Báo cáo khoa học: Involvement of NF-jB subunit p65 and retinoic acid receptors, RARa and RXRa, in transcriptional regulation of the human GnRH II gene pot

Involvement of NF-jB subunit p65 and retinoic acid
receptors, RARa and RXRa, in transcriptional regulation
of the human GnRH II gene
Ruby L. C. Hoo
1,
*, Kathy Y. Y. Chan
2
, Francis K. Y. Leung
1
, Leo T. O. Lee
1
, Peter C. K. Leung
3
and Billy K. C. Chow
3
1 School of Biological Sciences, University of Hong Kong, Pokfulam Road, Hong Kong, China
2 Department of Paediatrics, Chinese University of Hong Kong, Prince of Wales Hospital, Shatin, Hong Kong, China
3 Department of Obstetrics and Gynecology, University of British Columbia, Vancouver, Canada
In humans, the genes for gonadotropin-releasing hor-
mones (GnRH I and GnRH II) have the same modu-
lar structure, harboring three introns and four exons.
The exons encode a precursor polypeptide consisting
of a signaling peptide, the GnRH decapeptide, and the
GnRH-associated peptide (GAP) with unknown func-
tion [1]. The promoter region of the human
(h)GnRH II gene is located at the 5¢ flanking region,
the untranslated exon 1, intron 1, and exon 2. The
locations of exon 1, intron 1 and exon 2 are
)793 ⁄ )750 (relative to the +1 translation start codon
ATG), )749 ⁄ )8 and )7 to +154, respectively.
Despite similar gene structures, GnRH I and

GnRH II genes are regulated by different regulatory
elements. Multiple regulatory sites have been identified
in the promoter of the hGnRH II gene. In 2001, Chen
et al. [2] identified a putative cAMP-response element
(CRE) site at nucleotide sequence )860 to )853. The
Keywords
gonadotropin-releasing hormone II; NF-jB
subunit p65; retinoic acid receptors;
silencer; transcriptional regulation
Correspondence
B. K. C. Chow, School of Biological
Sciences, University of Hong Kong,
Pokfulam Road, Hong Kong, China
Tel: +852 2299 0850
Fax: +852 2857 4672
E-mail:
*Present address
Department of Medicine, Li Ka Shing
Faculty of Medicine, University of Hong
Kong, Queen Mary Hospital, Hong Kong
(Received 1 November 2006, revised 19
March 2007, accepted 22 March 2007)
doi:10.1111/j.1742-4658.2007.05804.x
Gonadotropin-releasing hormone (GnRH) I and II are hypothalamic deca-
peptides with pivotal roles in the development of reproductive competence
and regulation of reproductive events. In this study, transcriptional regula-
tion of the human GnRH II gene was investigated. By scanning mutation
analysis coupled with transient promoter assays, the motif at )641 ⁄ )636
(CATGCC, designated GII-Sil) was identified as a repressor element.
Mutation of this motif led to full restoration of promoter activity in TE671

medulloblastoma and JEG-3 placenta choriocarcinoma cells. Supershift
and chromatin immunoprecipitation assays showed in vitro and in vivo
binding of NF-jB subunit p65 and the retinoic acid receptors, RARa and
RXRa, to the promoter sequences. Over-expression of these protein factors
indicated that p65 is a potent repressor, and the RARa ⁄ RXRa heterodimer
is involved in the differential regulation of the GnRH II gene in neuronal
and placental cells. This was confirmed by quantitative real-time PCR.
Treatment of cells with the RARa ⁄ RXRa ligands, all-trans retinoic acid
and 9-cis-retinoic acid, reduced and increased GnRH II gene expression in
TE671 and JEG-3 cells, respectively. Taken together, these data demon-
strate the differential roles of NF-jB p65 and RARa ⁄ RXRa, interacting
with the same sequence in the promoter of the human GnRH II gene to
influence gene expression in a cell-specific manner.
Abbreviations
ATRA, all-trans retinoic acid; ChIP, chromatin immunoprecipitation; CRE, cAMP-response element; EMSA, electrophoretic mobility-shift
assay; GAP, GnRH-associated peptide; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GnRH, gonadotropin-releasing hormone; HDAC,
histone deacetylase; L-CoR, ligand-dependent corepressor; N-CoR, nuclear receptor corepressor; RA, retinoic acid; RAR, retinoic acid
receptor.
FEBS Journal 274 (2007) 2695–2706 ª 2007 The Authors Journal compilation ª 2007 FEBS 2695
same research group also demonstrated that GnRH II,
but not GnRH I, is potently up-regulated by a cAMP
analog in human neuronal medulloblastoma cells
TE671. From deletion and mutation analysis, it was
concluded that the CRE site is responsible for both the
basal activity and cAMP induction of the hGnRH II
promoter. Similarly to the case of cAMP stimulation,
it has been reported that estrogen regulates the expres-
sion of GnRH I and GnRH II differentially. Estrogen
treatment down-regulates the promoter activity of
GnRH I but up-regulates GnRH II promoter activity.

Indeed, analysis of the promoter sequence has revealed
a partial putative estrogen-responsive element site
and an SP1 site at positions )1252 ⁄ )1256 and
)1726 ⁄ )1717, respectively [3]. In addition to cAMP
and estrogen, other hormonal regulation of GnRH II
expression has been investigated. In human granulolu-
teal cells, treatment with follicle-stimulating hormone
or human choriogonadotropin was reported to increase
GnRH II mRNA level but decrease GnRH I mRNA
level [4]. It is of interest that GnRH II was reported to
be self-regulated in the same study. Significant decrea-
ses in GnRH II and GnRH receptor mRNA levels
were observed in cells treated with GnRH II or its
agonist.
Our research group has previously identified a min-
imal promoter and two enhancer elements (E-boxes)
and Ets-like element in the untranslated first
exon functioning co-operatively to achieve full promo-
ter activity [5]. A silencing element in the first intron,
which has a significant repressive effect on the
GnRH II gene, has also been reported [6]. The present
study aimed to define the cis-acting element and
investigate the protein factors involved in regulation of
the hGnRH II gene in TE61 and JEG-3 cells. These
cell lines, which endogenously co-express GnRH I and
GnRH II, are valuable models for examining tran-
scriptional regulation of the GnRH II gene [7,8].
Results
Fine mapping of the cis-acting element
at )650 ⁄ )620

To characterize the hGnRH II intronic silencer and to
identify the location of the cis-acting element(s) within
this region, a series of mutant constructs, scanning
mutants Mut1 to Mut10 as shown in Fig. 1A, were
generated from the wild-type pGL2-()2103 ⁄ )620) con-
struct. The 30 base pairs at )650 ⁄ )620 was a potent
silencing element in both cell lines, significantly
repressing promoter activity to 17.6 ± 0.7% and
31.2 ± 1.6% in TE671 and JEG-3 cells, respectively.
In TE671 cells, Mut3, Mut4, Mut5 and Mut6 signifi-
cantly [P < 0.001 versus pGL2-()2103 ⁄ )620) (wild-
type)] restored promoter activity to 44.0%, 87.1%,
85.1% and 42.0% (compared with full promoter activ-
ity), respectively (Fig. 1B). Mut4 and Mut5 restored
almost full promoter activity (87.1% and 85.1%). Sim-
ilar results were observed in JEG-3 cells (Fig. 1C):
Mut3, Mut4, and Mut5 significantly [P < 0.001 versus
pGL2-()2103 ⁄ )620) (wild-type)] restored promoter
activity to 44.9%, 81.9% and 84.8%, respectively, with
Mut4 and Mut5 restoring almost full promoter activity
(81.9 ± 4.9% and 84.8 ± 9.8%, respectively). In con-
trast, Mut6 did not show significant restoration of pro-
moter activity in JEG-3 cells. It is interesting to note
that Mut1 led to further significant [P < 0.001 versus
pGL2-()2103 ⁄ )620) (wild-type)] repression in both cell
lines.
hGII-Sil is a novel silencing element of the
hGnRH II gene
Mutational analysis of the putative silencing element
residing at )650 ⁄ )620 demonstrated the functional

significance of the Mut4 and Mut5 region (CATGC-
CAG, hGII-Sil). Electrophoretic mobility-shift assays
(EMSAs) using the radiolabeled hGII-Sil oligonucleo-
tide as DNA probe were then performed to identify
whether there is any specific DNA–protein binding
Complex in this region. Although the hGII-Sil region
had a similar gene-repressive effect in both cell lines,
slightly different DNA–protein binding patterns were
observed in EMSAs using TE671 and JEG-3 nuclear
extracts (Fig. 2A). Three obvious DNA–protein com-
plexes were observed in the EMSA with TE671 nuclear
extract (Fig. 2A). Formation of Complex A and Com-
plex B were dose-dependently inhibited by the unlabe-
led DNA probe, and Complex A was completely
diminished in 200-fold excess unlabeled competitor.
This implies that the binding of protein factors in
Complex A and Complex B with the putative silencer
is specific. In JEG-3 cell lines, three retarded DNA–
protein complexes were also observed (Fig. 2A). Of
these, only Complex C showed a specific interaction
because it was the only Complex that was dose-depend-
ently inhibited by self competition. Furthermore, when
a nonspecific unlabeled oligonucleotide (L8 oligonuc-
leotide) was applied as the unlabeled competitor
(Fig. 2B), formation of Complex A and Complex B
was not inhibited. The presence of mutant oligonucleo-
tides with mutations at the Mut4 and Mut5 region
(Mut4+5 oligonucleotide) as the unlabeled competitor
in the binding reaction fails to inhibit the formation of
both Complex A and Complex B (Fig. 2B).

Differential regulation of the GnRH II gene R. L. C. Hoo et al.
2696 FEBS Journal 274 (2007) 2695–2706 ª 2007 The Authors Journal compilation ª 2007 FEBS
NF-jB subunit p65 and retinoic acid receptors,
RARa and RXR, interact with hGII-Sil in TE671
cells
According to the results of supershift assays, NF-jB
p65 subunit antibody and RAR antibody abolished
the formation of Complex A, indicating that the p65
subunit and members of the RAR family are involved
in the DNA–protein Complex in TE671 cells. Intrigu-
ingly, along with the abolition of Complex A forma-
tion by RAR-specific antibody, there was a
concomitant increase in the intensity of Complex B
(Fig. 3A). Subsequent supershift assays using antibod-
ies against different isoforms of RAR (RARa, RARb,
RARc) and RXR were performed to identify which
members of the RAR family were present in the
DNA–protein Complex (Fig. 3B). Only RARa-specific
antibody and RXR-specific antibody successfully abol-
ished the formation of Complex A, indicating the
involvement of RARa and RXR in the DNA–protein
complex. Similarly to the supershift assay described in
Fig. 3A, abolition of Complex A formation by RARa-
specific antibody and RXR-specific antibody was
accompanied by enhancement of Complex B.
To show in vivo binding of p65, RAR and RXR
to the hGII-Sil region, chromatin immunoprecipita-
tion (ChIP) assays were performed (Fig. 4). We
observed no PCR signals from the negative controls
(No immunoprecipitation, lane 3; anti-rabbit IgG,

lane 7; and PCR negative, lane 8). These controls
indicate that there was neither nonspecific precipita-
tion nor PCR contamination. Positive PCR signals
A
pGL2-Basic
pGL2–(-2103/-650)
pGL2–(-2103/-620)
pGL2–(-2103/-620) Mut1
pGL2–(-2103/-620) Mut2
pGL2–(-2103/-620) Mut3
pGL2–(-2103/-620) Mut4
pGL2–(-2103/-620) Mut5
pGL2–(-2103/-620) Mut6
pGL2–(-2103/-620) Mut7
pGL2–(-2103/-620) Mut8
pGL2–(-2103/-620) Mut9
pGL2–(-2103/-620) Mut10
pGL2-Basic
pGL2–(-2103/-650)
pGL2–(-2103/-620)
pGL2–(-2103/-620) Mut1
pGL2–(-2103/-620) Mut2
pGL2–(-2103/-620) Mut3
pGL2–(-2103/-620) Mut4
pGL2–(-2103/-620) Mut5
pGL2–(-2103/-620) Mut6
pGL2–(-2103/-620) Mut7
pGL2–(-2103/-620) Mut8
pGL2–(-2103/-620) Mut9
pGL2–(-2103/-620) Mut10

0 20 40 60 80 100 120
Relative promoter activity (% change)
0 20 40 60 80 100 120
Relative promoter activity (% change)
TE671
B
C
JEG-3
Fig. 1. Fine mapping of the putative silencing element in the first intron of the hGnRH II gene. The series of mutational constructs (A) were
cotransfected (1 l g each) with 0.5 pSV-b-gal vector into TE671 cells (B) and JEG-3 cells (C) using Lipofection Reagent GeneJuice. At 48 h
post-transfection, cell lysate was prepared and used for luciferase and b-galactosidase assays. Luciferase values are normalized by b-galac-
tosidase expression and are shown as percentage changes in relative promoter activities compared with that of pGL2-()2103 ⁄ )650), the
hGnRH II promoter region with the putative 30-bp silencing element deleted, which is designated as having 100% promoter activity. Values
are mean ± S.E.M. from at least three independent experiments each in triplicate. *Significant difference (P<0.001) versus control
pGL2-()2103 ⁄ )620).
R. L. C. Hoo et al. Differential regulation of the GnRH II gene
FEBS Journal 274 (2007) 2695–2706 ª 2007 The Authors Journal compilation ª 2007 FEBS 2697
were detected using p65, RAR and RXR antibodies
(lane 4–6) and in the positive control (lane 2). In
summary, data from the ChIP assays indicate in vivo
interaction of p65, RAR and RXR with the hGII-Sil
promoter.
Over-expression of NF-jB p65 subunit
down-regulated hGnRH II gene expression
Functional assays were carried out to identify the
effect of these trans-acting elements on expression of
A
Nuclear extract
Competitor (fold)
Nuclear extract (µg)

Complex A
Complex B
Non-
specific binding
Free probe
Complex C
Non-
specific binding
Non-
specific binding
Free probe
TE671
JEG-3

0× 50× 100× 200×

0× 50× 100× 200×
15µg
0 µg
B
Nuclear extract
Competitor
(fold)
Nuclear extract (µg)
Complex A
Complex B
Non-
specific binding
Free probe

0×
0×
200×
TE671
L8 non-specific oligo
Mutant oligo
50× 100× 200×
15µg 15µg
0 µg
15µg
0 µg
Fig. 2. Specific interaction of nuclear factors
from TE671 and JEG-3 cells with the Mut4
and Mut5 (hGII-Sil) region in the putative
silencer. (A) EMSAs to characterize the pro-
tein factor(s) binding to the Mut4 and Mut5
(hGII-Sil) region in the putative intronic silen-
cing element in TE671 and JEG-3 cells. Syn-
thetic oligonucleotides of hGII-Sil were
annealed to form dsDNA before radiolabe-
ling with c
32
P. The radiolabeled 24-bp DNA
probe (0.2 omol, 200 000 cpm) was incuba-
ted with 15 lg nuclear extracts from TE671
or JEG-3 cells during the binding reaction.
Increasing concentrations (0–200-fold
excess) of unlabeled hGII-Sil oligonucleo-
tides were applied as unlabeled competitors
to allow self-competition. (B) L8 nonspecific

oligonucleotide and mutant oligonucleotide
(Mut4+5 oligonucleotide) were used as
competitors.
Probe hGII-Sil
A
Nuclear extract TE671
Nuclear extract (µg) 0µg 15µg
Antibody
-ve +ve p65 c-Jun RAR
Complex A
Complex B
Non-specific
b
inding
Free probe
B
Probe
Nuclear extract
Nuclear extract (µg)
hGII-Sil
TE671
0µg 15µg
Antibody
-ve +ve
RARα RARβ RARγ
RXR
Complex A
Complex B
Non-specific
binding

Free probe
Fig. 3. Protein factors NF-jB subunits p65, RARa and RXR family interact with the putative silencer in TE671 cells. Supershift assay to iden-
tify protein factors that bind to the Mut4 and Mut5 (hGII-Sil) region in the putative intronic silencing element in TE671 cells. Synthetic oligo-
nucleotides of hGII-Sil were annealed to form dsDNA before radiolabeling with c
32
P. In each reaction, 15 lg TE671 nuclear extract was
incubated with specific antibodies against different transcription factors to allow specific protein–antibody interactions. The radiolabeled
24-bp DNA probe (0.2 omol, 200 000 cpm) was then incubated with the nuclear extracts for the binding reaction. –ve, No antibody incuba-
tion; + ve, 0.2 lg BSA applied as positive control.
Differential regulation of the GnRH II gene R. L. C. Hoo et al.
2698 FEBS Journal 274 (2007) 2695–2706 ª 2007 The Authors Journal compilation ª 2007 FEBS
the hGnRH II gene in vivo. These were conducted
by transient transfection coupled to luciferase assay
using TE671 and JEG-3 cells. Co-transfection of
the silencer-containing promoter constructs pGL2-
()2103 ⁄ )620) with p65 expression vector (pCMV4-
p65) led to a dramatic decrease in promoter activity in
both cell lines in a dose-dependent manner (Fig. 5).
Even 0.1 lg of the p65 expression vector produced a
significant (P<0.001) decrease in promoter activity
in both cell lines, indicating the strong potency of
repression induced by p65.
Effect of unliganded RARa and RXRa and retinoic
acid (RA) treatments on GnRH II promoter
activity
To investigate the in vivo effect of RARa and RXR
on the transcriptional regulation of the hGnRH II
gene, the expression vector of human RARa (pCMX-
hRARa) and ⁄ or human RXRa (pCMX-hRXRa) were
cotransfected with the silencer-containing promoter

construct pGL2-()2103 ⁄ )620) into TE671 and JEG-3
cells. Neither the transfection of RARa or RXRa nor
the cotransfection of both receptors had a significant
effect on the GnRH II promoter activity in TE671
cells (Fig. 6). In contrast, transfection of RARa and
cotransfection of RARa and RXRa significantly
(P < 0.001) alleviated the gene repression of the silen-
cer-containing promoter constructs in JEG-3 cells
(Fig. 6). Surprisingly, RXRa alone might not be
responsible for the repression, as its over-expression,
without RARa, did not have any significant effect on
promoter activity.
To further elucidate the regulation of GnRH II gene
by RARs, TE671 and JEG-3 cells were treated with
all-trans retinoic acid (ATRA; a ligand of RARs)
and ⁄ or 9-cisRA (a ligand of RXRs) before the meas-
urement of GnRH II promoter activity. In TE671
Marker
Input
No IP
p65
RAR
RXR
IgG
-ve
12345678
274bp
Antibody
Fig. 4. ChIP assay of GnRH II promoter on TE671 cells. It shows
binding of p65, RAR and RXR to GnRH II promoter in the context

of chromatin. Chromatin from TE671 cells was formaldehyde cross-
linked and immunoprecipitated with p65, RAR and RXR antibodies
(lanes 4–6). After reversal of the cross-linking, the purified DNA
fragments were subjected to PCR using primers to amplify a 274-
bp segment spanning the hGII-Sil region of the GnRH II promoter.
Immunoprecipitation without antibody (No IP, lane 3) and using a
nonspecific antibody against rabbit IgG (IgG, lane 7) was carried out
as negative controls. Lane 8, a negative control for PCR (without
any DNA template). Input DNA from fragmented chromatin before
immunoprecipitation was used as a positive control (lane 2).
Lane 1, DNA size standards (100-bp DNA ladder; Invitrogen).
120
100
80
60
40
20
pGL2-(-2103/-620)
pCMV4- p65
0
+
0µg
+
0.1µg
+
0.25µg
+
0.5µg
+
1µg

*
*
*
*
TE671
JEG-3
Relative promoter activity
(% change)
Fig. 5. In vivo dose-dependent effect of over-expressing NF-jB
p65 subunit on the promoter activity of hGnRH II gene in TE671
and JEG-3 cells. pCMV4-p65 expression vector was transfected to
each sample at different doses, and their effects on pGL2-
()2103 ⁄ )620) were evaluated. Values are shown as percentage
changes in relative promoter activities compared with that of the
positive control [pGL2-()2103 ⁄ )620) without over-expression of
p65]. The promoter activity of the positive control is regarded as
100%. Values are mean ± S.E.M. from at least three independent
experiments each performed in triplicate. *P<0.001, significant
difference from control pGL2-()2103 ⁄ )620). p65, pCMV4-p65
expression vector.
200
180
160
140
120
100
80
60
40
20

0
pGL2-(-2103/-620) + + + +
hRARa+
hRXRa
hRXRahRARa–
*
*
TE671
JEG-3
Retinoic Acid
Receptors
Relative promoter activity
(% change)
Fig. 6. Effects of unliganded RARa and RXRa on hGnRH II promo-
ter activity in TE671 and JEG-3 cells. Supershift assay to identify
which members of the RAR family bind to the Mut4 and Mut5
(hGII-Sil) region in the putative intronic silencing element in TE671
cells. Synthetic oligonucleotides of hGII-Sil were annealed to form
dsDNA before radiolabeling with c
32
P. In each reaction, 15 lg
TE671 nuclear extract was incubated with specific antibodies
against RARs to allow specific protein–antibody interactions. The
radiolabeled 24-bp DNA probe (0.2 pmol, 200 000 cpm) was
then incubated with the nuclear extracts for the binding reaction.
–ve, No antibody incubation. + ve, 0.2 lg BSA applied as positive
control.
R. L. C. Hoo et al. Differential regulation of the GnRH II gene
FEBS Journal 274 (2007) 2695–2706 ª 2007 The Authors Journal compilation ª 2007 FEBS 2699
cells, the application of both ATRA and 9-cisRA sig-

nificantly down-regulated the promoter function to
61.8 ± 5.0% and 57.5 ± 3.3%, respectively (Fig. 6)
(P < 0.001). Interestingly, cotreatment with ATRA
and 9-cisRA had a similar repressive effect
(54.1 ± 0.8%; P < 0.001). In contrast with the repres-
sive effect in TE671 cells, neither cotreatment nor
treatment with ATRA or 9-cisRA alone had an obvi-
ous effect on the promoter activity of hGnRH II gene
in JEG-3 cells (Fig. 7).
Differential effects of ligand-activated RARa and
RXRa on the promoter activity of the hGnRH II
gene in TE671 and JEG-3 cells
Over-expression of RARs together with the application
of RAs led to significant (P < 0.001) down-regulation
of the promoter activity in TE671 cells (Fig. 8). A
synergistic repressive effect was observed in cells when
compared with cells only treated with retinoic acid
(RAs) (Figs 7 and 8) (P < 0.05 or P < 0.001). It was
also demonstrated that RARs alone have no effect on
the promoter activity of hGnRH II in TE671 cells
(Fig. 6). The repressive effect of RAs and the synergis-
tic effect observed in Fig. 7 therefore imply that lig-
and-bound RAR and RXR are responsible for the
repression of GnRH II gene in TE671 cells. On the
other hand, over-expression of RARs together with
the application of RAs in JEG-3 cells led to significant
(P < 0.001) alleviation of the promoter activity from
the repressed state (Fig. 8). When compared with the
samples that were only transfected with RARa and ⁄ or
RXRa (without RA treatment), simultaneous ligand

activation of RARa and RXRa (cotransfection of
RARa and RXRa together with treatment of both
ATRA and 9-cisRA) provided further up-regulation of
the promoter activity (P < 0.001). Although a syner-
gistic effect was observed in simultaneous ligand-acti-
vated RARa and RXRa, RXRa alone, in either its
unliganded or ligand-bound state, had no effect on the
promoter activity. Finally, the endogenous transcript
levels of the GnRH II gene in TE671 and JEG-3 cells
were further evaluated by quantitative RT-PCR. Con-
sistent with the results obtained from luciferase assays,
ligand-bound RARa and RXRa led to a significant
(P < 0.05) decrease in endogenous GnRH II gene
expression in TE671 cells. In contrast, ligand-bound
RARa and RXRa led to a significant (P < 0.001)
increase in GnRH II
gene expression in JEG-3 cells
(Fig. 9).
Discussion
The hGnRH II gene was first identified by White and
his colleagues in 1998 [9]. Although GnRH II and its
140
**
**
120
100
80
60
40
20

pGL2-(-2103/-620) + + + +
ATRA +
9-cisRA
TE671
JEG-3
9-cisRAATRA–Retinoic Acids Treatment
0
Relative promoter activity
(% change)
Fig. 7. Differential effects of RA treatment on the promoter activity
of the hGnRH II gene in TE671 and JEG-3 cells. In vivo effect of
over-expressing RARa and RXRa on the promoter activity of the
hGnRH II gene in TE671 and JEG-3 cells. Values are shown as per-
centage changes in relative promoter activities compared with that
of the positive control [pGL2-()2103 ⁄ )620) without over-expression
of transcription factors]. The promoter activity of the positive con-
trol is regarded as 100%. Values are mean ± S.E.M. from at least
three independent experiments each performed in triplicate. *Signi-
ficant difference (P<0.001) versus control pGL2-()2103 ⁄ )620).
hRARa, pCMX-hRARa expression vector; hRXRa, pCMX-hRXRa
expression vector.
250
TE671
JEG-3
200
150
100
50
pGL2-(-2103/-620)
Retinoic Acids

Receptor
–
––
hRARa*
hRXRa
**
*
*
♦
♠
♦
♦
♦
hRARa
ATRA 9-cisRA 9-cisRA
AT R A
hRXRa
hRARa*
hRXRa
Retinoic Acids
Treatment
+++ ++
0
Relative promoter activity (% change)
Fig. 8. Differential effects of ligand-activated RARa and RXRa on
the promoter activity of the hGnRH II gene in TE671 and JEG-3
cells. In vivo effect of RARa and RXRa with their ligands, ATRA
and 9-cisRA, on the promoter activity of the hGnRH II gene in
TE671 cells and JEG-3 cells. Values are shown as percentage chan-
ges in relative promoter activities compared with that of the posit-

ive control [pGL2-()2103 ⁄ )620) without treatment]. The promoter
activity of the positive control is regarded as 100%. Values are
mean ± S.E.M. from at least three independent experiments each
performed in triplicate. *, r,
“ represent significantly different val-
ues (* and
“, P < 0.001; * and r, P < 0.01; “ and r, P < 0.05 or
above). hRARa, pCMX-hRARa expression vector; hRXRa, pCMX-
hRXRa expression vector.
Differential regulation of the GnRH II gene R. L. C. Hoo et al.
2700 FEBS Journal 274 (2007) 2695–2706 ª 2007 The Authors Journal compilation ª 2007 FEBS
first isoform share 70% homology, they are encoded
by different gene loci and possess distinct tissue expres-
sion patterns and biological functions. It is widely
expressed in various parts of the brain and the periph-
eral tissues. Its expression and potent antitumor activ-
ity in various normal and cancerous cells have received
much attention [10,11]. In contrast with the well-stud-
ied GnRH I, the gene regulation, expression patterns
and biological role of GnRH II are still largely
unclear. Several studies have focused on the gene
activation mechanisms of hGnRH II. It has been
demonstrated that expression of GnRH II can be up-
regulated by cAMP [2], gonadotropins [4] and estrogen
[3]. Two AP-4-interacting E-boxes, and an Ets-like ele-
ment have been identified in the untranslated first exon
and found to be responsible for the minimal promoter
activity of GnRH II [5]. In addition to these activating
elements, our research group has located a putative
silencer-like element in the first intron at )650 ⁄ )620

(relative to the +1 translation start site) [6]. In the
present study, a novel cis-acting element was first iden-
tified by deletion analysis and designated hGII-Sil
(GATGCC, position at )641 ⁄ )636). It was found to
be a major responsible element that mediates the
repressive effect, which, when mutated, led to a almost
complete restoration of promoter activity in two
GnRH II-expressing cell lines: medulloblastoma TE671
and placental cell JEG-3.
The hGII-Sil site does not show significant homo-
logy with any known consensus repressor binding site.
The highest similarity was suggested on comparison
with a novel repressive element SNOG (AATGG
GGG) of human growth-associated protein 43 gene
(hGAP43) with 50% homology [12]. The nucleotides,
ATG, in the hGAP43 SNOG element, which have
been reported to be crucial for the repressive effect,
coincide with the core sequence hGII-Sil identified in
our study. Although the protein factors of hGAP43
SNOG have not yet been identified, it is possible
that the two repressive elements in hGAP43 and
GnRH II gene have the same or a very similar
mechanism.
EMSAs and supershift assays performed in this
study indicated specific protein factors that bind to the
hGII-Sil region in a cell-specific manner. It was dem-
onstrated that NF-jB p65, RARa and RXR are
responsible for forming Complex A, or, at least, are
members of the Complex in TE61 cells. This was con-
firmed by ChIP assays which provided evidence for

in vivo interaction of these protein factors (p65, RAR
and RXR) with the hGII-Sil region. It is noteworthy
that, when Complex A was abolished by RAR anti-
body and RXR antibody, another specific Com-
plex (Complex B) increased in intensity. This may
imply competition binding between RAR and ⁄ or RXR
and Complex B on the hGII-Sil silencing element. Sim-
ilar results have been reported in other in vitro mam-
malian promoter studies of the Fas gene, in which
multiple protein factors and cofactors were involved
[13].
NF-jB subunit p65 was demonstrated in this study
to act as a potent repressor of hGnRH II promoter
in both neuronal and placental cells. NF-jB com-
plexes comprise homodimers or heterodimers of the
family including p65 (RelA), c-Rel, RelB, p50
(p105 ⁄ NF-jB1), and p52 (p100 ⁄ NF-jB2). Different
heterodimers bind to their specific promoters to regu-
late transcription of a wide range of genes to control
immune responses, cell apoptosis ⁄ survival and tissue
repair [14–16]. A classic model of NF-jB activation
involves the p50 ⁄ p65 heterodimer, which interacts with
the jB site and the CRE of the promoters. Being the
active partner of the heterodimer in the nucleus, p65 is
able to establish interactions with various transcription
factors such as CBP ⁄ p300 and histone deacetylases
(HDACs) [17]. It has also been reported that NF-jB
is involved in gene repression through differential
6
TE671

JEG-3
5
4
3
2
1
0
No treatment
Ligand-bound (RARαRXRα)
dimer
‡
‡
‡
GnRH II mRNA / GAPDH mRNA
(ratio against untreated cells)
Fig. 9. Effects of ligand-activated RARa and RXRa on hGnRH II
gene expression. The effect of ligand-bound RARa and RXRa on
the endogenous hGnRH II transcript level in TE671 and JEG-3 cells,
using quantitative real-time PCR analysis. Cells were treated with
ATRA and 9-cisRA 24 h after the transfection of expression vectors
of RARa and RXRa. The transcript level of untreated cells is defined
as 1.0. Total RNAs were harvested 24 h after drug treatment. First-
strand cDNAs were prepared from total RNAs as described and
used for quantitative PCRs. The hGnRH II transcript level of cells
treated with ligand-bound RARa ⁄ RXRa was compared with that of
untreated cells. The GnRH II mRNA ⁄ GAPDH mRNA ratio was
calculated by the 2
–DDCt
method, using the GAPDH mRNA concen-
tration measured by quantitative PCR as the internal control. Data

are the mean ± SEM from three experiments, each performed in
duplicate.
R. L. C. Hoo et al. Differential regulation of the GnRH II gene
FEBS Journal 274 (2007) 2695–2706 ª 2007 The Authors Journal compilation ª 2007 FEBS 2701
phosphorylation of p65 [15] or the association of
CBP ⁄ p300 to form a repressor Complex [18–20]. Other
studies have suggested that the binding of p65 to the
cofactors renders them unavailable for gene activation
[20–22]. In the context of the GnRH II promoter,
there is a cluster of enhancing elements, including a
functional CRE, within 200 bp upstream of the hGII-
Sil site. The enhancers have been suggested to be
responsible for the basal and stimulatory transcription
level of the gene [5,7]. Accordingly, it is possible that
p65 is an active member of the repressor Complex at
the hGII-Sil site, which then interacts with the activa-
tors involved to down-regulate promoter activity.
Furthermore, the nuclear receptor RAR ⁄ RXR het-
erodimer was found to be involved in the regulation of
GnRH II gene in both cells, yet, differential response
occurs in the two cell types in the presence of the
receptor’s ligands. Ligand-activated RARa and RXR
were found to contribute to the repressed expression of
GnRH II in the neuronal TE671 cells; ligand-activated
RARa, on the other hand, up-regulated gene expres-
sion in JEG-3 cells. To our knowledge, this study is
the first to demonstrate the presence of differential
transcriptional regulation of the GnRH II gene in dif-
ferent GnRH II-expressing human cell types. RAs play
important roles in development, differentiation, and

homeostasis in a tissue-specific manner [23,24]. The
actions of RAs are highly diversified because their sig-
nals can be transduced through different RARs. In
addition, the nuclear receptors are able to cross-talk
with cell surface receptor signaling pathways, and the
RARs and RXRs can interact with multiple coactiva-
tors and ⁄ or corepressors. These combinatorial effects
result in the pleiotropic effects of RAs. For RA-
induced genes, unliganded RAR ⁄ RXR heterodimers
bind to corepressors such as the silencing mediator of
retinoid and thyroid hormone receptor (SMRT)
and ⁄ or nuclear receptor corepressor (N-CoR). SMRT
and N-CoR in turn function as bridging factors that
recruit other coregulator proteins to form a larger
corepressor Complex [25,26].
Conversely, addition of hormone agonist leads to
the release of corepressor Complex by the receptor,
which then recruits a series of coactivator proteins,
such as steroid receptor coactivator 1 (SRC-1), gluco-
corticoid receptor interacting protein 1 (GRIP1), acti-
vator of thyroid and retinoic acid receptor (ACTR)
and p300 ⁄ cAMP response element binding protein-
binding protein (CBP ⁄ p300) [26–28]. This may explain
the up-regulation (alleviation of the repressing effect of
GII-Sil) of the hGnRH II promoter by the ligand-acti-
vated RAR⁄ RXR heterodimer in JEG-3 cells. It is
noteworthy that RXR, even in its ligand-activated
state, did not induce up-regulation of the gene without
over-expression of RAR. In contrast, ligand-activated
RAR itself was able to up-regulate the gene to a signi-

ficant level without the aid of RXR. This phenomenon
of RXR acting as the silent or ‘nonpermissive’ partner
in an RXR⁄ nuclear receptor heterodimer has often
been observed. These dimers do not respond to RXR
ligands but are only sensitive to RAR ligand activation
[23,29–31]. In the case of RAR ⁄ RXR, it was observed
that RXR can acquire the ability to respond to its
own ligand only if RAR is activated by ATRA before-
hand. In this situation, simultaneous addition of lig-
ands for both RAR and RXR leads to synergistic
activation of the heterodimer [31,32], which agrees
with the observation in the present study. Moreover,
quantitative RT-PCR analysis demonstrated this up-
regulation by ligand-activated RAR ⁄ RXR at the tran-
scriptional level of the hGnRH II gene. Therefore, the
RAR ⁄ RXR heterodimer interacts with the hGII-Sil
silencer and is probably responsible for its gene-repres-
sive effect in JEG-3 placental cells.
However, contrary to the results observed in placen-
tal cells and the current paradigm of the role of
RA-induced activation, the application of RAs and
introduction of ligand-activated RAR ⁄ RXR hetero-
dimer further down-regulated the hGnRH II gene in
TE61 cells. In fact, there are examples of ligand-bound
nuclear repressors exerting transrepression, rather than
activation, over their regulating genes. For instance,
thyroid hormone receptor b, which is closely related to
RARs, is found to markedly repress the thyroid-stimu-
lating hormone b promoter after being bound by its
cognate ligand thyroid hormone, via HDAC recruit-

ment [33,34]. Indeed, there is increasing evidence that
the ligand–nuclear receptor–corepressor relationship is
often not a simple switching on–off model. The func-
tions of the ‘corepressors’ may depend on cell type,
combinations of neighboring regulatory factors, and
the phase of the cell cycle [35]. Most corepressors have
been found to be promiscuously but not specifically
expressed [24,36]. It has also been reported that coacti-
vators can act as corepressors of liganded RAR and
thyroid hormone receptor in the context of epidermal
keratin genes, and vice versa [24]. It has long been
known that the interaction between coregulators and
nuclear receptors (liganded versus unliganded) is deter-
mined by the cis-acting elements. Hence, different tran-
scriptional responses can be elicited in various
promoter contexts even when the same ligands and
receptors are involved [24,37–39]. Another possible
hypothesis on the ligand-dependent transrepression
mechanism of hGnRH II observed here may involve
the newly discussed theory of ligand-dependent
Differential regulation of the GnRH II gene R. L. C. Hoo et al.
2702 FEBS Journal 274 (2007) 2695–2706 ª 2007 The Authors Journal compilation ª 2007 FEBS
corepressor (L-CoR). L-CoR is a distinct class of core-
pressor which causes gene repression through ligand-
bound nuclear receptors [35,40,41]. Fernandes et al.
[35] found a wide expression pattern of L-CoR in var-
ious human adult and fetal tissues, including kidney,
placenta, cerebellum and corpus callosum of the brain
at the transcription level. L-CoR interacts with both
HDAC2 and another corepressor C-terminal binding

protein, mediating strong gene repression through both
HDAC-dependent and HDAC-independent mecha-
nisms. Such a ligand-induced repression mechanism is
important as a means of attenuating and counterbalan-
cing hormone-induced transactivations, acting transi-
ently as part of a cycle of cofactors at the target
promoters, and allowing hormone-induced target gene
repression [35,41].
The present study discusses the transcriptional regu-
lation of the hGnRH II. It is also the first report of
differential regulation of the gene in two GnRH II-
expressing cell types. It may give useful cues about the
expression pattern of the largely unknown GnRH II.
We also provide evidence of the newly discussed mech-
anism of L-CoR. Little is still known about the
molecular basis of ligand-induced transrepression
[35,41,42]. As knowledge on this topic accumulates, a
more detailed elucidation of GnRH II transcriptional
regulation is expected.
Methods and Materials
Cell lines
TE671 (human medulloblastoma cell line) and JEG-3
(human placental cell line) were maintained in Dulbecco’s
modified Eagle’s medium (Gibco-BRL, Invitrogen, Grand
Island, NY, USA) and Medium 199 (Gibco-BRL, Invitro-
gen), respectively, supplemented with 10% fetal bovine
serum (Gibco-BRL, Invitrogen). All cells were incubated at
37 °C with 5% CO
2
in medium supplemented with

100 UÆmL
)1
penicillin G and 100 lgÆmL
)1
streptomycin
(Life Technologies, Carlsbad, CA, USA).
Promoter-luciferase constructs
The full-length hGnRH II promoter construct pGL2-
2103 ⁄ +1-Luc was generated by PCR amplification from
human genomic DNA using sequence-specific primers
followed by subsequent cloning into the promoter-less
pGL2-Basic vector (Promega, Madison, WI, USA) [5]. The
deletion mutants p-2103 ⁄ )650 Luc, which contains the core
promoter region and enhancing elements but lacks a silen-
cing element, and p-2103 ⁄ )620 Luc, which also includes the
silencing element, were generated by PCR amplification
using sequence-specific primers with p-2103 ⁄ +1 Luc as the
template. All mutant clones of the 30-bp silencer (scanning
mutants Mut 1–10) were generated by PCR amplifications
using mutagenic reverse primers and GLprimer1 forward
primer with wild-type pGL2-()2103 ⁄ )620) construct as the
template (Table 1). The purified PCR products were sub-
cloned into a pGL2-Basic vector (Promega) at KpnI and
HindIII restriction sites. All mutant plasmids were verified
by big dye terminator DNA sequencing analysis. Plasmid
DNAs used for transfection experiments were prepared
using the Nucleobond AX preparation kit (Macherey-
Nagel, Duren, Germany). Enzymes and oligoprimers were
purchased from Life Technologies and the Genome
Research Centre, University of Hong Kong, respectively.

Transfection and drug treatments
Two days before transfection, cells were seeded on to a
35-mm well (six-well plate; Costar, San Diego, CA, USA).
The seeding densities used for TE671 and JEG-3 were
1.5 · 10
5
cells ⁄ well and 2.5 · 10
5
cells ⁄ well, respectively.
The transfection mixture containing 1 lg promoter–lucif-
erase constructs, 0.5 lg pSV-b-gal or pCMV4-b-gal, an
appropriate amount of GeneJuice Transfection Reagent
(Novagen, Darmstadt, Germany) and 500 lL serum-free
medium was prepared. For assays of the effect of NF-jB
Table 1. Primer sequences for construction of scanning mutants. The mutated nucleotides are underlined.
Mutant Sequence (5¢) to 3¢)
Mut1 ACTAAGCTTAAAAGGGGACTTCTCTGGCATGGTTCAGG
TTTGGAGGCACCTGGGA
Mut2 ACTAAGCTTAAAAGGGGACTTCTCTGGCATGGTTC
CTGGGTGGAGGCACCTG
Mut3 ACTAAGCTTAAAAGGGGACTTCTCTGGCATGG
GGCAGGGGTGGAGGCAC
Mut4 ACTAAGCTTAAAAGGGGACTTCTCTGGCA
GTGTTCAGGGGTGGAGG
Mut5 ACTAAGCTTAAAAGGGGACTTCTCTG
TAATGGTTCAGGGGTGG
Mut6 ACTAAGCTTAAAAGGGGACTTCT
AGGGCATGGTTCAGGGG
Mut7 ACTAAGCTTAAAAGGGGACT
GATCTGGCATGGTTCAGGGG

Mut8 ACTAAGCTTAAAAGGGG
CATTCTCTGGCATGGTTCAGGGG
Mut9 ACTAAGCTTAAAAG
TTGACTTCTCTGGCATGGTTCAGGGG
Mut10 ACTAAGCTTAA
CCGGGGACTTCTCTGGCATGGTTCAGGGG
R. L. C. Hoo et al. Differential regulation of the GnRH II gene
FEBS Journal 274 (2007) 2695–2706 ª 2007 The Authors Journal compilation ª 2007 FEBS 2703
on promoter activity, 0.25 lg pCMV4-p50 and ⁄ or
pCMV4-p65 was cotransfected per well. For assays inves-
tigating the effect of RAR and RXR on promoter activ-
ity, 0.5 lg pCMX-hRARa and ⁄ or pCMX-hRXRa was
cotransfected per well. Appropriate amounts of the empty
vector, pcDNA3.1, were cotransfected so that the same
amounts of DNA were transfected in each sample. The
500 lL transfection mixture was added to 1.5 mL 10%
fetal bovine serum supplemented medium per well. After
37 °C incubation for 48 h, cell lysates were prepared by
first washing the cells twice with ice-cold NaCl ⁄ P
i
followed
by the addition of 200 lL reporter lysis buffer according
to the manufacturer’s protocol (Promega). For assays
investigating the effect of RAs on promoter activity, 1 lm
ATRA and ⁄ or 9-cisRA were added to the seeded cell cul-
tures in 35-mm wells, 24 h after the transient transfection
of promoter–luciferase constructs and ⁄ or human RA
expression vectors (0.5 lg pCMX-hRARa and ⁄ or pCMX-
hRXRa). After 24 h of drug treatment, cell lysates were
harvested as described previously.

Luciferase assay
A 100-lL sample of luciferase substrate solution (Promega)
was automatically injected into 20 lL cell lysate, and
luciferase activity was measured as light emission using a
luminometer (Lumat LB9507; EG & G Berthold, Bad
Wildbad, Germany). b-Galactosidase activity was deter-
mined by incubating the cell lysate (50 lL) in 100 mm
sodium phosphate buffer, pH 7.3, containing 1 mm MgCl
2
,
50 mm 2-mercaptoethanol and 0.7 mgÆmL
)1
o-itrophenyl
galactoside for 15 min at 37 °C. A
420
was measured using a
spectrophotometer (U-2800; Hitachi High-Technologies
Corporation, Tokyo Japan). For each transfection assay,
luciferase activity was determined and normalized on the
basis of b-galactosidase activity. Each plasmid was tested
at least nine times in three separate experiments.
Electrophoretic mobility-shift and supershift
assays
Nuclear proteins were extracted from TE671 cells and JEG-
3 cells as described previously [43]. The double-stranded
probe corresponding to hGII-Sil was end labeled using the
Ready-To-Go T4 polynucleotide kinase labeling kit (Amer-
sham Pharmacia Biotech, Arlington Heights, IL, USA) with
[c-
32

P]ATP (5000 CiÆnmol
)1
; Amersham Pharmacia Bio-
tech). Unlabeled nucleotides were removed by passing the
sample through a microspin column G-25 (Amersham
Pharmacia Biotech) at 3000 g. Binding reactions were per-
formed by incubating the 10 mg nuclear extracts with the
binding buffer (10 mm Tris ⁄ HCl, pH 7.5, 0.1 mm EDTA,
1mm magnesium acetate, 0.1 mm dithiothreitol, 5% gly-
cerol, 60 mm KCl), 1 l g poly(dI-dC), and 0.5 pmol
(200 000 cpm) labeled probe for 15 min at room tempera-
ture. For competition assays, 50-fold, 100-fold and 200-fold
molar excess of the unlabeled wild-type oligonucleotide,
hGII-Sil (5¢-CCTCCACCCCTGAACCATGCCAGA-3¢),
and nonspecific L8 oligonucleotide were used. For the
supershift assay, specific antibodies (rabbit polyclonal IgG;
Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA)
against known transcription factors were incubated with
the nuclear extract in the presence of 1 · binding buffer at
room temperature for 45 min before binding to the labeled
probe. Free and bound probes were separated by electro-
phoresis for 2 h at 200 V in a 5% nondenaturing poly-
acrylamide gel in 0.5 · Tris ⁄ borate ⁄ EDTA buffer (45 mm
Tris-borate, 0.1 mm EDTA). After electrophoresis, the gel
was dried and autoradiographed (Biomax MR film; East-
man Kodak Co., Rochester, NY, USA) for 16 h at )70 °C
with intensifiers (Amersham Pharmacia Biotech).
ChIP assay
ChIP assays were performed essentially as described by Lee
et al. [44]. TE671 cells were cross-linked with 1% formal-

dehyde. Cells were harvested by centrifugation and resus-
pended in lysis buffer (1% SDS, 10 mm EDTA, 50 mm
Tris ⁄ HCl, pH 8.1, 1 mm phenylmethanesulfonyl fluoride,
1 lgÆmL
)1
aprotinin and 1.5 lgÆmL
)1
pepstatin A). After
sonication in Sonifier 450 (Branson, Danbury, CT, USA),
4 lg antibody and 20 lL Protein G ⁄ agarose (Santa Cruz
Biotechnology) were added to precipitate the DNA–protein
complex. Precipitated DNA–protein Complex was washed in
the ChIP buffer (0.1% SDS, 1% Triton X-100, 0.1% sodium
deoxycholate, 140 mm NaCl, 1 mm phenylmethanesulfonyl
fluoride, 1 lgÆmL
)1
aprotinin and 1.5 lgÆmL
)1
pepstatin A)
and eluted in the elution buffer (1% SDS and 0.1 m NaH-
CO
3
). The mixture was incubated at 65 °C for 4 h to reverse
the formaldehyde cross-linking. Protein was removed by pro-
teinase K digestion (200 lgÆmL
)1
) and phenol ⁄ CHCl
3
extraction. The extracted DNA was used for PCR using
forward (GnRH II-F, 5¢-GGGTGGAGCTGCCTGGTC

TATA-3¢) and reverse (GnRH II-R, 5¢-CAGGGGCAACA
AGCACAAGA-3¢) primers.
Quantitative RT-PCR
Transfected cells were treated with the drug 1 day after
transfection for 24 h as described above, and total RNA
was isolated using the TriPure Isolated Reagent (Roche
Molecular Biochemicals, Basel, Switzerland). Total RNA
(5 lg) was reverse-transcribed with an oligo-dT primer and
Superscript III reverse transcriptase (Invitrogen). One-fifth
of the first-strand cDNA was used for real-time quantita-
tive PCR. The transcript levels of GnRH II were measured
with the SYBR Green Master Mix (Applied Biosystems,
Foster City, CA, USA) with specific primers; for GnRH,
forward primer 5¢-GCCCACCTTGGACCCTCAGAG-3¢
and reverse primer 5¢-CGGAGAACCTCACACTTTAT
Differential regulation of the GnRH II gene R. L. C. Hoo et al.
2704 FEBS Journal 274 (2007) 2695–2706 ª 2007 The Authors Journal compilation ª 2007 FEBS
TGG-3¢; and for glyceraldehyde-3-phosphate dehydroge-
nase (GAPDH), forward primer 5¢-ATTCCACCCATG
GCAAATTC-3¢ and reverse primer 5¢-GGCAGAGAT
GATGACCCT-3¢. The fluorescence signals were detected
with the iCycler iQ Real Time Detection System (Bio-Rad,
Hercules, CA, USA). The percentage change in target
transcript level was normalized with the internal control
GAPDH by the 2
–DDCt
method [45].
Statistical analysis
When appropriate and unless otherwise stated, the statisti-
cal significance of transfection data was evaluated by either

one-way analysis of variance followed by Dunnett’s test or
Bonferroni’s test with the negative control (pGL2-Basic) or
with the wild-type hGnRH II promoter construct pGL2-
()2103 ⁄ )620) as the independent variable. Differences are
regarded as significant when P < 0.05.
Acknowledgements
This work was supported by research grants from
CRCG HKU7501 ⁄ 05M and HKU7384 ⁄ 04M to
B.K.C.C.
References
1 Limonta P, Moretti RM, Marelli MM & Motta M
(2003) The biology of gonadotropin hormone-releasing
hormone: role in the control of tumor growth and pro-
gression in humans. Front Neuroendocrinol 24, 279–
295.
2 Chen A, Laskar-Levy O, Ben-Aroya N & Koch Y
(2001) Transcriptional regulation of the human GnRH
II gene is mediated by a putative cAMP response ele-
ment. Endocrinology 142, 3483–3492.
3 Chen A, Zi K, Laskar-Levy O & Koch Y (2002) The
transcription of the hGnRH-I and hGnRH-II genes in
human neuronal cells is differentially regulated by estro-
gen. J Mol Neurosci 18, 67–76.
4 Kang SK, Tai CJ, Nathwani PS & Leung PC (2001)
Differential regulation of two forms of gonadotropin-
releasing hormone messenger ribonucleic acid in human
granulosa-luteal cells. Endocrinology 142, 182–192.
5 Cheng CK, Hoo RL, Chow BK & Leung PC (2003)
Functional cooperation between multiple regulatory ele-
ments in the untranslated exon 1 stimulates the basal

transcription of the human GnRH-II gene. Mol Endo-
crinol 17, 1175–1191.
6 Hoo RL, Ngan ES, Leung PC & Chow BK (2003) Two
Inr elements are important for mediating the activity of
the proximal promoter of the human gonadotropin-
releasing hormone receptor gene. Endocrinology 144,
518–527.
7 Chen Z, Zheng H & Dong KW (2001) Identification of
negative and positive estrogen response elements in
human GnRH upstream promoter in the placental
JEG-3 cells. Mol Cell Endocrinol 184, 125–134.
8 Chen A, Yahalom D, Laskar-Levy O, Rahimipour S,
Ben-Aroya N & Koch Y (2001) Two isoforms of
gonadotropin-releasing hormone are coexpressed in
neuronal cell lines. Endocrinology 142, 830–837.
9 White RB, Eisen JA, Kasten TL & Fernald RD
(1998) Second gene for gonadotropin-releasing
hormone in humans. Proc Natl Acad Sci USA 95,
305–309.
10 Marelli MM, Moretti RM, Januszkiewicz-Caulier J,
Motta M & Limonta P (2006) Gonadotropin-releasing
hormone (GnRH) receptors in tumors: a new rationale
for the therapeutical application of GnRH analogs in
cancer patients? Curr Cancer Drug Targets 6, 257–269.
11 von Alten J, Fister S, Schulz H, Viereck V, Frosch KH,
Emons G & Grundker C (2006) GnRH analogs reduce
invasiveness of human breast cancer cells. Breast Cancer
Res Treat 100, 13–21.
12 Weber JR & Skene JH (1997) Identification of a novel
repressive element that contributes to neuron-specific

gene expression. J Neurosci 17, 7583–7593.
13 Li XR, Chong AS, Wu J, Roebuck KA, Kumar A,
Parrillo JE, Rapp UR, Kimberly RP, Williams JW &
Xu X (1999) Transcriptional regulation of Fas gene
expression by GA-binding protein and AP-1 in T cell
antigen receptor. CD3 complex-stimulated T cells.
J Biol Chem 274, 35203–35210.
14 Bonizzi G & Karin M (2004) The two NF-jB activation
pathways and their role in innate and adaptive immu-
nity. Trends Immunol 25, 280–288.
15 Campbell KJ & Perkins ND (2004) Post-translational
modification of RelA (p65) NF-jB. Biochem Soc Trans
32, 1087–1089.
16 Nakanishi C & Toi M (2005) Nuclear factor-jB inhibi-
tors as sensitizers to anticancer drugs. Nat Rev Cancer
5, 297–309.
17 Viatour P, Merville MP, Bours V & Chariot A (2005)
Phosphorylation of NF-jB and I
jB proteins: implica-
tions in cancer and inflammation. Trends Biochem Sci
30, 43–52.
18 McKay LI & Cidlowski JA (1998) Cross-talk between
nuclear factor-jB and the steroid hormone receptors:
mechanisms of mutual antagonism. Mol Endocrinol 12,
45–56.
19 McKay LI & Cidlowski JA (2000) CBP (CREB binding
protein) integrates NF-jB (nuclear factor-jB) and
glucocorticoid receptor physical interactions and anta-
gonism. Mol Endocrinol 14, 1222–1234.
20 Burkhart BA, Hebbar PB, Trotter KW & Archer TK

(2005) Chromatin-dependent E1A activity modulates
NF-jB RelA-mediated repression of glucocorticoid
R. L. C. Hoo et al. Differential regulation of the GnRH II gene
FEBS Journal 274 (2007) 2695–2706 ª 2007 The Authors Journal compilation ª 2007 FEBS 2705
receptor-dependent transcription. J Biol Chem 280,
6349–6358.
21 Ray A & Prefontaine KE (1994) Physical association
and functional antagonism between the p65 subunit of
transcription factor NF-kB and the glucocorticoid
receptor. Proc Natl Acad Sci USA 91, 752–756.
22 Sheppard KA, Phelps KM, Williams AJ, Thanos D,
Glass CK, Rosenfeld MG, Gerritsen ME & Collins T
(1998) Nuclear integration of glucocorticoid receptor
and nuclear factor-jB signaling by CREB-binding
protein and steroid receptor coactivator-1. J Biol Chem
273, 29291–29294.
23 Chambon P (1996) A decade of molecular biology of
retinoic acid receptors. FASEB J 10, 940–954.
24 Jho SH, Vouthounis C, Lee B, Stojadinovic O, Im MJ,
Brem H, Merchant A, Chau K & Tomic-Canic M
(2005) The book of opposites: the role of the nuclear
receptor co-regulators in the suppression of epidermal
genes by retinoic acid and thyroid hormone receptors.
J Invest Dermatol 124, 1034–1043.
25 Hong SH & Privalsky ML (1999) Retinoid isomers dif-
fer in the ability to induce release of SMRT corepressor
from retinoic acid receptor-a. J Biol Chem 274, 2885–
2892.
26 Farboud B & Privalsky ML (2004) Retinoic acid recep-
tor-a is stabilized in a repressive state by its C-terminal,

isotype-specific F domain. Mol Endocrinol 18, 2839–
2853.
27 McKenna NJ, Xu J, Nawaz Z, Tsai SY, Tsai MJ &
O’Malley BW (1999) Nuclear receptor coactivators:
multiple enzymes, multiple complexes, multiple func-
tions. J Steroid Biochem Mol Biol 69, 3–12.
28 Privalsky ML (2004) The role of corepressors in tran-
scriptional regulation by nuclear hormone receptors.
Annu Rev Physiol 66, 315–360.
29 Kurokawa R, DiRenzo J, Boehm M, Sugarman J, Gloss
B, Rosenfeld MG, Heyman RA & Glass CK (1994) Reg-
ulation of retinoid signalling by receptor polarity and
allosteric control of ligand binding. Nature 371, 528–531.
30 Forman BM, Umesono K, Chen J & Evans RM (1995)
Unique response pathways are established by allosteric
interactions among nuclear hormone receptors. Cell 81,
541–550.
31 Lala DS, Mukherjee R, Schulman IG, Koch SS,
Dardashti LJ, Nadzan AM, Croston GE, Evans RM &
Heyman RA (1996) Activation of specific RXR hetero-
dimers by an antagonist of RXR homodimers. Nature
383, 450–453.
32 Mangelsdorf DJ & Evans RM (1995) The RXR hetero-
dimers and orphan receptors. Cell 83, 841–850.
33 Sasaki S, Lesoon-Wood LA, Dey A, Kuwata T, Wein-
traub BD, Humphrey G, Yang WM, Seto E, Yen PM,
Howard BH, et al. (1999) Ligand-induced recruitment
of a histone deacetylase in the negative-feedback regula-
tion of the thyrotropin b gene. EMBO J 18, 5389–5398.
34 Tagami T, Park Y & Jameson JL (1999) Mechanisms

that mediate negative regulation of the thyroid-stimulat-
ing hormone a gene by the thyroid hormone receptor.
J Biol Chem 274, 22345–22353.
35 Fernandes I, Bastien Y, Wai T, Nygard K, Lin R,
Cormier O, Lee HS, Eng F, Bertos NR, Pelletier N et al.
(2003) Ligand-dependent nuclear receptor corepressor
LCoR functions by histone deacetylase-dependent and -
independent mechanisms. Mol Cell 11, 139–150.
36 Khan OY & Nawaz Z (2003) Nuclear hormone receptor
co-regulators. Curr Opin Drug Discov Dev 6, 692–701.
37 Mangelsdorf DJ, Umesono K, Kliewer SA, Borgmeyer
U, Ong ES & Evans RM (1991) A direct repeat in the
cellular retinol-binding protein type II gene confers
differential regulation by RXR and RAR. Cell 66,
555–561.
38 Chambon P (1995) The molecular and genetic dissection
of the retinoid signaling pathway. Recent Prog Horm
Res 50, 317–332.
39 Kurokawa R, Soderstrom M, Horlein A, Halachmi S,
Brown M, Rosenfeld MG & Glass CK (1995) Polarity-
specific activities of retinoic acid receptors determined
by a co-repressor. Nature 377, 451–454.
40 Weston AD, Blumberg B & Underhill TM (2003) Active
repression by unliganded retinoid receptors in develop-
ment: less is sometimes more. J Cell Biol 161, 223–228.
41 White JH, Fernandes I, Mader S & Yang XJ (2004)
Corepressor recruitment by agonist-bound nuclear
receptors. Vitam Horm 68, 123–143.
42 Murayama A, Kim MS, Yanagisawa J, Takeyama K &
Kato S (2004) Transrepression by a liganded nuclear

receptor via a bHLH activator through co-regulator
switching. EMBO J 23, 1598–1608.
43 Ausubel F, Brent R, Kingston RE, Moore DD,
Seidman JG, Smith JA & Struhi K (1987) Current
Protocols in Molecular Biology. Wiley, New York.
44 Lee LT, Tan-Un KC, Pang RT, Lam DT & Chow BK
(2004) Regulation of the human secretin gene is con-
trolled by the combined effects of CpG methylation,
Sp1 ⁄ Sp3 ratio, and the E-box element. Mol Endocrinol
18, 1740–1755.
45 Livak KJ & Schmittgen TD (2001) Analysis of relative
gene expression data using real-time quantitative PCR
and the 2 (-Delta Delta C (T) method. Methods 25,
402–408.
Differential regulation of the GnRH II gene R. L. C. Hoo et al.
2706 FEBS Journal 274 (2007) 2695–2706 ª 2007 The Authors Journal compilation ª 2007 FEBS