Báo cáo khoa học: Intermodule cooperativity in the structure and dynamics of consecutive complement control modules in human C1r Structural biology docx

Intermodule cooperativity in the structure and dynamics
of consecutive complement control modules in human C1r
Structural biology
Andra
´
sLa
´
ng
1,
*, Katalin Szila
´
gyi
2,
*, Bala
´
zs Major
2
,Pe
´
ter Ga
´
l
2
,Pe
´
ter Za
´
vodszky
2
and
Andra

´
s Perczel
1,3
1 Laboratory of Structural Chemistry and Biology, Institute of Chemistry, Eo
¨
tvo
¨
s Lora
´
nd University, Pa
´
zma
´
ny Pe
´
ter se
´
ta
´
ny 1 ⁄ A, Budapest,
Hungary
2 Institute of Enzymology, Biological Research Center, Hungarian Academy of Sciences, Budapest, Hungary
3 Protein Modeling Group HAS-ELTE, Institute of Chemistry, Eo
¨
tvo
¨
s Lora
´
nd University, Budapest, Hungary
Introduction

Complement is an effective serine protease cascade sys-
tem in the blood, whose purpose is to opsonize and
clear infectious particles and antigens [1]. This is
achieved by three parallel pathways, which converge in
common final steps to eliminate pathogens. The first
pathway is termed the ‘classical’ pathway, although it
is not the oldest one in evolutionary terms [2,3]. The
classical pathway recognizes immunocomplexes con-
Keywords
cooperativity; dynamics; flexibility;
modularity; NMR-spectroscopy
Correspondence
A. Perczel, Institute of Chemistry, Eo
¨
tvo
¨
s
Lora
´
nd University, H-1518, 112, PO Box 32,
Budapest, Hungary
Fax: (36 1) 372 2620
Tel: (36 1) 372 2600
E-mail:
Website:
*These authors contributed equally to this
work
(Received 26 May 2010, revised 22 June
2010, accepted 27 July 2010)
doi:10.1111/j.1742-4658.2010.07790.x

The modular C1r protein is the first protease activated in the classical
complement pathway, a key component of innate immunity. Activation of
the heteropentameric C1 complex, possibly accompanied by major inter-
subunit re-arrangements besides proteolytic cleavage, requires targeted
regulation of flexibility within the context of the intramolecular and inter-
molecular interaction networks of the complex. In this study, we prepared
the two complement control protein (CCP) modules, CCP1 and CCP2, of
C1r in their free form, as well as their tandem-linked construct,
CCP1CCP2, to characterize their solution structure, conformational
dynamics and cooperativity. The structures derived from NMR signal
dispersion and secondary chemical shifts were in good agreement with
those obtained by X-ray crystallography. However, successful heterologus
expression of both the single CCP1 module and the CCP1CCP2 constructs
required the attachment of the preceding N-terminal module, CUB2, which
could then be removed to obtain the properly folded proteins. Internal
mobility of the modules, especially that of CCP1, exhibited considerable
changes accompanied by interfacial chemical shift alterations upon the
attachment of the C-terminal CCP2 domain. Our NMR data suggest that
in terms of folding, stability and dynamics, CCP1 is heavily dependent on
the presence of its neighboring modules in intact C1r. Therefore, CCP1
could be a focal interaction point, capable of transmitting information
towards its neighboring modules.
Abbreviations
CCP, complement control protein; CCP1, first complement control protein module of C1r; CCP2, second complement control protein module
of C1r; CCP1CCP2, tandem of the two CCPs from C1r; CCP1
single,
single CCP1 module; CCP2
single,
single CCP2 module; CUB2CCP1CCP2,
a trimodular fragment of C1r; CCP1

CCP2,
CCP1 module in tandem CCP1CCP2;
CCP1
CCP2, CCP2 module in tandem CCP1CCP2; CUB2
CCP1,
CUB2 module in tandem CUB2CCP1; DLS, dynamic light scattering; MASP, mannose-binding lectin-associated serine protease;
R
1,
longitudinal relaxation; R
1,
transverse relaxation; RSDM, reduced spectral density mapping; s
e,
effective correlation time.
3986 FEBS Journal 277 (2010) 3986–3998 ª 2010 The Authors Journal compilation ª 2010 FEBS
taining antibodies of IgG or IgM isotypes. The recog-
nition is achieved by C1q, a disulfide-linked subunit of
the C1 heteropentameric protein, and leads to the
autoactivation of the C1r subunit, a modular serine
protease. In an extraordinary example of ‘action at a
distance’, an activation signal is then mechanically
transmitted to two molecules of C1r that are located
within the six collagen-like stems of C1q. The exact
details of this process are still largely unresolved.
The active C1r then activates the third subunit of C1,
a homologus serine protease called C1s. Both C1r and
C1s are present in duplicate copies within the C1 com-
plex, forming a tetramer. Both the autoactivation of
C1r and the activation of C1s require large-scale move-
ments of the different domains of the proteases. Inter-
modular and intramodular flexibilities are thought to

be essential in these movements. Expression of recom-
binant intact C1r [4] and its domain combinations in
insect cells and bacteria, has provided an opportunity
to study the mechanism of activation at an intramolec-
ular level.
The intact C1r is an 80-kDa trypsin-like modular
serine protease of 705 residues [5–7]. C1r contains six
modules of four different types. A post-translationally
hydroxylated Ca-ion-binding epidermal growth factor
domain [8–10], sandwiched between two CUB
(C1s ⁄ C1r, urchin epidermal growth factor, bone mor-
phogenetic protein) modules [11], contributes to the
formation of the complex with C1s and C1q in a
Ca
2+
-dependent manner [12]. The C-terminal proteo-
lytic fragment of C1r is termed c
B
or catalytic frag-
ment, and consists of tandem complement control
protein (CCP) and serine protease domains. This frag-
ment is responsible for all reported catalytic activity
and forms a homodimer in neutral solutions [13]. The
CCP2 module increases the thermal stability of the ser-
ine protease and enhances its C1s-cleaving activity.
CCP modules are common in the complement system
[14,15] and can also be found in proteins such as c-ami-
nobutyric acid type B receptor subunit 1a [16] and
interleukin-2 receptor-a [17]. The CCP of the interleu-
kin-2 receptor-a carries another, but atypical, CCP as

an insertion at its ‘hypervariable loop’ leading to two
strand-swapped CCP-like domains. Typical CCP mod-
ules [18] have four highly conserved cysteine residues
with an abab disulfide-pairing pattern, as well as a con-
served tryptophan and multiple invariable proline, gly-
cine and aromatic residues. The fold comprises two
antiparallel b-pleated sheets, which are formed by
strands B, D, F, G, E and H forming a b-sandwich.
The two disulfides are located close to the termini
of the module, which define the two apices of the some-
what ellipsoidal protein. CCP structures are highly
variable, with the invariant parts comprising mainly the
b-strands. The loops between strands B and C, known
as the ‘hypervariable loop‘, D and E, E and F, F and
G, and G and H are particularly tolerant of longer
insertions [19]. In multimodular proteins, however,
insertions in the F–G and D–E loops might affect inter-
modular interactions between consecutive CCP mod-
ules because these loops project towards the previous
(F–G) or the subsequent (D–E) CCP module. In gen-
eral, CCP modules mediate protein–protein [20–22]
and ⁄ or protein–carbohydrate [23–25] interactions.
Currently available backbone dynamics data, deter-
mined by NMR spectroscopy, show a diverse picture of
CCP mobility [26–34]. In general, segments with
increased mobility are candidates for interaction sites
[29]. In the present study, NMR spectroscopy was
applied to determine the backbone dynamics of the two
CCP modules from human C1r to locate the source of
flexibility needed for structural re-arrangement upon

autoactivation and to identify possible interaction sites.
Results
Expression, folding and stability of single and
tandem CCP modules
To distinguish between the different constructs investi-
gated in this study, we used the following notations:
first complement control protein module of C1r
(CCP1
single
) and second complement control protein
module of C1r (CCP2
single
) for the single CCP mod-
ules, and CCP1
CCP2
and
CCP1
CCP2 for the corre-
sponding modules within the covalently linked tandem
CCP1CCP2 (
#
1) module pair.
The products were expressed as insoluble inclusion
bodies. Only a small amount of CCP1
single
could be
obtained, whereas CCP2
single
was successfully produced
in the required quantity. However, fusion constructs

containing the N-terminal preceding CUB2 module,
CUB2CCP1, and a trimodular fragment of C1r
(CUB2CCP1CCP2) yielded sufficient amounts of prop-
erly folded proteins. The wild-type human protein does
not contain any post-translational modifications (e.g.
glycosylation) and thus it was expected that the pro-
karyotic host fulfills the basic requirements for produc-
tion of these constructs.
In terms of folding, as judged by differential scan-
ning calorimetry and CD spectroscopy, CCP2
single
was
properly folded when expressed as a single module,
whereas folded CCP1
single
and CCP1CCP2 (
#
2) could
only be obtained by thermolysin digestion of the
CUB2CCP1 and CUB2CCP1CCP2 constructs, respec-
tively. Furthermore, CD-spectroscopic and differential
A. La
´
ng et al. Flexibility and cooperativity of CCP modules
FEBS Journal 277 (2010) 3986–3998 ª 2010 The Authors Journal compilation ª 2010 FEBS 3987
scanning calorimetric measurements also revealed that
the thermal denaturation of both CCP2
single
at 54.3 °C
and CCP1CCP2 (

#
2) was reversible (data not shown),
in contrast to that of CCP1
single
, which is irreversible
with a melting temperature of 63.4 °C [35]. Both
folded modules are stable under ambient conditions.
To investigate possible multimerization ⁄ aggregation
of the samples caused by their high concentration
(about two to three times higher than that found in
serum from human blood), gel filtration and dynamic
light scattering (DLS) studies were performed on the
pair of modules. DLS showed the approximate molec-
ular mass of CCP1CCP2 (17259.6 Da) in the tempera-
ture range from 300 to 315K (Fig. 1). In conjunction
with gel filtration, this clearly excludes any significant
aggregation at the temperature range of our NMR
measurements.
Analysis of single modules
Backbone assignment and secondary chemical shifts:
the secondary structure of CCPs
1
H-
15
N correlation spectra of both CCP
single
modules
exhibited excellent signal dispersion in both dimensions
with minimal overlaps, indicative of well-folded globu-
lar structures at 300 K, pH 4.0–4.5 and pH 7.0.

Spin-system identification and
1
H,
a
H,
15
N backbone
assignment of each single module was obtained by 3D
N
H-
15
N-TOCSY-HSQC and 3D
N
H-
15
N-NOESY-
HSQC. Assignment of CCP1
single N
H-
15
N cross-peaks
was hampered by its large proportion of glutamine
residues (nine out of 73,  12.3%) but almost com-
plete assignment was achieved (except for T286–I289).
The large
1
H downfield shift (10.46 ppm) of the weak
L334 cross-resonance suggests strong H-bonding. All
backbone resonances of CCP2
single

were assigned at
both pH values, except for the four N-terminal resi-
dues (A353, S354, M355, I356) and G377. Addition-
ally, R399–G401 and E404 resonances were missing
only at pH 7.0.
Neutralizing the solutions resulted in a few back-
bone shifts, as monitored by 2D HSQC spectra. Imid-
azole groups of histidine residues (pK
a
 6.0) are
expected to be deprotonated at neutral pH. Significant
changes in backbone amide shifts were indeed
observed for H335, H348 (CCP1
single
) and H390
(CCP2
single
), and for some nearby residues (Fig. S1).
H335 displays a significant downfield shift in both
dimensions (
N
H and
15
N), whereas the cross-peaks of
H348 and H390 migrate mainly along the
15
N dimen-
sion upon the elevation of pH. The preceding L334
was not clearly visible at acidic pH (however, it gave
an NOE cross-peak to the H335 amide), whereas it

could be clearly identified at neutral pH. Furthermore,
N
H of M351, R399, A400, G401 and E404 are only
observable at pH 4.5.
Comparison of secondary
a
H chemical shifts at
acidic and neutral conditions revealed no major differ-
ences, and shifts under both conditions were in good
agreement with the secondary structure observed in the
crystal structures of C1r CCPs [36,37] and other CCP
modules (Figs S2–S9). Therefore, we conclude that a
change in pH within our examined range did not sig-
nificantly disturb modular integrity, although local
effects were shown. Both single module structures are
therefore essentially similar to those observed in the
crystal structure of multimodular constructs. We note
that, in general, conserved residues do not necessarily
exhibit similar chemical shifts caused by differences in
their microenvironment [38].
Relaxation data of single modules
To characterize the inherent flexibility of the single
modules, longitudinal (R
1
) and transverse ( R
2
) relaxa-
tion, as well as {
1
H}-

15
N NOE measurements, were
made at 11.7 T. These relaxation data were acquired
and analyzed for both CCP
single
modules at pH 4.0–4.5
and pH 7.0 at 300K (Table S1).
The R
2
⁄ R
1
value, which satisfactorily correlates with
the overall re-orientation time (s
c
) of well-folded pro-
teins, was calculated for CCP
single
modules at both pH
values. Because of more complete assignment, we
Fig. 1. Good correspondence between the calculated (dotted
horizontal line) and measured (
#
2, unfilled triangle) molecular mass
of thermolysin-treated CCP1CCP2 indicates monomer forms in the
temperature range of 300–315 K. In the same temperature range,
the first construct (
#
1, filled circle) is not a monomer, as shown
by DLS data.
Flexibility and cooperativity of CCP modules A. La

´
ng et al.
3988 FEBS Journal 277 (2010) 3986–3998 ª 2010 The Authors Journal compilation ª 2010 FEBS
focused on relaxation data obtained at the lower pH
(data acquired at pH7.0 are listed in Tables S1 and
S2). Although larger (9358.6 Da), the lower R
2
⁄ R
1
value of CCP2
single
(2.681 ± 0.356) suggests a faster
overall re-orientation than that for CCP1
single
(8564.7 Da and 2.957 ± 0.359) (Table S1). The E–F
loop of CCP2
single
could not be fully traced in the
available X-ray structures [Protein Data Bank (PDB)
entries 1gpz, 2qy0], and the corresponding residues
(R399–Q407) exhibited an R
2
⁄ R
1
ratio (2.276 ± 0.352)
below the average, with a low {
1
H}-
15
N NOE (0.301)

also. Corresponding cross-resonances were absent at
the higher pH value. All these data indicate that the
E–F loop is mobile on the ps to ns timescale. High
R
2
⁄ R
1
values, indicating slow timescale motion (lsto
ms), were observed for residues K419–K423 and E425,
giving a value of 3.134 ± 0.435 for the G–H loop
average (K419–I427).
For CCP1, a high R
2
⁄ R
1
value was observed for
C341, D344, R349 and A350 (R
2
⁄ R
1
> 3.4) and indi-
cated ls to ms timescale NH vector re-orientation.
Except for the N-terminus, low R
2
⁄ R
1
values (< 2.5)
for residues F301, T302, H335 and S336 showed effec-
tive relaxation mechanisms on the ps to ns timescale.
Model-free analysis of single modules

Model-free analysis of CCP1
single
and CCP2
single
at both
pH values was applied in order to obtain a detailed pic-
ture of residual motions of all the amide NHs within the
molecules. Local NH flexibility is typically given in
terms of the square of the generalized order parameters,
S
2
, as the rate of physical restriction of NH motion, and
of effective correlation time, s
e
, on the ps to ns range.
Extremely fast local motion is indicated by dissecting S
2
to provide its proportion, S
f
2
. We applied isotropic
motional description because of its simplicity and
robustness. Here, we focus on the backbone dynamics at
pH 4.0–4.5 (Tables S3 and S4) whereas the results at
pH 7.0 are given in (Tables S5 and S6).
Both CCP
single
modules at both pH values exhibited
high S
2

values (> 0.8) in general, which are character-
istic of well-folded globular proteins. In CCP1
single
,
small S
2
values of NH (S
2
< 0.8), representing larger
amplitude motions, were found at the N-terminus (up
to L307) extending to the ‘HVL’ (except D299 and
I303) at pH 4.0. Increased local backbone flexibility
was also detected at loops E–F (N331–S336) and G–H
(R349–A350) and at the C-terminus (Fig. 2 and Table
S3), as well as in the ‘hypervariable’ B–C loop and the
D–E turn. Dissection of ps to ns timescale motions by
introducing the S
f
2
parameter was necessary for resi-
dues F301, T302 and H335, which showed very rapid
internal motion. By contrast, significant contributions
from the slower ls to ms scale backbone motions (R
ex
)
were observed for residues A350, R349, C341, E300
and N331.
For CCP2
single
, residues with low S

2
values (< 0.8)
were located at the N-terminus (up to L365 except for
C359) and C-terminus, in the D–E turn around P392
and in the highly mobile E–F loop (T398–Q407) at pH
4.5 (Fig. 2 and Table S4). Crystallographic B-factors
determined for this loop [36,37] were in accordance
with our NMR results. Furthermore, the observed
backbone proton (
a
H and
N
H) chemical shifts of most
of these residues were close to random-coil values con-
sistent with increased mobility (Fig. S2). Residues
exhibiting more restricted motion are located not only
in b -strands (from B to H) but also in the ‘hypervari-
able’ B–C loop. Conformational exchange (R
ex
) was
detected for residues E425, E421, G408, K423, T398
and K419. Distinct rapid local motion was indicated
by the significant s
e
of G424 and G401, for which resi-
dues the inclusion of an S
f
2
term was also found to be
necessary.

In general, similar mobility patterns were observed
at neutral pH for both modules (Tables S5 and S6).
However, the A–B turn in CCP1
single
loses much of its
local mobility (S
2
> 0.8), which might be the result of
D299 side-chain deprotonation and carboxylate inter-
action with the amide NH of C354, as observed in
both crystal structures [36,37]. This atypical b-turn is
therefore not only sequentially, but also dynamically,
unique in the known CCP folds.
Analysis of the covalently linked CCP1CCP2
module pair
Spectral properties of CCP1CCP2: chemical shift
perturbation analysis as a result of CCP1 and CCP2
Two different CCP1CCP2 constructs were investigated.
The first (
#
1) contained a non-native stretch of three
residues at the N-terminus originating from the con-
struct. The second (
#
2) was the thermolysin-digested
CUB2CCP1CCP2. At 280 K, 300 K and pH 4.0, or at
300 K and pH 7.0, HSQC spectra of both CCP1CCP2
constructs (Figs S10 and S11) showed highly overlap-
ping peaks in the middle of the amide region (close to
random coil values) and also gave resonances previ-

ously unobserved in single CCPs. Additionally, many
peaks were weak. These observations suggest that the
proteins were not properly folded under the conditions
applied. However, at a slightly elevated temperature
(320 K, pH 4.0 and 315 K, pH 7.0), a better-quality
HSQC spectrum with more resolved peaks could
be obtained for the second construct (
#
2) initially
A. La
´
ng et al. Flexibility and cooperativity of CCP modules
FEBS Journal 277 (2010) 3986–3998 ª 2010 The Authors Journal compilation ª 2010 FEBS 3989
containing the CUB2 module and obtained by therm-
olysin digestion (Figs S10 and S11). All data reported
below refer to this construct.
Backbone NH cross-resonances of residues in the
single and tandem CCP modules were compared at
300 K and pH 7.0. At neutral pH, fewer resonance
overlaps were observed than under acidic conditions
(Fig. S12). Chemical shift changes in the tandem
CCP1CCP2 construct relative to the free modules are
shown in Fig. 3. In general, the chemical shift changes
were small with the exception of the vicinity of two
aromatic residues, namely Y325 in CCP1 (D–E turn)
and Y381 of CCP2 (C–D turn), which were located at
the interface between the two modules. Remarkable
changes were also observed in the intermodular linker
and at the F–G turn in CCP2. This suggests that both
modules maintain their modular integrity; nevertheless,

there is a well-defined interface region between the two
modules that is formed primarily by the two aromatic
residues.
CCP1CCP2 flexibility (relaxation data and reduced
spectral density values)
Relaxation parameters for CCP1CCP2 were obtained
at 315 K and pH 7.0 (Fig. 4). In general,
CCP1
CCP2
A
B
Fig. 2. General order parameters for CCP
single
modules (A, CCP1; and B, CCP2) at acidic (filled circle) and neutral (unfilled triangle) pH and
300 K. The overall rotation correlation times are as indicated (acidic ⁄ neutral, respectively) completed with the value calculated by HydroPro.
The positions of b-strands are indicated with black boxes at the bottom of each panel.
Flexibility and cooperativity of CCP modules A. La
´
ng et al.
3990 FEBS Journal 277 (2010) 3986–3998 ª 2010 The Authors Journal compilation ª 2010 FEBS
has smaller R
1
values than CCP1
CCP2
, whereas the
opposite is found for R
2
values. Consequently, the
average R
2

⁄ R
1
ratio is higher in
CCP1
CCP2 than in
CCP1
CCP2
, which is exactly the reverse of the situation
observed for the CCP1
single
and CCP2
single
modules
and probably reflects the complex interdependence of
the modules in terms of internal dynamics and may
also be a consequence of the large anisotropy (devia-
tion from the ideal spherical shape) of the tandem
module pair relative to the single modules. This
Fig. 3. Interaction of tandem CCP modules is restricted to its interface (pH 7.0 and 300 K). Changes of residues at the interface region in
both modules are indicated with color-coded arrows. Interaction of CCP modules is mapped on both faces of the surface representation of
the crystal structure (2qy0). b-strands are indicated with black boxes. Color-coding: yellow > 0.15; orange > 0.30; red > 0.50. Combined
chemical shifts were obtained as described previously [39]. The linker colored light brown is slightly ambiguous.
AB
CD
CCP
single
CCP
single
CCP
single

CCP
single
Fig. 4. Relaxation data of the CCP modules. (A) R
1
( 543.0 ± 56.2 ms), (B) R
2
( 75.6 ± 12.3 ms), (C) {
1
H}-
15
N NOE (0.608 ± 0.163) and
(D) R
2
⁄ R
1
of CCP1CCP2 at pH7.0, 315 K (filled circle) and of CCP
single
at pH7.0, 300 K (hollow triangle). The positions of the b-strands are
indicated with black boxes at the bottom of each panel. Horizontal solid and dotted lines indicate mean and 1 SD values for single and
tandem constructs.
A. La
´
ng et al. Flexibility and cooperativity of CCP modules
FEBS Journal 277 (2010) 3986–3998 ª 2010 The Authors Journal compilation ª 2010 FEBS 3991
discrepancy is also apparent in the absolute values of
the calculated rotational diffusion correlation times, as
the s
c
of CCP1
single

(s
c
‡ 5.0 ns) at both pH values is
larger than that of CCP2
single
(s
c
 4.7 ns), which is
otherwise a larger molecule, and hydrodynamic calcu-
lations yield values of 5.2 and 5.6 ns, respectively.
R
2
values (13.32 ± 2.14) are consistent with the
increase in molecular size relative to the single modules
(CCP1
single
: 7.47 ± 1.35 and CCP2
single
: 7.16 ± 1.02).
{
1
H}-
15
N NOE and R
1
values, primarily indicative of
motions on the ps-ns timescale, show major changes
mainly in the CCP1 module. Low {
1
H}-

15
N NOE val-
ues indicate remarkably rapid (ps to ns) local mobility
in residues of the B–C loop and, to a lesser extent, in
the E–F and G–H loops; the R
1
values indicate mobil-
ity changes in the E–F loop. In general, the {
1
H}-
15
N
NOE values show a much more diverse distribution in
CCP1
CCP2
than in CCP1
single
, possibly corresponding
to an overall gain of fast timescale flexibility. By con-
trast, the large flexibility of the E–F loop in CCP2
seems to be retained in the tandem construct. R
2
val-
ues, bearing information on ls to ms motions, are
higher in both modules of the tandem construct than
in the free modules, with increases apparent at the
interfaces A–B (E300), D–E (Y325) and C–D (Y381),
near the F–G turns of CCP2 (T411, C412, I417 and
W418) and near the linker region (G360).
For the tandem module, the model-free approach

did not yield satisfactory results [e.g. the rotational
diffusion correlation time obtained from NMR data
(9.318 ns for CCP1 and 9.872 ns for CCP2) deviated
remarkably from that estimated by hydrodynamic
calculations (12.640 ns) based on the crystal structure]
[37]. Therefore, we turned to reduced spectral density
analysis (RSDM) [40,41]. RSDM evaluates three such
values sensitive for slow or overall (at x=0), interme-
diate (x
N
) and rapid (0.87x
H
) local motions. Such
analysis of CCP1CCP2 clearly shows the shift of J(0)
to larger values compared with CCP
single
, in accor-
dance with the slower re-orientation (i.e. higher s
c
)of
the molecule (Fig. 5). The smaller shift observed for
the values of CCP1 is in agreement with the smaller
difference in the R
2
⁄ R
1
ratio of the corresponding resi-
dues after attachment of CCP2. The larger dispersion
along both dimensions in CCP1CCP2 probably indi-
cates the increased anisotropy of the molecule. In

CCP1, the outliers along J(0) are A350 [the largest
J(0); filled circles in Fig. 5 ] in CCP1
single
and S336 [the
smallest J(0); open triangles in Fig. 5 ] in CCP1
CCP2
,
indicating the slow and rapid
N
H re-orientations of
these residues, respectively.
Discussion
We have successfully expressed and purified the two
CCP modules of the human complement protein C1r,
both individually and as a fused construct. Whereas
folded CCP2 was easily produced, properly folded
CCP1 could only be obtained using a thermolysin-
cleaved, folded CUB2CCP1 construct. Similarly, enzy-
matic cleavage of CUB2CCP1CCP2 resulted in
CCP1CCP2, which was folded and stable, as judged
by NMR and dynamic light-scattering measurements.
NMR signal dispersion and secondary chemical
shifts showed that the obtained proteins were properly
folded and their structures were consistent with the
general CCP fold. According to DLS measurements,
undesired aggregation or oligomerization did not occur
AB
Fig. 5. Intermediate versus slow timescale-sensitive reduced spectral-density values correlated for residues from CCP1 (A) and from CCP2
(B) both in single at 300 K (hollow triangle) and in tandem at 315 K (filled circle) constructs at pH7.0. The solid line represents reduced
spectral-density values reduced to single motion in a fully isotropic case. For simplicity, residues from the linker (355KIKD) are not shown.

Flexibility and cooperativity of CCP modules A. La
´
ng et al.
3992 FEBS Journal 277 (2010) 3986–3998 ª 2010 The Authors Journal compilation ª 2010 FEBS
under the conditions applied and therefore the
constructs could be reliably used to assess the interde-
pendence of the modules. This was corroborated by
the calculated s
c
values of the tandem construct based
on R
2
⁄ R
1
data, which do not indicate any increase in
molecular size above that expected based on hydrody-
namic calculations. Internal mobility data are also in
good agreement with previous structural studies; this
was most prominently exemplified by the S
2
parame-
ters of the E–F loops of the modules where the
increased mobility observed for CCP2 was also
reflected by the corresponding poor electron density in
the crystal structure [36,37]. These observations were
valid at both at pH 4.0–4.5 and pH 7.0 for the single
modules, indicating no major conformational transi-
tion upon pH change.
Chemical shift changes detected upon the transition
from acidic to neutral conditions were primarily

located in the sequential or structural vicinity of histi-
dines and thus may reflect minor conformational
changes induced by the protonation ⁄ deprotonation of
the imidazole side-chains [42]. This might affect ionic
contacts of histidines with aspartate and ⁄ or glutamate
residues. In the light of atomic structures of CCP1 and
CCP2 (2qy0 [36] and 1gpz [37]), this perturbation
might indicate that in CCP1, the side chain of H335 is
fully exposed, whereas that of H348 is close to the
backbone
N
H of V340. The protonation change of the
only His in CCP2, namely H390, affects residues at
strand B (368GDF sequence) and therefore might indi-
cate an ionic interaction with D369. Inspection of four
complement molecules from the ‘classical’ and ‘lectin’
pathways, each containing two CCPs, indicates that
the homologus interaction seems important to dock
the b-strand B to strand D (Table S7). Such ionic con-
tacts, like in C1r CCP2, may contribute to fold stabil-
ity in mannose-binding lectin-associated serine
protease (MASP)1 ⁄ 3 CCP1, MASP2 CCP1 and CCP2,
and C1s CCP2, whereas in C1r CCP1 and C1s CCP1,
polar and hydrophobic interactions are likely to be
dominant, respectively.
The presence of the CCP1 module, preceding the
catalytic fragment, is required to form the c
B
dimer
(made up of two CCP1CCP2SP molecules) at neutral

pH, but dimerization does not occur at pH values
lower than 5.5 [13]. Because the largest changes upon
pH alterations were detected at and near histidines
(H335 and H348), these residues are strong candidates
for inducing minor conformational changes and ⁄ or
forming pH-dependent interaction sites on CCP1.
Surface turns and loops with increased mobility can
provide easily variable protein–protein interaction sites
in proteins. In CCP1, the A–B turn has a unique
sequence among CCPs, as F301 occupies a position of a
Gly that is conserved in other modules. Side-chain
atoms of F301 form aromatic stacking interactions with
those of Y325 and act in synergy with the D299 (carbox-
ylate Od2)–C354 (amide H) hydrogen bond to promote
an unconventional geometry of the A–B turn with
increased flexibility when the D299 side-chain carboxyl-
ate is protonated (at pH 4.0). In CCP1
CCP2
at pH 7.0,
the ‘hypervariable’ B–C loop can be characterized by
rapid local motion, a feature that may be linked to its
interaction capacity with other molecules, as it is clearly
seen in the crystal structures [36,37]. The E–F loop has
different dynamics in CCP1 and CCP2, dominated by a
slow timescale (ls to ms) conformational exchange in
the former, while showing increased mobility (S
2
values
as low as 0.5) on the ps to ns timescale in the latter. The
G–H loop can be characterized by significant motions

on the ls to ms timescale in both of the free modules.
Thus, these loops are strong candidates for binding sites
of other complement and ⁄ or regulatory proteins. The
large insertion between E and F strands in C1r CCP2 is
atypical in CCP modules; in particular, it is absent from
the three closest human CCP2 homologs (MASP-1 ⁄ 3,
MASP-2 and C1s).
Modules are often defined as domains (i.e. autono-
mous folding and functional units) that occur in
diverse proteins. Thus, constructs containing domains
and their combinations that were different from those
of the modular C1r protein were expected to be easily
obtainable in folded and functional forms. However,
both the single CCP1 and the tandem CCP1CCP2
construct required an alternative strategy for efficient
production: only variants expressed in fusion with the
CUB2 module at their N-terminus were expressed and
folded properly and could then be cleaved to yield the
desired modules. This suggests that the CUB2 domain
might have a chaperoning role in the folding of the
CCP1. By contrast, interdependence of the two CCP
modules in the tandem construct is apparent, such as
the observed spectral properties of CCP1CCP2 at 300
and 320 K, as well as changes both in chemical shifts
and mobility parameters compared with those of the
free domains. Residues in the B–C, E–F and G–H
loops of CCP1 display deviations between CCP1
single
and CCP1
CCP2

in both of their {
1
H}-
15
N NOE and R
2
values (these R
2
changes are far greater than the gen-
eral increase of R
2
values according to the molecular
mass change). This is also consistent with the other-
wise elusive observation that the rotational correlation
times of the free modules are in reverse order com-
pared with those in the CCP1CCP2 tandem construct.
Comparison of C1r CCP data with previous CCP
module pair structures and mobility data shows that
A. La
´
ng et al. Flexibility and cooperativity of CCP modules
FEBS Journal 277 (2010) 3986–3998 ª 2010 The Authors Journal compilation ª 2010 FEBS 3993
the C1r inter-CCP flexibility is most likely similar to
that described for the CCP3CCP4 of viral complement
proteins [26] as a few hydrophobic interface residues
are well conserved. Although there are also important
differences, namely a shorter ‘HVL‘ loop, and the
presence of a tyrosine in strand C of CCP4 in place of
an asparagine in C1r CCP2 (N379), and based on the
results of the present perturbation study, we suggest

that the inter-CCP flexibility in C1r is restricted by
two nearby aromatic residues (Y325 and Y381).
In summary, our results suggest that folding, flexibility
and the implicated partner-binding ability of C1r CCP1
are all affected by neighboring modules in the intact C1r
molecule. These results imply that CCP1 might act as a
central effector site towards partner molecules as it is
capable of sensing alterations in neighboring modules
caused by various effects. In particular, the B–C, E–F
and G–H loops in CCP1, which are affected by the pres-
ence of CCP2, are candidates for such a function.
Internal mobility is a key factor in a multitude of
biomolecular interactions [43], and complement prote-
ases are surely no exception. Our observation that the
internal dynamics of a module can be modulated by
neighboring domains offers a new way to understand
the regulation of multidomain proteins and challenges
the generally accepted view that domains are indepen-
dent functional and folding units. Therefore, the reduc-
tionist approach for modular proteins (i.e. dissection
to smaller building blocks), their analysis and subse-
quent extrapolation to the full-length protein is not
always feasible for understanding the biological func-
tion (e.g. [44,45]). Nevertheless, it is clear that consecu-
tive CCP modules do exemplify a wide range of cases,
from independence to tight intermodular contacts
[46–48], manifesting an excellent opportunity for evolu-
tion to fine-tune macromolecular behavior and interac-
tions. Our results are in agreement with the previous
observations of Major et al. [35], showing that the

CUB2–CCP1 fragment plays an important regulatory
role in the autoactivation of C1r. The structure of the
CUB2 domain changes considerably upon Ca
2+
bind-
ing, and this effect is likely to be transmitted by the
CCP1 module towards the catalytic region of C1r.
Materials and methods
Construction of recombinant plasmids for
expression of the CCP modules of C1r
The cDNA fragments corresponding to the CCP2 (I356–
V433), CCP1CCP2 (I289–V433), CUB2CCP1 (Q173–D358)
and CUB2CCP1CCP2 (Q173–V433) modules of C1r were
amplified by PCR using the full-length cDNA template.
For the amplification procedure the following forward and
reverse primers were used, respectively:
CCP2: CGCGCTAGCATGATCAAGGACTGTGGG
CAGCCC and CGC
GAATTCTCACACTGGCAAGC
ACCGAGGAATCT;
CCP1CCP2: CGC
GCTAGCATGATCATCAAGTGCC
CCCAGCCC and CGC
GAATTCTCACACTGGCAA
GCACCGAGGAATCT;
CUB2CCP1: CGC
GCTAGCATGACTCAGGCTGAG
TGCAGCAGC and CGC
GAATTCTCAGTCCTTGA
TCTTGCATCTGGG;

CUB2CCP1CCP2: CGC
GCTAGCATGACTCAGGCT
GAGTGCAGCAGC and CGCGAATTCTCACACT
GGCAAGCACCGAGGAATCT.
The PCR products were digested with NheI and EcoRI
(cleavage sites underlined) and ligated into the pET-17b
expression vector (Novagen, Darmstadt, Germany). As a
result, the recombinant proteins contain an extra tripeptide
(A-S-M) at their N-terminus. The constructs were verified
by DNA sequencing.
Expression, isotope labeling, renaturation and
purification of the recombinant proteins
Expression, inclusion-body isolation and solubilization were
performed as previously described [13]. For isotope label-
ing, cultures were grown on M9 minimal medium supple-
mented with thiamine, trace metals [49], ampicillin and
chloramphenicol. Starter culture was grown for 4–5 h, and
then the cells were collected and used to inoculate 1 L of
minimal medium supplemented with 1 g of
15
NH
4
Cl
(National Institute of Research and Development for Isoto-
pic and Molecular Technologies, Cluj-Napoca, Romania)
for
15
N-labeling and 2 g of
13
C-glucose (Cambridge Isotope

Laboratories, Inc., Andover, MA, USA) for
13
C-labeling.
Cells were grown in a BioStat B (Braun, Sartorius,
Go
¨
ttingen, Germany) fermentor for 12 h. The solubilized
proteins (20 mgÆmL
)1
) were diluted 400-fold into the refold-
ing buffers [50 mm Tris ⁄ HCl (pH 8.3), 5 mm EDTA and
145 mm NaCl in the case of CCP2, or 2 m GuHCl in the
case of CCP1CCP2] or 125-fold for CUB2CCP1 and
CUB2CCP1CCP2 (pH 8.5, 750 mm Arg, 500 mm GuHCl
and 5 mm CaCl
2
). In each case, the refolding buffers con-
tained 3 mm reduced glutathione and 1 mm oxidized gluta-
thione. The renaturation process was conducted at 15 °C
overnight (2 days at 10 °C for CUB2-containing con-
structs). The solutions of the renatured proteins were dia-
lyzed against 50 mm Tris ⁄ HCl (pH 8.3) containing 145 mm
NaCl, and filtered through a glass filter, or, for CUB2-con-
taining constructs, were dialyzed twice against 20 mm
Tris ⁄ HCl (pH 8.0) containing 5 mm NaCl and 5 mm CaCl
2
,
and filtered through a 0.22-lm membrane filter. Renatured
proteins were purified on an SP Sepharose XL column
Flexibility and cooperativity of CCP modules A. La

´
ng et al.
3994 FEBS Journal 277 (2010) 3986–3998 ª 2010 The Authors Journal compilation ª 2010 FEBS
(Pharmacia Biotech, Uppsala, Sweden) equilibrated with
50 mm Tris ⁄ HCl (pH 8.3) containing 50 mm NaCl, and the
elution was conducted with a linear, 50–1000 mm gradient
of NaCl. The recombinant proteins were further purified
using an SP Sepharose HP column (GE Healthcare, Little
Chalfont, Buckinghamshire, UK), and the fractions were
identified by SDS ⁄ PAGE. CUB2CCP1 and CUB2CCP1C
CP2 renatured proteins were purified by Q Sepharose
ion-exchange chromatography and gel filtration on a
Sephacryl S100 column.
Limited proteolysis of C1r CCP1 and CCP1CCP2
and determination of protein concentration
Both CUB2-containing constructs were digested with
thermolysin at 37 °C [50] at an enzyme ⁄ substrate molar
ratio of 1 : 40. The reaction was stopped by the addition of
10 mm EDTA. The products were dialyzed against 50 mm
Na-acetate, 10 mm NaCl, 5 mm EDTA (pH 4.0). C1r CCP1
and CCP1CCP2 were purified by chromatography on an SP
Sepharose HP cation-exchange column in the same buffer
and eluted by application of an increasing ionic-strength
gradient. Both fragments were verified by MS.
The concentration of recombinant proteins was deter-
mined by measuring the absorbance at 280 nm using the
absorption coefficients 1.1, 1.6 and 1.4 (1%, 1 cm) for the
CCP1, CCP2 and CCP1CCP2 fragments, respectively. For
calculating absorption coefficients, we used the method of
Gill et al. [51], taking disulfide bridges into account. The

relative molecular mass values calculated from the amino
acid sequences were 8565, 9359 and 17 260 for CCP1
single
,
CCP2
single
and CCP1CCP2, respectively.
NMR spectroscopy
All NMR experiments were acquired on a Bruker DRX500
NMR spectrometer using a protein solution of  1.5 mm at
300, 310, 315 and 320 K. Samples were dissolved, each at a
final concentration of 10 mm, in Na-acetate ⁄ NaCl buffer
containing 2 mm NaN
3
in an H
2
O:D
2
O ratio of 9 : 1, at pH
values of 4.0, 4.5 and 7.0. Spectra typically contained 4K*64
data points in 2D experiments and 2K*256*64 data points in
3D experiments. Data processing and resonance frequency
assignment were completed using NMRPipe [52], Sparky [53]
and Xeasy [54]. Whereas backbone resonance assignment of
the CCP
single
could be achieved using standard 3D
15
N-TOC-
SY-HSQC and

15
N-NOESY-HSQC spectra [55], resonances
in the CCP1CCP2 construct were assigned by triple-reso-
nance experiments [HNCA and HN(CO)CA [56], as well as
CBCACONH [57,58] and HNCACB experiments]. Based on
heteronuclear
1
H-
15
N correlation experiments [59], chemical
shift differences were calculated as reported previously [39].
For investigations of
H
N backbone dynamics, R
1
and R
2
relaxation measurements, as well as {
1
H}-
15
N NOE experi-
ments, were performed [60]. Peak intensities were deter-
mined using Sparky [53], and relaxation parameters were
fitted with the Levenberg–Marquardt algorithm. The R
1
and R
2
delay times applied can be found in Table S8.
Hydrodynamic calculations for estimating the rotational

correlation times were performed using the program Hydro-
Pro [61].
Identification of residues with slow and fast timescale
motions was performed as described by Clore et al. [62].
Residues with a high R
2
⁄ R
1
(mean + 1 SD) ratio are
likely to exhibit R
ex
contribution, whereas low R
2
⁄ R
1
(mean ) 1SD) is indicative of s
e
contribution. These resi-
dues, along with those that produced unresolved (overlap-
ping) peaks were generally excluded from initial s
c
calculations (listed in Tables S1–S6).
Dynamics interpretation of relaxation values
Backbone dynamics of CCPs were calculated from relaxa-
tion parameters using both the model-free approach [63]
and RSDM [41]. Model-free analysis was carried out with
the program Tensor2 [63] using an isotropic diffusion model,
whereas RSDM was performed with an in-house program
using the equations described in Krizova et al. [41].
Gel filtration and DLS measurements

Gel filtration and DLS experiments were performed in
10 mm Tris ⁄ 1mm EDTA (pH 7.0). For gel filtration, a
Superose 12 column (Pharmacia, Stockholm, Sweden) was
used at room temperature ( 300 K). The flow rate was
1mLÆmin
)1
and UV absorbance at 280 nm was monitored
for detection of the proteins. For DLS, a DynaPro Titan
(Wyatt Technology Co., Santa Barbara, CA, USA) instru-
ment was used with DP-TH-03 (laser power 60 mW; range
used 10–15%) and a DT-TC-04 temperature-controlled
microsampler.
Acknowledgements
The authors are grateful to Zolta
´
nGa
´
spa
´
ri and Luka
´
s
ˇ
Z
ˇ
ı
´
dek for their help in the interpretation of relaxation
data and for their guidance when performing RSDM.
We also thank A. K. Fu

¨
ze
´
ry for critical reading of the
manuscript. This work was supported by grants from
ICGEB (CRP ⁄ HUN08-03), the Hungarian Scientific
Research Fund (OTKA K72973, NK-77978 and NI-
68466) and A
´
nyos Jedlik grant NKFP 07 1-MA-
SPOK07 from the Hungarian National Office for
Research and Technology.
References
1 Zipfel PF & Skerka C (2009) Complement regulators
and inhibitory proteins. Nat Rev Immunol 9, 729–740.
A. La
´
ng et al. Flexibility and cooperativity of CCP modules
FEBS Journal 277 (2010) 3986–3998 ª 2010 The Authors Journal compilation ª 2010 FEBS 3995
2 Walport MJ (2001) Complement. First of two parts.
N Engl J Med 344, 1140–1144.
3 Walport MJ (2001) Complement. Second of two parts.
N Engl J Med 344, 1058–1066.
4Ga
´
lP,Sa
´
rva
´
ri M, Szila

´
gyi K, Za
´
vodszky P &
Schumaker VN (1989) Expression of hemolytically
active human complement component C1r proenzyme
in insect cells using a baculovirus vector. Complement
Inflamm 6, 433–441.
5 Arlaud GJ, Willis AC & Gagnon J (1987) Complete
amino acid sequence of the A chain of human comple-
ment-classical-pathway enzyme C1r. Biochem J 241,
711–720.
6 Arlaud GJ & Gagnon J (1983) Complete amino acid
sequence of the catalytic chain of human complement
subcomponent C1-r. Biochemistry 22, 1758–1764.
7 Lacroix M, Ebel C, Kardos J, Dobo
´
J, Ga
´
lP,
Za
´
vodszky P, Arlaud GJ & Thielens NM (2001) Assem-
bly and enzymatic properties of the catalytic domain of
human complement protease C1r. J Biol Chem 276,
36233–36240.
8 Rees DJG, Jones IM, Handford PA, Walter SJ, Esnouf
MP, Smith KJ & Brownlee GG (1988) The role of beta-
hydroxyaspartate and adjacent carboxylate residues in
the first EGF domain of human factor IX. EMBO J

7, 2053–2061.
9 Monkovic DD, VanDusen WJ, Petroski CJ, Garsky
VM, Sardana MK, Za
´
vodszky P, Stern AM & Fried-
man PA (1992) Invertebrate aspartyl ⁄ asparaginyl beta-
hydroxylase: potential modification of endogenous epi-
dermal growth factor-like modules. Biochem Biophys
Res Commun 189, 233–241.
10 Campbell ID & Bork P (1993) Epidermal growth
factor-like modules. Curr Opin Struct Biol 3, 385–392.
11 Bork P & Beckmann G (1993) The CUB domain. A
widespread module in developmentally regulated
proteins. J Mol Biol 231, 539–545.
12 Bally I, Rossi V, Lunardi T, Thielens NM, Gaboriaud
C & Arlaud GJ (2009) Identification of the C1q-binding
Sites of Human C1r and C1s: a refined three-dimen-
sional model of the C1 complex of complement. J Biol
Chem 284, 19340–19348.
13 Kardos J, Ga
´
l P, Szila
´
gyi L, Thielens NM, Szila
´
gyi K,
Lo
˜
rincz Z, Kulcsa
´

r P, Gra
´
f L, Arlaud GJ & Za
´
vodszky
P (2001) The role of the individual domains in the
structure and function of the catalytic region of a
modular serine protease, C1r. J Immunol 167, 5202–
5208.
14 Patthy L (1987) Detecting homology of distantly related
proteins with consensus sequences. FEBS Lett 214, 1–7.
15 Reid KB & Day AJ (1989) Structure-function relation-
ships of the complement components. Immunol Today
10, 177–180.
16 Hawrot E, Xiao Y, Shi QL, Norman D, Kirkitadze M
& Barlow PN (1998) Demonstration of a tandem pair
of complement protein modules in GABA(B) receptor
1a. FEBS Lett 432, 103–108.
17 Rickert M, Wang X, Boulanger MJ, Goriatcheva N &
Garcia KC (2005) The structure of interleukin-2 com-
plexed with its alpha receptor. Science 308, 1477–1480.
18 Barlow PN, Baron M, Norman DG, Day AJ, Willis
AC, Sim RB & Campbell ID (1991) Secondary
structure of a complement control protein module
by two-dimensional 1H NMR. Biochemistry 30,
997–1004.
19 Norman DG, Barlow PN, Baron M, Day AJ, Sim RB
& Campbell ID (1991) Three-dimensional structure of a
complement control protein module in solution. J Mol
Biol 219, 717–725.

20 Hourcade D, Liszewski MK, Krych-Goldberg M &
Atkinson JP (2000) Functional domains, structural vari-
ations and pathogen interactions of MCP, DAF and
CR1. Immunopharmacology 49, 103–116.
21 Krych-Goldberg M & Atkinson JP (2001) Structure-
function relationships of complement receptor type 1.
Immunol Rev 180, 112–122.
22 Kirkitadze MD & Barlow PN (2001) Structure and flex-
ibility of the multiple domain proteins that regulate
complement activation. Immunol Rev 180, 146–161.
23 Mark L, Lee WH, Spiller OB, Villoutreix BO & Blom
AM (2006) The Kaposi’s sarcoma-associated herpesvi-
rus complement control protein (KCP) binds to heparin
and cell surfaces via positively charged amino acids in
CCP1-2. Mol Immunol 43, 1665–1675.
24 Schmidt CQ, Herbert AP, Kavanagh D, Gandy C,
Fenton CJ, Blaum BS, Lyon M, Uhrı
´
n D & Barlow PN
(2008) A new map of glycosaminoglycan and C3b bind-
ing sites on factor H. J Immunol 181, 2610–2619.
25 Schmidt CQ, Herbert AP, Hocking HG, Uhrı
´
nD&
Barlow PN (2008) Translational mini-review series on
complement factor H: structural and functional correla-
tions for factor H. Clin Exp Immunol 151 , 14–24.
26 Wiles AP, Shaw G, Bright J, Perczel A, Campbell ID &
Barlow PN (1997) NMR studies of a viral protein that
mimics the regulators of complement activation. J Mol

Biol 272, 253–265.
27 Uhrinova S, Lin F, Ball G, Bromek K, Uhrin D,
Medof ME & Barlow PN (2003) Solution structure of a
functionally active fragment of decay-accelerating fac-
tor. Proc Natl Acad Sci USA 100, 4718–4723.
28 Smith BO, Mallin RL, Krych-Goldberg M, Wang X,
Hauhart RE, Bromek K, Uhrin D, Atkinson JP &
Barlow PN (2002) Structure of the C3b binding site of
CR1 (CD35), the immune adherence receptor. Cell 108,
769–780.
29 O’Leary JM, Bromek K, Black GM, Uhrinova S,
Schmitz C, Wang X, Krych M, Atkinson JP, Uhrin D
& Barlow PN (2004) Backbone dynamics of comple-
ment control protein (CCP) modules reveals mobility in
binding surfaces. Protein Sci 13, 1238–1250.
Flexibility and cooperativity of CCP modules A. La
´
ng et al.
3996 FEBS Journal 277 (2010) 3986–3998 ª 2010 The Authors Journal compilation ª 2010 FEBS
30 Jenkins HT, Mark L, Ball G, Persson J, Lindahl G,
Uhrin D, Blom AM & Barlow PN (2006) Human
C4b-binding protein, structural basis for interaction
with streptococcal M protein, a major bacterial viru-
lence factor. J Biol Chem 281, 3690–3697.
31 Hoshino M, Hagihara Y, Nishii I, Yamazaki T, Kato H
& Goto Y (2000) Identification of the phospholipid-bind-
ing site of human beta(2)-glycoprotein I domain V by het-
eronuclear magnetic resonance. J Mol Biol 304, 927–939.
32 Herbert AP, Uhrı
´

n D, Lyon M, Pangburn MK &
Barlow PN (2006) Disease-associated sequence varia-
tions congregate in a polyanion recognition patch on
human factor H revealed in three-dimensional structure.
J Biol Chem 281 , 16512–16520.
33 Henderson CE, Bromek K, Mullin NP, Smith BO,
Uhrı
´
n D & Barlow PN (2001) Solution structure and
dynamics of the central CCP module pair of a poxvirus
complement control protein. J Mol Biol 307, 323–339.
34 Blein S, Ginham R, Uhrin D, Smith BO, Soares DC,
Veltel S, McIlhinney RA, White JH & Barlow PN
(2004) Structural analysis of the complement control
protein (CCP) modules of GABA(B) receptor 1a: only
one of the two CCP modules is compactly folded. J Biol
Chem 279, 48292–48306.
35 Major B, Kardos J, Ke
´
kesi KA, L
}
orincz Z, Za
´
vodszky
P&Ga
´
l P (2010) Calcium-dependent conformational
flexibility of a CUB domain controls activation of the
complement serine protease C1r. J Biol Chem 285,
11863–11869.

36 Kardos J, Harmat V, Pallo
´
A, Baraba
´
s O, Szila
´
gyi K,
Gra
´
fL,Na
´
ray-Szabo
´
G, Goto Y, Za
´
vodszky P & Ga
´
l
P (2008) Revisiting the mechanism of the autoactivation
of the complement protease C1r in the C1 complex:
structure of the active catalytic region of C1r.
Mol Immunol 45, 1752–1760.
37 Budayova-Spano M, Lacroix M, Thielens NM, Arlaud
GJ, Fontecilla-Camps JC & Gaboriaud C (2002) The
crystal structure of the zymogen catalytic domain of
complement protease C1r reveals that a disruptive
mechanical stress is required to trigger activation of the
C1 complex. EMBO J 21, 231–239.
38 Szenthe B, Ga
´

spa
´
ri Z, Nagy A, Perczel A & Gra
´
fL
(2004) Same fold with different mobility: backbone
dynamics of small protease inhibitors from the desert
locust, Schistocerca gregaria. Biochemistry 43, 3376–
3384.
39 Mulder FA, Schipper D, Bott R & Boelens R (1999)
Altered flexibility in the substrate-binding site of related
native and engineered high-alkaline Bacillus subtilisins.
J Mol Biol 292, 111–123.
40 Lefevre JF, Dayie KT, Peng JW & Wagner G (1996)
Internal mobility in the partially folded DNA binding
and dimerization domains of GAL4: NMR analysis of
the N-H spectral density functions. Biochemistry 35,
2674–2686.
41 Krı
´
zova
´
H, Zı
´
dek L, Stone MJ, Novotny MV &
Sklena
´
r V (2004) Temperature-dependent spectral
density analysis applied to monitoring backbone
dynamics of major urinary protein-I complexed with

the pheromone 2- sec-butyl-4,5-dihydrothiazole. J Bio-
mol NMR 28, 369–384.
42 Huda
´
ky P & Perczel A (2004) Peptide models XLII. Ab
initio study on conformational changes of N-formyl-L-
histidinamide caused by protonation or deprotonation
of its side chain. J Mol Struct (THEOCHEM) 675,
117–127.
43 Boehr DD, Nussinov R & Wright PE (2009) The role
of dynamic conformational ensembles in biomolecular
recognition. Nat Chem Biol 5, 789–796.
44 Novokhatny VV, Ingham KC & Medved LV (1991)
Domain structure and domain-domain interactions of
recombinant tissue plasminogen activator. J Biol Chem
266, 12994–13002.
45 Thielens NM, Enrie K, Lacroix M, Jaquinod M,
Hernandez JF, Esser AF & Arlaud GJ (1999) The
N-terminal CUB-epidermal growth factor module pair
of human complement protease C1r binds Ca
2+
with
high affinity and mediates Ca
2+
-dependent interaction
with C1s. J Biol Chem 274, 9149–9159.
46 Kirkitadze MD, Henderson C, Price NC, Kelly SM,
Mullin NP, Parkinson J, Dryden DT & Barlow PN
(1999) Central modules of the vaccinia virus comple-
ment control protein are not in extensive contact.

Biochem J 344, 167–175.
47 Kirkitadze MD, Krych M, Uhrin D, Dryden DT, Smith
BO, Cooper A, Wang X, Hauhart R, Atkinson JP &
Barlow PN (1999) Independently melting modules and
highly structured intermodular junctions within
complement receptor type 1 . Biochemistry 38,
7019–7031.
48 Kirkitadze MD, Dryden DT, Kelly SM, Price NC,
Wang X, Krych M, Atkinson JP & Barlow PN (1999)
Co-operativity between modules within a C3b-binding
site of complement receptor type 1. FEBS Lett 459,
133–138.
49 Weber DJ, Gittis AG, Mullen GP, Abeygunawardana
C, Lattman EE & Mildvan AS (1992) NMR docking of
a substrate into the X-ray structure of staphylococcal
nuclease. Proteins 13, 275–287.
50 Arlaud GJ, Gagnon J, Villiers CL & Colomb MG
(1986) Molecular characterization of the catalytic
domains of human complement serine protease C1r.
Biochemistry 25, 5177–5182.
51 Gill SC & von Hippel PH (1989) Calculation of protein
extinction coefficients from amino acid sequence data.
Anal Biochem 182, 319–326.
52 Delaglio F, Grzesiek S, Vuister GW, Zhu G, Pfeifer J
& Bax A (1995) NMRPipe: a multidimensional spectral
processing system based on UNIX pipes. J Biomol
NMR 6, 277–293.
A. La
´
ng et al. Flexibility and cooperativity of CCP modules

FEBS Journal 277 (2010) 3986–3998 ª 2010 The Authors Journal compilation ª 2010 FEBS 3997
53 Goddard TD & Kneller DG (2009) SPARKY 3.
University of California, San Francisco.
54 Bartels C, Xia T-H, Billeter M, Gu
¨
ntert P & Wu
¨
thrich
K (1995) The program XEASY for computer-supported
NMR spectral analysis of biological macromolecules.
J Biomolecular NMR 6, 1–10.
55 Talluri S & Wagner G (1996) An optimized 3D
NOESY-HSQC. J Magn Reson B 112, 200–205.
56 Yamazaki T, Lee W, Revington M, Mattiello DL,
Dahlquist FW, Arrowsmith CH & Kay LE (1994) An
HNCA pulse scheme for the backbone assignment of
15
N,
13
C,
2
H-labeled proteins: Application to a 37-kDa
Trp repressor-DNA complex. J Am Chem Soc 116,
6464–6465.
57 Grzesiek S & Bax A (1992) Correlating backbone amide
and side-chain resonances in larger proteins by multiple
relayed triple resonance NMR. J Am Chem Soc 114,
6291–6293.
58 Muhandiram DR & Kay LE (1994) Gradient-enhanced
triple-resonance 3-dimensional NMR experiments with

improved sensitivity. J Magn Reson B 103, 203–216.
59 Mori S, Abeygunawardana C, Johnson MO & van
Zijl PC (1995) Improved sensitivity of HSQC spectra
of exchanging protons at short interscan delays using
a new fast HSQC (FHSQC) detection scheme that
avoids water saturation. J Magn Reson B 108,
94–98.
60 Farrow NA, Zhang O, Forman-Kay JD & Kay LE
(1994) A heteronuclear correlation experiment for
simultaneous determination of
15
N longitudinal decay
and chemical exchange rates of systems in slow equilib-
rium. J Biomol NMR 4, 727–734.
61 Garcı
´
a De La Torre J, Huertas ML & Carrasco B
(2000) Calculation of hydrodynamic properties of glob-
ular proteins from their atomic-level structure. Biophys
J 78, 719–730.
62 Clore GM, Driscoll PC, Wingfield PT & Gronenborn
AM (1990) Analysis of the backbone dynamics of inter-
leukin-1 beta using two-dimensional inverse detected
heteronuclear
15
N-
1
H NMR spectroscopy. Biochemistry
29, 7387–7401.
63 Dosset P, Hus JC, Blackledge M & Marion D (2000)

Efficient analysis of macromolecular rotational diffusion
from heteronuclear relaxation data. J Biomol NMR 16,
23–28.
Supporting information
The following supplementary material is available:
Fig. S1. Effect of pH on backbone chemical shifts
based on comparison of
N
H resonances at pH 4.0
(pH4.5 in CCP2
single
) and pH 7.0 at 300 K is consis-
tent with histidine side chain protonation.
Fig. S2–S8. Sequence corrected
a
H secondary chemical
shifts of different CCP modules at various conditions.
Fig. S9. Magnification of
a
H secondary chemical shifts
of residues from different CCP modules.
Fig. S10. Set of HSQC spectra of CCP1CCP2 (#2) col-
lected at 280, 300 and 320 K at pH 4.0.
Fig. S11. Set of HSQC spectra of CCP1CCP2 (#2) col-
lected at 300 and 315 K at pH7.0.
Fig. S12. Overlay of HSQC spectra collected at 300 K
of single CCP1 and CCP2 and of pair of modules at
neutral and acidic pH.
Doc. S1. Intermodule cooperativity in the structure
and dynamics of consecutive complement control mod-

ules in human C1r.
Table S1. Mean relaxation values at 300 K both mea-
sured in acidic and neutral conditions.
Table S2. Overlapping, slow motion, fast motion resi-
dues in single modules in acidic and neutral solutions
at 300 K.
Table S3–S6. Calculated ‘Model-free’ values assuming
isotropic rotational diffusion tensor for CCP1 and for
CCP2 at various conditions.
Table S7. Selected examples of intramodule interac-
tions in CCP modules similarly to that in C1rCCP2
(PDB codes and numbers are used).
Table S8. Time delays (in second) used for relaxation
measurements.
This supplementary material can be found in the
online version of this article.
Please note: As a service to our authors and readers,
this journal provides supporting information supplied
by the authors. Such materials are peer-reviewed and
may be re-organized for online delivery, but are not
copy-edited or typeset. Technical support issues arising
from supporting information (other than missing files)
should be addressed to the authors.
Flexibility and cooperativity of CCP modules A. La
´
ng et al.
3998 FEBS Journal 277 (2010) 3986–3998 ª 2010 The Authors Journal compilation ª 2010 FEBS