.
Ó FEBS 2002 Structure and function of GlcNAc kinase (Eur. J. Biochem. 269) 4215
secondary structure of GlcNAc kinase was compared with
that of glucokinase, because glucokinase seems to be most
closely related, at least among the well-characterized sugar
kinases. Thus, glucokinase and GlcNAc kinase share all
five subdomains of the ATP-binding domain of sugar
kinases with high sequence similarity (Fig. 4; [9]). Both
proteins have a similar molecular mass (glucokinase
50 kDa, GlcNAc kinase 39 kDa) without potential regu-
latory domains. Finally, GlcNAc kinase can also act as a
glucokinase when glucose is present at millimolar concen-
trations [21], which are necessary also for the activity of
glucokinase [22].
The distribution of a-helices and b-sheets in GlcNAc
kinase and glucokinase showed a very similar pattern.
Highest similarities were found within the ATP-binding
subdomains, indicating a common structure of the ATP-
binding sites of the two enzymes. Interestingly, five of the six
cysteines of GlcNAc kinase had an equivalent cysteine
in glucokinase, not always in a direct sequence homology,
but always within the common secondary structure:
C45
GlcNAc kinase
–C129
Glucokinase

(a-helix); C131
GlcNAc kinase
– C233
Glucokinase
(b-sheet); C143
GlcNAc kinase
– C252
Glucokinase
(b-sheet); C211
GlcNAc kinase
–C371
Glucokinase
(a-helix);
C217
GlcNAc kinase
– C382
Glucokinase
(a-helix). This suggests
that these homologous cysteines may have the same
function in GlcNAc kinase as in glucokinase.
In order to visualize a potential three-dimensional
structure of GlcNAc kinase with respect to the localization
of the cysteine residues, a three-dimensional model of
glucokinase was used [23]. Based on the sequence align-
ments of glucokinase and GlcNAc kinase and the common
ATP-binding domain, the GlcNAc kinase was fitted into the
glucokinase model using RasMol software. Figure 5 shows
the predicted structure of GlcNAc kinase with the localiza-
tion of the five ATP-binding subdomains and the secondary
structures common to glucokinase. Typical v-like lobes are

present, comparable to the hexokinase subunits [24]. One
lobe consists of the phosphate1 subdomain and the
predicted a-helix I. The other lobe consists of the phos-
phate2 and the adenosine subdomains, the predicted b-sheet
II and the predicted a-helix III. The two lobes are linked
with the Connect1 and Connect2 subdomains. Localization
of the substrate binding pockets is analogous to that of
hexokinase, with the ATP pocket in the adenosine sub-
domain and the sugar pocket on the opposite side within the
b-sheet II [25].
The positions of the cysteines of GlcNAc kinase are
displayed in Fig. 5B. Cysteines C211 and C45, whose
Fig. 5. Predicted three-dimensional structure
of GlcNAc kinase. (A) Front view of the three-
dimensional structure of GlcNAc kinase based
on a model of glucokinase. ATP binding
subdomains are highlighted in different gray
scales. Secondary structures in common with
glucokinase are indicated with: I, a-helix; II,
b-sheet; III, a-helix. (B) Top view of the three-
dimensional structure of GlcNAc kinase. The
relative positions of cysteines are labeled with
astar.
4216 M. Berger et al.(Eur. J. Biochem. 269) Ó FEBS 2002
mutation to serine had little or no effect on specific activity,
are localized outside the catalytic center. The cysteines,
whose mutation had a more marked effect on specific
activity, are localized near (C217) or within (C268) the ATP
binding domain. C131 and C143, which were suggested to
be active site residues, were found to be very close to the

area of phosphate transition. Therefore it can be concluded
that C131 and C143 are directly involved in binding the two
relevant functional groups of the kinase reaction, the
c-phosphate of ATP and the hydroxyl group at C6 of
GlcNAc, or they may even be involved in the catalytic
mechanism.
DISCUSSION
The most reactive functional group in a protein is, in
general, the sulfhydryl group of cysteine. Chemical reagents
are used to investigate the role of cysteine residues in
substrate binding and catalytic activity of enzymes [26].
Earlier investigations by our group, using chemical reagents,
identified two adjacent cysteine residues in GlcNAc kinase
[14]. In the present work all six cysteine residues of the
GlcNAc kinase were mutated to serine residues. With
the added help of a three-dimensional model, each of the
cysteine residues was checked for its role in the catalytic
mechanism of GlcNAc kinase. C131 and C143 seem to be
directly involved in the transfer of the c-phosphate from
ATP to the hydroxyl group at C6 of GlcNAc. This is
confirmed by the measured K
m
values for GlcNAc and
ATP, whereby mutations of C131 and C143 resulted in
strongly decreased affinities to both substrates.
It has been suggested that two cysteine residues in vicinal
positions are a general feature of the active site of enzymes
with phosphate binding sites [27]. In GlcNAc kinase these
cysteines seem to be C131 and C143. Their counterparts in
glucokinase are C233 and C252. Mutations of these

cysteines to serines have very similar effects on enzyme
activity and substrate binding in glucokinase and GlcNAc
kinase [28]. It can therefore be concluded that these cysteines
have an important and identical role in the enzymatic
mechanism of both kinases, presumably catalyzing the
transfer of the c-phosphate from ATP to GlcNAc/glucose.
C131 appears to be the cysteine of the phosphate donor site
during the catalytic mechanism, whereas C143 accepts the
phosphate and transfers it to C6 of GlcNAc. The closeness
of C131 to C143 can be seen in a three-dimensional model
of glucokinase in complex with glucose [29], where the
corresponding C233 is in the direct neighborhood of
Asn231, which binds the C4-hydroxyl group of glucose.
Kinetic data for C217S clearly display a role in the
binding of GlcNAc. C217 is located on a-helix III
(Fig. 5B). It can therefore be concluded that this a-helix
influences the sugar binding. C211 is also located on
a-helix III, and its presence results in an increase in the
K
m
value for GlcNAc. But C211S also showed an
increased K
m
value for ATP. This can be explained by
the closeness of this part of a-helix III to the adenosine
subdomain (Fig. 5). Structural changes due to the C211S
and C217S mutation may also have an allosteric effect on
other parts of the enzyme. The same explanation can be
given for the increased K
m

values of C268S; although
located on the adenosine subdomain, the mutation
obviously changes the structure of the sugar binding
domain. The results for C211S, C217S and C268S can
also be explained by an ineffective induced fit mechanism
of the mutated GlcNAc kinases. The induced fit mechan-
ism for sugar kinases was first described for hexokinase
[30]. Binding of the sugar results in a strong conforma-
tional change allowing the binding of ATP. Mutations of
amino acids involved in this mechanism therefore result in
lower affinities to both substrates.
Datta [31] reported for hog spleen GlcNAc kinase that its
activity is feed-back inhibited by UDP-GlcNAc. This
postulates an allosteric binding site for UDP-GlcNAc
within the GlcNAc kinase protein. But the structural model
of GlcNAc kinase does not reveal an obvious UDP-
GlcNAc binding site. Furthermore, purified rat liver
GlcNAc kinase [14] and recombinant mouse GlcNAc
kinase did not show any inhibition of their activities when
assayed in the presence of UDP-GlcNAc (data not shown).
This suggests that, at least for the rodent enzymes, no
regulation by UDP-GlcNAc takes place.
The present study combines results from site-directed
mutagenesis of distinct amino acids of an enzyme with
theoretical structural predictions based on known struc-
tures of related enzymes. Although the results from both
methods show good correlations, more detailed investiga-
tions are required. In order to obtain a detailed three-
dimensional structure of the enzyme by X-ray diffraction
analysis the crystallization of recombinant GlcNAc kinase

is in progress.
ACKNOWLEDGEMENTS
This work was supported by the Bundesministerium fu
¨
r Bildung und
Forschung, Bonn, the Fonds der Chemischen Industrie, Franfurt/
Main, and the Sonnenfeld-Stiftung, Berlin. We thank Dr T. A. Scott for
improving the English style of the manuscript.
REFERENCES
1. Schachter, H. (1991) The Ôyellow brick roadÕ to branched complex
N-glycans. Glycobiology 1, 453–461.
2. Hart, G.W., Kreppel, L.K., Comer, F.I., Arnold, C.S., Snow,
D.M.YeZ., Cheng, X., DellaManna, D., Caine, D.S., Earles, B.J.,
Akimoto, Y., Cole, R.N. & Hayes, B.K. (1996) O-GlcNAcylation
of key nuclear and cytoskeletal proteins: reciprocity with
O-phosphorylation and putative roles in protein multimerization.
Glycobiology 6, 711–716.
3. Reutter, W., Sta
¨
sche, R., Stehling, P. & Baum, O. (1997) The
biology of sialic acids. Insights into their structure, metabolism
and function in particular during viral infection. In Glycoscience,
Status and Perspectives (Gabius, H J. & Gabius, S., eds), pp. 245–
259. Chapman & Hall, Weinheim, Germany.
4. Wolosker, H., Kline, D., Bian, Y., Blackshaw, S., Cameron, A.M.,
Fralich, T.J., Schnaar, R.L. & Snyder, S.H. (1998) Molecularly
cloned mammalian glucosamine-6-phosphate deaminase localizes
to transporting epithelium and lacks oscillin activity. Faseb J. 12,
91–99.
5. Comb, D.G.R.S. (1958) Glucosamine metabolism. IV. Glucos-

amine 6-phosphate deaminase. J. Biol. Chem. 232, 807–827.
6. Boehmelt, G., Wakeham, A., Elia, A., Sasaki, T., Plyte, S., Potter,
J., Yang, Y., Tsang, E., Ruland, J., Iscove, N.N., Dennis, J.W. &
Mak, T.W. (2000) Decreased UDP-GlcNAc levels abrogate
proliferation control in EMeg32-deficient cells. EMBO J. 19,
5092–5104.
7. Ligos, J.M., Lain De Lera, T., Hinderlich, S., Guinea, B., Sanchez,
L., Roca, R., Valencia, A. & Bernad, A. (2002) Functional
Ó FEBS 2002 Structure and function of GlcNAc kinase (Eur. J. Biochem. 269) 4217
interaction between the ser/thr kinase PKL12 and GlcNAc kinase,
a prominent enzyme implicated in the salvage pathway for Glc-
NAc recycling. J. Biol. Chem. 277, 6333–6343.
8. Yamada-Okabe, T., Sakamori, Y., Mio, T. & Yamada-Okabe, H.
(2001) Identification and characterization of the genes for
N-acetylglucosamine kinase and N-acetylglucosamine-phosphate
deacetylase in the pathogenic fungus Candida albicans. Eur. J.
Biochem. 268, 2498–2505.
9. Hinderlich, S., Berger, M., Schwarzkopf, M., Effertz, K. &
Reutter, W. (2000) Molecular cloning and characterization of
murine and human N-acetylglucosamine kinase. Eur. J. Biochem.
267, 3301–3308.
10. Pastuszak, I., Drake, R. & Elbein, A.D. (1996) Kidney N-acet-
ylgalactosamine (GalNAc)-1-phosphate kinase, a new pathway of
GalNAc activation. J. Biol. Chem. 271, 20776–20782.
11. Hinderlich, S., Sta
¨
sche, R., Zeitler, R. & Reutter, W. (1997) A
bifunctional enzyme catalyzes the first two steps in N-acetylneur-
aminic acid biosynthesis of rat liver. Purification and
characterization of UDP-N-acetylglucosamine 2-epimerase/

N-acetylmannosamine kinase. J. Biol. Chem. 272, 24313–24318.
12. Sta
¨
sche, R., Hinderlich, S., Weise, C., Effertz, K., Lucka, L.,
Moormann, P. & Reutter, W. (1997) A bifunctional enzyme cat-
alyzes the first two steps in N-acetylneuraminic acid biosynthesis
of rat liver. Molecular cloning and functional expression of UDP-
N-acetyl-glucosamine 2-epimerase/N- acetylmannosamine kinase.
J. Biol. Chem. 272, 24319–24324.
13. Bork, P., Sander, C. & Valencia, A. (1992) An ATPase domain
common to prokaryotic cell cycle proteins, sugar kinases, actin,
and hsp70 heat shock proteins. Proc. Natl Acad. Sci. USA 89,
7290–7294.
14. Hinderlich, S., Nohring, S., Weise, C., Franke, P., Stasche, R. &
Reutter, W. (1998) Purification and characterization of N-acetyl-
glucosamine kinase from rat liver – comparison with UDP-N-
acetylglucosamine 2-epimerase/N-acetylmannosamine kinase.
Eur. J. Biochem. 252, 133–139.
15. Laemmli, U.K. (1970) Cleavage of structural proteins during
the assembly of the head of bacteriophage T4. Nature 227, 680–
685.
16. Altschul, S.F., Gish, W., Miller, W., Myers, E.W. & Lipman, D.J.
(1990) Basic local alignment search tool. J. Mol. Biol. 215, 403–
410.
17. Corpet, F. (1988) Multiple sequence alignment with hierarchical
clustering. Nucleic Acids Res. 16, 10881–10890.
18. Rost, B. & Sander, C. (1993) Prediction of protein secondary
structure at better than 70% accuracy. J. Mol. Biol. 232, 584–599.
19. Jones, D.T. (1999) Protein secondary structure prediction
based on position-specific scoring matrices. J. Mol. Biol. 292, 195–

202.
20. Ouali, M. & King, R.D. (2000) Cascaded multiple classifiers for
secondary structure prediction. Protein Sci. 9, 1162–1176.
21. Allen, M.B. & Walker, D.G. (1980) The isolation and preliminary
characterization of N-acetyl-
D
-glucosamine kinase from rat kidney
and liver. Biochem. J. 185, 565–575.
22. Meglasson, M.D. & Matschinsky, F.M. (1986) Pancreatic islet
glucose metabolism and regulation of insulin secretion. Diabetes
Metab. Rev. 2, 163–214.
23. St Charles, R., Harrison, R.W., Bell, G.I., Pilkis, S.J. & Weber,
I.T. (1994) Molecular model of human beta-cell glucokinase built
by analogy to the crystal structure of yeast hexokinase B. Diabetes
43, 784–791.
24. Fletterick, R.J., Bates, D.J. & Steitz, T.A. (1975) The structure of a
yeast hexokinase monomer and its complexes with substrates at
2.7-A resolution. Proc. Natl Acad. Sci. USA 72, 38–42.
25. Aleshin, A.E., Kirby, C., Liu, X., Bourenkov, G.P., Bartunik,
H.D., Fromm, H.J. & Honzatko, R.B. (2000) Crystal structures of
mutant monomeric hexokinase I reveal multiple ADP binding
sites and conformational changes relevant to allosteric regulation.
J. Mol. Biol. 296, 1001–1015.
26. Lundblad, R.L.N. & C.M. (1984) Chemical Reagents for Protein
Modification. CRC Press, New York.
27. Rippa, M., Bellini, T., Signorini, M. & Dallocchio, F. (1981)
Evidence for multiple pairs of vicinal thiols in some proteins.
J. Biol. Chem. 256, 451–455.
28. Tiedge, M., Richter, T. & Lenzen, S. (2000) Importance of cysteine
residues for the stability and catalytic activity of human pancreatic

beta cell glucokinase. Arch. Biochem. Biophys. 375, 251–260.
29. Mahalingam, B., Cuesta-Munoz, A., Davis, E.A., Matschinsky,
F.M., Harrison, R.W. & Weber, I.T. (1999) Structural model of
human glucokinase in complex with glucose and ATP: implica-
tions for the mutants that cause hypo- and hyperglycemia.
Diabetes 48, 1698–1705.
30. DelaFuente, G., Lagunas, R. & Sols, A. (1970) Induced fit in yeast
hexokinase. Eur. J. Biochem. 16, 226–233.
31. Datta, A. (1971) Studies on hog spleen N-acetylglucosamine kin-
ase. II. Allosteric regulation of the activity of N-acetylglucosamine
kinase. Arch. Biochem. Biophys. 142, 645–650.
4218 M. Berger et al.(Eur. J. Biochem. 269) Ó FEBS 2002