Báo cáo khoa học: Biochemical characterization of rice trehalose-6-phosphate phosphatases supports distinctive functions of these plant enzymes potx

Biochemical characterization of rice trehalose-6-phosphate
phosphatases supports distinctive functions of these plant
enzymes
Shuhei Shima
1,2
, Hirokazu Matsui
2
, Satoshi Tahara
2
and Ryozo Imai
1
1 Crop Cold Tolerance Research Team, National Agricultural Research Center for Hokkaido Region, NARO, Toyohira-ku, Sapporo, Japan
2 Department of Applied Bioscience, Graduate School of Agriculture, Hokkaido University, Sapporo, Japan
Trehalose is a nonreducing disaccharide in which two
glucose units are linked by an a,a -1,1-glycosidic link-
age. The prevalent pathway for trehalose synthesis
includes two enzymatic reactions. Trehalose 6-phos-
phate (Tre6P) is generated from UDP-glucose and glu-
cose 6-phosphate (Glc6P) in a reaction catalyzed by
trehalose-6-phosphate synthase (TPS). Tre6P is then
dephosphorylated to form trehalose via trehalose-6-
phosphate phosphatase (TPP) [1]. In yeast, trehalose
synthesis is carried out by a large enzyme complex that
is composed of four subunits, including TPS1, TPS2,
and regulatory subunits TSL1 and TPS3 [2].
Trehalose is widely distributed in nature. In bacteria,
fungi, and insects, trehalose functions as a storage car-
bohydrate or a blood sugar. In addition, trehalose can
protect cellular integrity against a variety of environ-
mental stresses associated with desiccation, heat, and
cold [3]. In plants, the presence of trehalose has been

Keywords
functional analysis; kinetic analysis; Oryza
sativa; recombinant protein; trehalose
Correspondence
R. Imai, Crop Cold Tolerance Research
Team, National Agricultural Research Center
for Hokkaido Region, National Agriculture
and Food Research Organization,
Hitsujigaoka 1, Toyohira-ku, Sapporo
0628555, Japan
Fax ⁄ Tel: +81 11 857 9382
E-mail:
(Received 8 November 2006, revised 14
December 2006, accepted 19 December
2006)
doi:10.1111/j.1742-4658.2007.05658.x
Substantial levels of trehalose accumulate in bacteria, fungi, and inverte-
brates, where it serves as a storage carbohydrate or as a protectant against
environmental stresses. In higher plants, trehalose is detected at fairly low
levels; therefore, a regulatory or signaling function has been proposed for
this molecule. In many organisms, trehalose-6-phosphate phosphatase is
the enzyme governing the final step of trehalose biosynthesis. Here we
report that OsTPP1 and OsTPP2 are the two major trehalose-6-phosphate
phosphatase genes expressed in vegetative tissues of rice. Similar to results
obtained from our previous OsTPP1 study, complementation analysis of a
yeast trehalose-6-phosphate phosphatase mutant and activity measurement
of the recombinant protein demonstrated that OsTPP2 encodes a func-
tional trehalose-6-phosphate phosphatase enzyme. OsTPP2 expression is
transiently induced in response to chilling and other abiotic stresses. Enzy-
matic characterization of recombinant OsTPP1 and OsTPP2 revealed strin-

gent substrate specificity for trehalose 6-phosphate and about 10 times
lower K
m
values for trehalose 6-phosphate as compared with trehalose-
6-phosphate phosphatase enzymes from microorganisms. OsTPP1 and
OsTPP2 also clearly contrasted with microbial enzymes, in that they are
generally unstable, almost completely losing activity when subjected to heat
treatment at 50 °C for 4 min. These characteristics of rice trehalose-6-
phosphate phosphatase enzymes are consistent with very low cellular sub-
strate concentration and tightly regulated gene expression. These data also
support a plant-specific function of trehalose biosynthesis in response to
environmental stresses.
Abbreviations
ABA, abcisic acid; Glc1P, glucose 1-phosphate; Glc6P, glucose 6-phosphate; GST, glutathione S-transferase; TPP, trehalose-6-phosphate
phosphatase; TPS, trehalose-6-phosphate synthase; Tre6P, trehalose 6-phosphate.
1192 FEBS Journal 274 (2007) 1192–1201 ª 2007 The Authors Journal compilation ª 2007 FEBS
documented in a limited number of species, including
Myrothamnus flabellifolia, a desiccation-tolerant desert
plant [4,5], and Selaginella lepidophylla, a desiccation-
tolerant moss [6]; its occurrence in many other plant
species is uncertain.
TPS and TPP genes were functionally identified in
Arabidopsis thaliana by complementation of Saccharo-
myces cerevisiae mutants [7,8]. Homologous TPS and
TPP genes have now been identified in many other
plant species. These results suggest that trehalose
synthesis may in fact be ubiquitous among angio-
sperms, although the levels to which it accumulates
are generally low [1,9]. Attempts to increase trehalose
content in plants by overexpressing microbial TPS

and TPP genes resulted in transgenic tobacco and
potato plants with increased stress tolerance at the
tissue level [10–12]. However, these transformants
exhibited pleiotropic phenotypes, such as stunted
growth and lancet-shaped leaves [11,12]. On the
other hand, expression of an Escherichia coli TPS–
TPP fusion enzyme in transgenic rice resulted in
accumulation of 3–10 times more trehalose compared
to nontransgenic rice plants, imparting abiotic stress
tolerance without altering morphology [13,14]. There-
fore, these findings suggested that accumulation of
Tre6P may result in the observed morphologic alter-
ations in the tobacco and potato studies.
Although trehalose biosynthesis in higher plants has
been demonstrated, details of both the physiologic
functions and regulation of this pathway remain lar-
gely unknown. Genome sequencing of Arabidopsis and
rice has revealed complex genomic organization of
plant trehalose biosynthesis genes. Eleven putative TPS
and 10 putative TPP genes were identified within the
Arabidopsis genome, and nine putative TPS and nine
putative TPP genes were found within the rice genome.
Genetic studies have revealed that trehalose biosyn-
thesis genes function specifically in regulating plant
growth and development. An Arabidopsis knockout
mutant of AtTPS1 exhibited impaired embryo matur-
ation [15]. Further characterization of the mutant dem-
onstrated that AtTPS1 is also required for vegetative
growth and flowering [16]. A recent study established
that a maize TPP gene is involved in inflorescence

development [17]. A more specific function of trehalose
biosynthesis in the regulation of starch biosynthesis
has recently been revealed. Trehalose feeding was
found to induce expression of ApL3, encoding a large
subunit of ADP-glucose pyrophosphorylase in Arabid-
opsis [18,19]. It was demonstrated recently that Tre6P
directly regulated starch synthesis via post-transla-
tional redox activation of ADP-glucose pyrophospho-
rylase [20,21].
In our previous study, we demonstrated that expres-
sion of the rice TPP gene OsTPP1 is rapidly and tran-
siently induced by chilling stress and abcisic acid
(ABA) treatment. Induction of OsTPP1 was followed
by transient increases in total TPP activity and treha-
lose content in rice root [22]. Eight other members of
the rice TPP gene family have not yet been character-
ized, so it is not known if these members have diver-
gent functions in rice. In addition, the enzymatic
properties of plant TPPs are largely unknown.
In this article, we report the isolation of a second
TPP gene from rice, OsTPP2, and its relative tran-
scription in response to abiotic stresses, as well as the
in vivo and in vitro functionality of its translated prod-
uct. We also describe unique kinetic and biophysical
properties of the plant TPPs.
Results
Isolation of rice OsTPP2
Completion of the rice genome sequence revealed nine
putative TPP genes. To determine which of these TPP
genes are expressed in rice seedlings, RT-PCR was car-

ried out using specific primer sets designed to amplify
transcripts from all of these OsTPP genes (OsTPP1–
OsTPP9) [22]. Only mRNA for OsTPP2 was detected
in addition to that of the previously characterized
OsTPP1 after 28 cycles of PCR amplification
(Fig. 1A). OsTPP3–OsTPP9 mRNAs were not detec-
ted in root and shoot tissues after up to 35 cycles of
amplification (data not shown). These results suggested
that OsTPP1 and OsTPP2 were the major TPP genes
expressed in rice seedlings. A full-length OsTPP2
cDNA was then isolated from root tissue by RT-PCR.
The OsTPP2 gene contained an ORF encoding a
42.6 kDa protein with 382 amino acid residues. Overall
amino acid sequence homology between OsTPP2 and
OsTPP1 was 53% (Fig. 1B). Greater similarity was
observed between OsTPP2 and Arabidopsis AtTPPA
(57%). OsTPP2 contains two motifs shared by all TPP
enzymes (Fig. 1B), known as phosphatase boxes: (FIL -
MAVT)-D-(ILFRMVY)-D-(GSNDE)-(TV)-(ILVAM)-
(ATSVILMC)-X-(YFWHKR)-X-(YFWHNQ) (domain
A), and (KRHNQ)-G-D-(FYWHILVMC)-(QNH)-
(FWYGP)-D-(PSNQYW) (domain B) [23].
Responses of OsTPP2 to chilling and other
abiotic stresses
In our previous study, we demonstrated that OsTPP1
expression is transiently induced by multiple abiotic
stresses [22]. We therefore determined whether
S. Shima et al. Rice trehalose-6-phosphate phosphatases
FEBS Journal 274 (2007) 1192–1201 ª 2007 The Authors Journal compilation ª 2007 FEBS 1193
OsTPP2 expression is also responsive to abiotic stres-

ses. RNA gel blot analysis was performed on total
RNA extracted from rice seedlings subjected to low
temperature (12 °C), drought, and salt stresses
(Fig. 2). OsTPP2 mRNA levels were detectable prior
to stress treatments, and transiently increased in
response to low temperature, peaking at 10 h after
the initiation of treatment in both shoot and root tis-
sues. This expression pattern contrasted with the
observed rapid induction of OsTPP1 and gradual
induction of OsMEK1 in response to low-temperature
treatment [22,24]. Drought stress transiently induced
OsTPP2 expression, which peaked at 6 h in shoots
and 2 h in roots (Fig. 2). The induction of OsTPP2
expression occurs earlier during stress treatment com-
pared with expression of another drought-induced
gene (salT) [25]. Treatment with 150 mm NaCl also
induced OsTPP2 expression (Fig. 2) in roots, suggest-
ing that stresses associated with water deficit similarly
affect expression of this gene. However, in contrast to
chilling and drought stress treatments, clear induction
of OsTPP2 was not observed in shoots, whereas the
salt treatment effectively induced salT in both roots
and shoots. Slight and transient induction of OsTPP2
was observed in roots and shoots in response to exo-
genous ABA. Together, these expression analyses indi-
cated involvement of OsTPP2 in multiple stress
responses.
A
B
A

B
Fig. 1. Expression of putative OsTPP genes in young vegetative tissues, and alignment of TPP sequences. (A) Expression analysis of puta-
tive TPP genes with RT-PCR, using RNAs extracted from root and shoot tissues of rice seedlings (O. sativa L. cv. Yukihikari). (B) Alignment
of the amino acid sequences of OsTPP2, OsTPP1 (O. sativa [22]), AtTPPA and AtTPPB (A. thaliana [8]), TPS2 (Sa. cerevisae [34]) and OtsB
(E. coli [35]). Database accession numbers are: OsTPP1, BAD12596; OsTPP2, BAF34519; AtTPPA, AAC39369; AtTPPB, AAC39370; TPS2,
CAA98893; and OtsB, CAA48912. Shading reflects the degree of amino acid conservation. Black shading indicates amino acid identity. The
bars represent highly conserved domains.
Rice trehalose-6-phosphate phosphatases S. Shima et al.
1194 FEBS Journal 274 (2007) 1192–1201 ª 2007 The Authors Journal compilation ª 2007 FEBS
OsTPP2 complements a yeast Dtps2 mutant
To detect OsTPP2 enzyme function in vivo,aSa. cere-
visiae (YPH499) tps2 (TPP) deletion mutant [22] was
transformed with plasmid constructs based on the
pAUR123 vector (Takara). Whereas wild-type cells
grow at both 30 °C and 36 °C, growth of the Dtps2
mutant at 36 °C was inhibited because of its inability
to synthesize trehalose (Fig. 3). The same mutant yeast
strain transformed with OsTPP2 recovered wild-type
levels of growth at 36 °C, suggesting that OsTPP2 is a
functional TPP enzyme in yeast cells.
TPP activity of recombinant OsTPP2
To determine whether OsTPP2 exhibits TPP activity
in vitro, it was purified as a recombinant protein. To
accomplish this, the ORF of OsTPP2 was inserted into
a pGEX-6P-3 vector to produce a glutathione S-trans-
ferase (GST)–OsTPP2 fusion protein. After affinity
column purifications and protease digestion, OsTPP2
proteins were purified to near homogeneity. The size
of the purified recombinant enzyme was estimated to
be 45 kDa on SDS ⁄ PAGE, in accordance with the size

deduced from the nucleotide sequence (42.6 kDa)
(Fig. 4A). TPP activity was then measured using this
purified recombinant enzyme. Aliquots of purified
enzyme were added to the reaction mixtures, and
conversion of Tre6P into trehalose was detected as a
measure of enzyme activity (Fig. 4B). Under these
same conditions, purified GST or NaCl ⁄ P
i
solution
without enzyme did not result in this conversion
(Fig. 4B). We therefore concluded that OsTPP2
encodes a functional TPP enzyme.
Enzymatic properties of OsTPP1 and OsTPP2
Although genes encoding plant TPPs have been identi-
fied in several plant species, their enzymatic character-
istics have not been explored. To further characterize
the enzymatic properties of plant TPP enzymes, we
also purified recombinant OsTPP1 using the same
methods. Then, the kinetic parameters of these recom-
binant OsTPP1 and OsTPP2 enzymes were determined.
The K
m
values for Tre6P of OsTPP1 and OsTPP2
were determined to be 0.0921 and 0.186 mm, respect-
ively, using Hanes–Woolf plots (Table 1). The k
cat
val-
ues of OsTPP1 and OsTPP2 were 6.52 and 13.4 s
)1
,

respectively. Therefore, the k
cat
⁄ K
m
values of OsTPP1
and OsTPP2 were approximately the same. These
Fig. 3. Complementation of the heat-sensitive phenotype of a
Sa. cerevisiae tps2 deletion mutant by introduction of OsTPP2.A
YPH499 tps2 deletion mutant was transformed with the pAUR123
vector (Dtps2) and pAUR123-OsTPP2 (Dtps2 ⁄ OsTPP2). As a posit-
ive control, YPH499 wild-type cells were transformed with the
empty pAUR123 vector (wt). These transformants were grown
overnight in YPD liquid medium supplemented with 0.5 lgÆmL
)1
aureobasidin A. The cultures were then diluted 1–1000 times. Five
microliters of each dilution was then spotted onto an YPD agar
plate supplemented with 0.5 lgÆmL
)1
aureobasidin A. These plates
were incubated at 30 °Cor36°C for 2 days.
A
B
C
D
Fig. 2. Expression of OsTPP2 in rice seedlings in response to
abiotic stress and exogenous ABA treatment. Total RNAs were iso-
lated from rice seedlings subjected to chilling stress (A), drought
stress (B), 150 m
M NaCl stress (C), and exogenous ABA (50 lM)
solution (D). The RNA blots were hybridized with an OsTPP2 probe.

The expression of OsTPP1 is shown for comparison of expression
patterns, and those of OsMEK1 [24] and salT [25] are shown as
positive controls for these treatments. Ethidium bromide-stained
total RNA (10 lg) is presented as a loading control.
S. Shima et al. Rice trehalose-6-phosphate phosphatases
FEBS Journal 274 (2007) 1192–1201 ª 2007 The Authors Journal compilation ª 2007 FEBS 1195
results indicated that both enzymes exhibit similar cat-
alytic activities. It is interesting to note here that the
K
m
values for rice TPPs are more than 10 times lower
than those of bacterial TPP enzymes reported thus far.
For instance, others reported that the K
m
values for
E. coli and Mycobacterium smegmatis TPPs were
2.5 mm and 1.5 mm, respectively [26,27].
To determine the substrate specificity of these
recombinant proteins, phosphatase activities were
measured using various sugar phosphate substrates
[glucose 1-phosphate (Glc1P), Glc6P, galactose 6-
phosphate, mannose 1-phosphate, mannose 6-phos-
phate, fructose 1-phosphate, fructose 6-phosphate,
sucrose 6-phosphate, lactose 1-phosphate, and ribose
5-phosphate]. Both OsTPP1 and OsTPP2 exhibited
strong phosphatase activity upon Tre6P, but almost
no activity (less than 1% relative to Tre6P) was detec-
ted with any of the other sugar phosphates tested (data
not shown).
The pH dependences of OsTPP1 and OsTPP2

enzyme activities were determined within a pH range
of 5.5–9.0, using two different buffers (Mes ⁄ NaOH,
pH 5.5–7.5; Tris ⁄ HCl, pH 7.0–9.0). The pH optima of
OsTPP1 and OsTPP2 were approximately 7.0 and 6.5,
respectively, whereas the enzymes had almost no activ-
ity at pH 5.5 or 9 (Fig. 5).
The heat stabilities of the recombinant OsTPP1
and OsTPP2 were determined by measuring residual
activities after heat treatments (40–80 °C) (Fig. 6).
A
B
Fig. 4. Purification of recombinant OsTPP1 and OsTPP2 and deter-
mination of their activities. Recombinant OsTPP1 and OsTPP2 were
purified according to the experimental procedure described previ-
ously. (A) SDS ⁄ PAGE (12%) was run with protein standards
(lane M), crude extracts of the recombinant bacterial strains
induced without (lane 2) or with (lane 3) isopropyl thio-b-
D-galacto-
side, and purified recombinant OsTPP1 or OsTPP2 (lane 4). (B)
Chromatograms detailing TPP activities of recombinant OsTPP1,
OsTPP2, and GST. These proteins (0.5 lg) were used for assays in
100 lL reaction mixtures (2 m
M Tre6P,2mM MgCl
2
,50mM
Tris ⁄ HCl, pH 7.0). T; trehalose; T6P, trehalose 6-phosphatase.
Table 1. Enzymatic properties of recombinant OsTPP1 and
OsTPP2.
Protein
K

m
a
(mM)
K
cat
(s
)1
)
K
cat
⁄ K
m
(mM
)1
Æs
)1
) Reference
OsTPP1 0.0921 6.52 70.8 This study
OsTPP2 0.186 13.4 72.0 This study
E. coli TPP 2.5 14.3 5.8 [27]
M. smegmatis TPP 1.5 – – [26]
a
K
m
for Tre6P.
Rice trehalose-6-phosphate phosphatases S. Shima et al.
1196 FEBS Journal 274 (2007) 1192–1201 ª 2007 The Authors Journal compilation ª 2007 FEBS
Heat treatment at 50 °C or higher for 4 min nearly
eliminated both OsTPP1 and OsTPP2 activity, indica-
ting that both enzymes are heat-labile.

Discussion
Identification and functional characterization of treha-
lose biosynthesis genes have established trehalose
biosynthesis in higher plants. However, low-level accu-
mulation of trehalose in plants suggests a distinctive
function of this substance compared with its role in
other organisms. Organization of these trehalose bio-
synthesis genes is also quite unique in higher plants.
Only one or two copies of TPS and TPP genes exist in
most bacteria, fungi, and insects, whereas these genes
constitute a large gene family in higher plants. For
example, in Arabidopsis, 11 TPS and 10 TPP genes
have been identified from genomic information [28,29],
and nine TPS and nine TPP homologs are found in
the rice genome. Therefore, researchers have specula-
ted that trehalose biosynthesis is tightly regulated dur-
ing plant growth and development, and that each TPS
and TPP gene is under specific regulation. In this
study, we identified a novel TPP gene (OsTPP2) from
rice, and demonstrated that OsTPP2 and the previ-
ously identified OsTPP1 are predominantly expressed
in young vegetative tissues of rice. According to the
results of yeast complementation analysis and enzyme
assays with recombinant protein, OsTPP2 encodes a
functional TPP.
Expression of OsTPP2 was regulated by multiple
stress factors, such as chilling, drought, and salt stresses,
as well as ABA treatment (Fig. 2). It is interesting that
OsTPP1 is also regulated by the same stress factors but
its induction kinetics are quite different in comparison

to those of OsTPP2 [22]. OsTPP2 is transiently induced
after 10 h of chilling stress (12 °C), whereas transient
induction of OsTPP1 occurs much earlier ) within 2 h
of the chilling stress [22]. Similarly, the patterns of OsT-
PP2 induction in response to drought and salt stresses
A
B
Fig. 5. Optimal pH for recombinant OsTPP1 (A) and OsTPP2 (B)
activity. The reaction buffer systems tested were Mes ⁄ NaOH
(pH 5.5–7.5) and Tris ⁄ HCl (pH 7.0–9.0). The enzyme assay was car-
ried out as described in Experimental procedures. This activity was
determined by measuring inorganic phosphate released from
Tre6P.
A
B
Fig. 6. Heat stability of recombinant OsTPP1 (A) and OsTPP2 (B).
The purified recombinant OsTPP1 and OsTPP2 were incubated for
various time periods at temperatures ranging from 40 °Cto80°C.
The residual activity after treatment is expressed as a percentage
of the original activity.
S. Shima et al. Rice trehalose-6-phosphate phosphatases
FEBS Journal 274 (2007) 1192–1201 ª 2007 The Authors Journal compilation ª 2007 FEBS 1197
differ from those of OsTPP1 under similar conditions.
OsTPP2 is induced by exogenous ABA during 1–2 h of
treatment, whereas ABA induction of OsTPP1 occurs
more rapidly (within 1 h) and pronouncedly [22]. These
data clearly show that OsTPP1 and OsTPP2 are under
distinctive regulation. Our preliminary results with
green fluorescent protein fusion proteins suggested that
both OsTPP1 and OsTPP2 are cytosolic proteins. It was

therefore suggested that trehalose biosynthesis is tightly
regulated in response to multiple abiotic stress factors in
rice, the process involving two differentially regulated
TPP enzymes.
Using recombinant enzymes, we conducted the first
detailed functional characterization of plant TPPs.
These rice TPPs displayed three distinct properties com-
pared with the previously characterized microbial TPPs.
First, the K
m
values for the recombinant OsTPP1 and
OsTPP2 enzymes are lower than values published for
the microbial enzymes. Others have reported that the
Tre6P concentration in Arabidopsis is relatively very low
(10.1 ± 1.3 lgÆg
)1
fresh weight) [30]. Therefore, these
low K
m
values for OsTPP1 and OsTPP2 correlate with
low concentrations of this substrate in plant cells.
Second, these rice TPPs were overall less stable than
bacterial enzymes. For example, others reported that a
TPP from Mycobacterium did not lose activity after heat
treatment at 60 °C for 6 min [31]. In contrast, the results
of this study indicate that OsTPP1 and OsTPP2 are
completely inactivated after incubation at 50 °C for 3 or
4 min, so these enzymes are heat-labile. This further
suggests that the turnover rates of OsTPP1 and OsTPP2
are relatively high. Relatively rapid turnover of these

enzymes would better enable tight control of trehalose
or Tre6P levels in rice. Third, the substrate specificity of
OsTPP1 and OsTPP2 is higher than for the correspond-
ing bacterial enzymes [31]. For instance, the mycobacte-
rial TPP exhibited approximately 18% and 5% relative
activities against Glc1P and Glc6P, when compared
with Tre6P substrate. In contrast, no phosphatase activ-
ity was detected when OsTPP1 and OsTPP2 were
incubated with various sugar phosphate substrates,
including Glc1P and Glc6P (data not shown).
The function of trehalose in stress tolerance has
been documented in several transgenic plants [13,32].
However, whether trehalose has a direct stress protec-
tion function in wild-type plants (as in the case of
microorganisms) or a regulatory function remains
unclear. Rice transgenic plants expressing an otsA–otsB
fusion gene exhibited improved stress tolerance; how-
ever, trehalose in these plants did not reach high
enough levels to function as an osmoprotectant
[14,33]. Moreover, trehalose accumulated in wild-type
rice plants at very low levels, and changed minimally
and transiently in response to chilling stress [22]. In
this study, we discovered that stress-induced OsTPP2
expression was transient and distinct from the expres-
sion pattern of salT (which encodes a protein with a
putative stress protection function) under those same
conditions [25]. Moreover, others have shown recently
that the trehalose biosynthesis pathway is intercon-
nected with the glucose and ABA signaling pathways
in Arabidopsis [30]. These current studies suggest that

trehalose or Tre6P is involved in regulation of stress
responses in higher plants.
Although the trehalose biosynthesis pathways are
conserved during evolution, a unique function of this
substance in higher plants has yet to be elucidated.
Rather than overproduction of trehalose as a stress
protectant or as a storage carbohydrate, fine-tuned
biosynthesis is required to produce the putative signa-
ling molecules trehalose or Tre6P in higher plants. Our
genetic and biochemical analyses presented here sup-
port this hypothesis.
Experimental procedures
Plant materials, growth conditions and stress
treatments
Seeds of Japonica rice (Oryza sativa L. cv. Yukihikari) were
surface-sterilized in 70% ethanol for 20 min, further steril-
ized in 2.5% sodium hypochlorite solution for 25 min, and
then washed several times with sterile water. These steril-
ized seeds were then soaked in distilled water for 4 days
and set for germination in the dark at 20 °C. Germinated
seeds were uniformly distributed onto a plastic mesh grid
that was supported by a plastic container filled with water
up to the base of the mesh grid. Seeds were then grown
under continuous illumination in a growth chamber at
25 °C. After growth for 7 days, the seedlings were subjected
to various abiotic stress treatments. Chilling treatment was
imposed by transferring mesh grids containing seedlings
into containers filled with prechilled water at 12 °Cina
growth chamber set at the respective temperature. Roots
and shoots of the treated seedlings were collected after 0

(control), 1, 2, 4, 6, 10, 24 and 48 h of chilling treatment,
immediately frozen in liquid nitrogen, and stored at )80 °C
for further analysis. For NaCl and ABA treatments, 7-day-
old rice seedlings were transferred, along with the mesh
grid, and placed into solutions containing 150 mm NaCl
and 50 lm ABA, respectively. For ABA treatments, shoots
were also sprayed with ABA solution. Drought treatment
was imposed by shifting the mesh grid with seedlings
(immediately removing free water from roots by blotting on
a paper towel) into a container without water. Roots and
shoots of the treated seedlings were then collected and
stored as mentioned previously.
Rice trehalose-6-phosphate phosphatases S. Shima et al.
1198 FEBS Journal 274 (2007) 1192–1201 ª 2007 The Authors Journal compilation ª 2007 FEBS
RT-PCR and cDNA cloning
Expression analysis of all putative TPP genes was carried
out by RT-PCR. Total RNA was extracted from root and
shoot tissues of rice seedlings (O. sativa L. cv. Yukihikari)
using TRIzol reagent (Invitrogen, Carlsbad, CA, USA).
The total RNA (1 lg) was reverse-transcribed using the
GeneAmp Gold RNA PCR Reagent Kit (Applied Biosys-
tems, Foster City, CA, USA) with an oligo-dT primer. The
following PCR was carried out using gene-specific forward
and reverse primers (listed in Table 2) according to the
protocol supplied with the kit. GeneAmp 9700 (Applied
Biosystems) was used for amplification with the following
program: 28 or 35 cycles of 94 °C for 45 s, 53 °C for
45 min, and 72 °C for 1.5 min, with a final extension at
72 °C for 5 min. The amplified bands were cloned into a
pGEM-T easy vector (Promega, Madison, WI, USA) and

subsequently sequenced.
DNA sequencing and analysis
DNA sequencing was carried out using an ABI PRISM 310
Genetic Analyzer (PE Biosystems, Foster City, CA, USA).
The BigDye Terminator v1.1 Cycle Sequencing Kit
(Applied Biosystems) was used for the sequencing reaction.
Sequence analysis was performed using genetyx software
(Software Development, Tokyo, Japan). Multiple amino
acid alignments were performed using the online clustal w
alignment program at a website maintained by DDBJ
( />Northern blot analyses
Total RNA was isolated from plant tissues using TRIzol
reagent (Invitrogen). Ten micrograms of total RNA was
then denatured in formamide and formaldehyde, separated
on 0.8% agarose gels, and transferred onto Hybond-N
+
membranes (GE Healthcare, Piscataway, NJ, USA). The
blots were hybridized in Rapid-Hyb Buffer (GE Health-
care) at 65 ° C with a
32
P-labeled full-length OsTPP2 frag-
ment as a probe. The blots were washed twice with wash
buffer (2 · NaCl ⁄ Cit, 0.1% SDS) for 15 min at 65 °C, and
then washed twice with another wash buffer (0.2 · NaCl ⁄ -
Cit, 0.1% SDS) for 15 min at 65 °C. The blots were then
exposed to X-ray film for signal detection.
Yeast complementation
A Sa. cerevisiae tps2 deletion mutant of the YPH499
(MATa his3-D200 leu2-D1 lys2-801 trp1-D1 ade2-101
ura3-52) strain was used as a host cell population for

complementation analysis [22]. The OsTPP2 ORF region
was cloned into the pAUR123 vector (Takara, Kyoto,
Japan), which allows constitutive expression of the insert
under control of the ADH1 promoter. Transformation of
Sa. cerevisiae was carried out with the S.c. EasyComp
Transformation Kit (Invitrogen). The plasmid vectors
pAUR123-OsTPP2 and pAUR123 were transformed into
both the wild-type and the mutant YPH499 strains. These
transformants were cultured in YPD liquid medium (1%
yeast extract, 2% peptone and 2% glucose) until a D
600
of
0.5 was reached. The collected cells were resuspended in
sterilized water, and a series of dilutions (10
)1
,10
)2
, and
10
)3
) was made. Five microliters of each dilution was then
dropped onto YPD plates and cultured for 2 days at either
30 °Cor36°C.
Recombinant protein production and purification
The ORFs of OsTPP1 and OsTPP2 were PCR-amplified
with BamHI and SalI linker sequences from the correspond-
ing cDNA clones. These PCR products were digested and
ligated with a predigested pGEX-6P-3 vector (GE Health-
care). E. coli BL21 cells were then transformed with the
resulting pGEX-OsTPP1 and pGEX-OsTPP2 vectors,

respectively. The transformant cells were grown overnight in
LB medium containing ampicillin (50 lgÆmL
)1
), inoculated
into 2 · YT medium containing ampicillin (50 lgÆmL
)1
),
and cultured at 37 °C for 3 h. Recombinant protein expres-
sion was induced with 0.5 mm isopropyl thio-b-d-galacto-
side and incubated for another 3 h. Pelleted cells were
resuspended in 10 mL of NaCl ⁄ P
i
(pH 7.4, 0.14 m NaCl,
3mm KCl, 10 mm Na
2
HPO
4
,2mm KH
2
PO
4
) and disrup-
ted with sonication. Lysed samples were centrifuged in an
AR 0/5-24 rotor (MX-300; Tomy, Tokyo, Japan) at
14 000 g for 5 min at 4 °C. Recombinant proteins were
purified from the soluble fractions with a glutathione-seph-
arose 4B affinity column (GE Healthcare), and then digested
with precision protease at 4 °C. The protein samples were
separated by SDS ⁄ PAGE (12%) and stained with Coomas-
Table 2. Oligonucleotide primers used for RT-PCR analysis.

Gene Orientation Oligonucleotide sequence (5¢-to3¢)
OsTPP1 (AB120515) Forward TCAGTCATGCCCGGTGGC
Reverse ACACTGAGTGCTTCTTCC
OsTPP2 (AB277360) Forward ATGGATTTGAAGACAAGCAAC
Reverse TTAAGTGGATTCCTCCTTCCA
OsTPP3 (AP004341) Forward ATGACGAACCACGCCGGC
Reverse CTACTTGCCAATCAGCCCTTT
OsTPP4 (AP004119) Forward CTGTTCGTCTCGACGAGT
Reverse TCTTACGGCCTCTACACC
OsTPP5 (AL606633) Forward CACGCACCTACACCAAGA
Reverse TGATGGGCCTCTCAGCAT
OsTPP6 (AP004658) Forward TCAACGGATGGGTGGAGT
Reverse ACTTGGACACGAGGATGC
OsTPP7 (AP005580) Forward CACGACGCTGTTCCCGTA
Reverse TCAACCGTGTCCTGGACA
OsTPP8 (AP004727) Forward AGTACGACGCGTGGACGA
Reverse GTGTGCTGCGAAGTCATG
OsTPP9 (AC103551) Forward TGCTCTCTCGCTCTCGTT
Reverse AGTGTCACTGTGGTCAGG
S. Shima et al. Rice trehalose-6-phosphate phosphatases
FEBS Journal 274 (2007) 1192–1201 ª 2007 The Authors Journal compilation ª 2007 FEBS 1199
sie Brilliant Blue. The protein concentrations were measured
with a Bio-Rad Protein Assay (Bio-Rad, Hercules, CA,
USA) using IgG as a standard.
Assay of TPP activity
Assays for TPP enzyme activity were carried out in reaction
mixtures (100 lL) containing the following components:
2mm Tre6P,2mm MgCl
2
,50mm Tris ⁄ HCl buffer

(pH 7.0), and an appropriate amount of enzyme (0.5 lg).
After incubation at 37 °C for 30 min, these mixtures were
boiled for 4 min to stop the reaction. The amount of treha-
lose produced was determined using a Dionex (DX-500)
gradient chromatography system coupled with pulse amper-
ometric detection (Dionex Corporation, Sunnyvale, CA,
USA). The samples were applied to a CarboPac PA1 colum
(Dionex) equilibrated with 0.1 m NaOH, using a flow rate
of 1 mLÆmin
)1
. A 0.2 m sodium acetate gradient buffered in
0.1 m NaOH was applied over 3–8 min; the sodium acetate
concentration was then increased to 1 m for 2 min before
equilibrating the column again with 0.1 m NaOH. Under
these conditions, the retention times of trehalose and Tre6P
were 2.8 min and 12.0 min, respectively.
For the analysis of optimum pH, substrate specificity,
and heat tolerance, TPP activity was assayed by determin-
ing released inorganic phosphate levels with BIOMOL
GREEN Reagent (Biomol Research Laboratories,
Plymouth Meeting, PA, USA). Two volumes of this reagent
were added to each terminated enzyme reaction, and then
incubated for 20 min at room temperature. The absorbance
of each mixture was determined at 620 nm with a Beckman
DU-65 spectrophotometer (Beckman Instrument, Inc., Full-
erton, CA, USA) and compared with that of a standard
solution.
Substrate specificity
TPP enzymes (0.5 lg) were added to a reaction mixture
(100 lL) containing 50 mm Tris ⁄ HCl (pH 7.0), 2 mm

MgCl
2
, and 2 mm sugar phosphate, and incubated at 37 °C
for 30 min. The sugar phosphate substrates tested were
Glc1P, Glc6P, galactose 6-phosphate, mannose 1-phos-
phate, mannose 6-phosphate, fructose 1-phosphate, fructose
6-phosphate, sucrose 6-phosphate, lactose 1-phosphate and
ribose 5-phosphate. All sugar phosphates were purchased
from Sigma Chemical Co. (St Louis, MO, USA).
PH optimum
The pH optimum of TPP was determined using two differ-
ent buffer systems, Mes ⁄ NaOH (pH 5.5–7.5) and Tris ⁄ HCl
(pH 7.0–9.0). The conditions for the enzyme reaction and
determination of inorganic phosphate levels were as des-
cribed above.
Heat stability of TPP
The purified proteins were heat-treated at different temper-
atures (40–80 °C) for 0, 1, 2, 3 or 4 min, and then cooled
immediately on ice. After centrifugation at 20 000 g for
5 min by using MX-300 (Tomy), the supernatants were
used to determine residual activity. Enzyme reactions and
determination of inorganic phosphate levels were carried
out as described above.
References
1 Goddijn OJ & van Dun K (1999) Trehalose metabolism
in plants. Trends Plant Sci 4, 315–319.
2 Bell W, Sun W, Hohmann S, Wera S, Reinders A,
De Virgilio C, Wiemken A & Thevelein JM (1998)
Composition and functional analysis of the Saccharo-
myces cerevisiae trehalose synthase complex. J Biol

Chem 273 , 33311–33319.
3 Elbein AD (1974) The metabolism of alpha,alpha-treha-
lose. Adv Carbohydr Chem Biochem 30, 227–256.
4 Bianchi G, Gamba A, Limiroli R, Pozzi N, Elster R,
Salamini F & Bartels D (1993) The unusual sugar com-
position in leaves of the resurrection plant Myrothamnus
flabellifolia. Physiol Plant 87, 223–226.
5 Drennan PM, Smith TM, Goldsworthy D & van Staden
J (1993) The occurrence of trehalose in the leaves of the
desiccation-tolerant angiosperm Myrothamnus flabellifo-
lius Welw. J Plant Physiol 142, 493–496.
6Mu
¨
ller J, Boller T & Wiemken A (1995) Trehalose and
trehalase in plants: recent developments. Plant Sci 112,
1–9.
7 Blazquez MA, Santos E, Flores CL, Martinez-Zapater
JM, Salinas J & Gancedo C (1998) Isolation and molecu-
lar characterization of the Arabidopsis TPS1 gene, encod-
ing trehalose-6-phosphate synthase. Plant J 13, 685–689.
8 Vogel G, Aeschbacher RA, Muller J, Boller T & Wiem-
ken A (1998) Trehalose-6-phosphate phosphatases from
Arabidopsis thaliana: identification by functional comple-
mentation of the yeast tps2 mutant. Plant J 13, 673–683.
9 Goddijn O & Smeekens S (1998) Sensing trehalose bio-
synthesis in plants. Plant J 14, 143–146.
10 Holmstrom KO, Mantyla E, Welin B, Mandal A &
Palva ET (1996) Drought tolerance in tobacco. Nature
379, 683–684.
11 Goddijn OJ, Verwoerd TC, Voogd E, Krutwagen RW,

de Graaf PT, van Dun K, Poels J, Ponstein AS, Damm
B & Pen J (1997) Inhibition of trehalase activity
enhances trehalose accumulation in transgenic plants.
Plant Physiol 113, 181–190.
12 Romero C, Belles JM, Vaya JL, Serrano R & Culianez-
Macia FA (1997) Expression of the yeast trehalose-6-
phosphate synthase gene in transgenic tobacco plants:
pleiotropic phenotypes include drought tolerance. Planta
201, 293–297.
Rice trehalose-6-phosphate phosphatases S. Shima et al.
1200 FEBS Journal 274 (2007) 1192–1201 ª 2007 The Authors Journal compilation ª 2007 FEBS
13 Garg AK, Kim JK, Owens TG, Ranwala AP, Choi
YD, Kochian LV & Wu RJ (2002) Trehalose accumula-
tion in rice plants confers high tolerance levels to differ-
ent abiotic stresses. Proc Natl Acad Sci USA 99, 15898–
15903.
14 Jang IC, Oh SJ, Seo JS, Choi WB, Song SI, Kim CH,
Kim YS, Seo HS, Choi YD, Nahm BH et al. (2003)
Expression of a bifunctional fusion of the Escherichia
coli genes for trehalose-6-phosphate synthase and treha-
lose-6-phosphate phosphatase in transgenic rice plants
increases trehalose accumulation and abiotic stress toler-
ance without stunting growth. Plant Physiol 131 , 516–
524.
15 Eastmond PJ, van Dijken AJ, Spielman M, Kerr A, Tis-
sier AF, Dickinson HG, Jones JD, Smeekens SC &
Graham IA (2002) Trehalose-6-phosphate synthase 1,
which catalyses the first step in trehalose synthesis, is
essential for Arabidopsis embryo maturation. Plant J 29,
225–235.

16 van Dijken AJ, Schluepmann H & Smeekens SC (2004)
Arabidopsis trehalose-6-phosphate synthase 1 is essen-
tial for normal vegetative growth and transition to flow-
ering. Plant Physiol 135, 969–977.
17 Satoh-Nagasawa N, Nagasawa N, Malcomber S, Sakai
H & Jackson D (2006) A trehalose metabolic enzyme
controls inflorescence architecture in maize. Nature 441,
227–230.
18 Wingler A, Fritzius T, Wiemken A, Boller T & Aesch-
bacher RA (2000) Trehalose induces the ADP-glucose
pyrophosphorylase gene, ApL3, and starch synthesis in
Arabidopsis. Plant Physiol 124, 105–114.
19 Fritzius T, Aeschbacher R, Wiemken A & Wingler A
(2001) Induction of ApL3 expression by trehalose com-
plements the starch-deficient Arabidopsis mutant adg2-1
lacking ApL1, the large subunit of ADP-glucose pyro-
phosphorylase. Plant Physiol 126, 883–889.
20 Kolbe A, Tiessen A, Schluepmann H, Paul M, Ulrich S
& Geigenberger P (2005) Trehalose 6-phosphate regu-
lates starch synthesis via posttranslational redox activa-
tion of ADP-glucose pyrophosphorylase. Proc Natl
Acad Sci USA 102, 11118–11123.
21 Lunn JE, Feil R, Hendriks JH, Gibon Y, Morcuende
R, Osuna D, Scheible WR, Carillo P, Hajirezaei MR &
Stitt M (2006) Sugar-induced increases in trehalose 6-
phosphate are correlated with redox activation of
ADPglucose pyrophosphorylase and higher rates of
starch synthesis in Arabidopsis thaliana. Biochem J 397,
139–148.
22 Pramanik MH & Imai R (2005) Functional identifica-

tion of a trehalose 6-phosphate phosphatase gene that is
involved in transient induction of trehalose biosynthesis
during chilling stress in rice. Plant Mol Biol 58, 751–
762.
23 Thaller MC, Schippa S & Rossolini GM (1998) Con-
served sequence motifs among bacterial, eukaryotic, and
archaeal phosphatases that define a new phosphohydro-
lase superfamily. Protein Sci 7, 1647–1652.
24 Wen JQ, Oono K & Imai R (2002) Two novel mitogen-
activated protein signaling components, OsMEK1 and
OsMAP1, are involved in a moderate low-temperature
signaling pathway in rice. Plant Physiol 129, 1880–1891.
25 Claes B, Dekeyser R, Van den Villarroel RBM, Bauw
G, Van Montagu M & Caplan A (1990) Characteriza-
tion of a rice gene showing organ-specific expression in
response to salt stress and drought. Plant Cell 2, 19–27.
26 Matula M, Mitchell M & Elbein AD (1971) Partial pur-
ification and properties of a highly specific trehalose
phosphate phosphatase from Mycobacterium smegmatis.
J Bacteriol 107, 217–222.
27 Seo HS, Koo YJ, Lim JY, Song JT, Kim CH, Kim
JK, Lee JS & Choi YD (2000) Characterization of a
bifunctional enzyme fusion of trehalose-6-phosphate
synthetase and trehalose-6-phosphate phosphatase of
Escherichia coli. Appl Environ Microbiol 66, 2484–
2490.
28 Eastmond PJ & Graham IA (2003) Trehalose metabo-
lism: a regulatory role for trehalose-6-phosphate? Curr
Opin Plant Biol 6, 231–235.
29 Leyman B, Van Dijck P & Thevelein JM (2001) An

unexpected plethora of trehalose biosynthesis genes in
Arabidopsis thaliana. Trends Plant Sci 6, 510–513.
30 Avonce N, Leyman B, Mascorro-Gallardo JO, Van
Dijck P, Thevelein JM & Iturriaga G (2004) The
Arabidopsis trehalose-6-P synthase AtTPS1 gene is a
regulator of glucose, abscisic acid, and stress signaling.
Plant Physiol 136, 3649–3659.
31 Klutts S, Pastuszak I, Edavana VK, Thampi P, Pan
YT, Abraham EC, Carroll JD & Elbein AD (2003)
Purification, cloning, expression, and properties of
mycobacterial trehalose-phosphate phosphatase. J Biol
Chem 278, 2093–2100.
32 Penna S (2003) Building stress tolerance through over-
producing trehalose in transgenic plants. Trends Plant
Sci 8, 355–357.
33 Avonce N, Leyman B, Thevelein J & Iturriaga G (2005)
Trehalose metabolism and glucose sensing in plants.
Biochem Soc Trans 33, 276–279.
34 De Virgilio C, Burckert N, Bell W, Jeno P, Boller T &
Wiemken A (1993) Disruption of TPS2, the gene encod-
ing the 100-kDa subunit of the trehalose-6-phosphate
synthase ⁄ phosphatase complex in Saccharomyces cere-
visiae, causes accumulation of trehalose-6-phosphate
and loss of trehalose-6-phosphate phosphatase activity.
Eur J Biochem 212, 315–323.
35 Kaasen I, Falkenberg P, Styrvold OB & Strom AR
(1992) Molecular cloning and physical mapping of the
otsBA genes, which encode the osmoregulatory tre-
halose pathway of Escherichia coli: evidence that trans-
cription is activated by katF (AppR). J Bacteriol 174,

889–898.
S. Shima et al. Rice trehalose-6-phosphate phosphatases
FEBS Journal 274 (2007) 1192–1201 ª 2007 The Authors Journal compilation ª 2007 FEBS 1201