Báo cáo khoa học: High and complementary expression patterns of alcohol and aldehyde dehydrogenases in the gastrointestinal tract Implications for Parkinson’s disease docx

High and complementary expression patterns of alcohol
and aldehyde dehydrogenases in the gastrointestinal tract
Implications for Parkinson’s disease
Marie Westerlund1, Andrea Carmine Belin1, Michael R. Felder2, Lars Olson1 and Dagmar Galter1
1 Department of Neuroscience, Karolinska Institutet, Stockholm, Sweden
2 Department of Biological Sciences, University of South Carolina, Columbia, USA

Keywords
ADH1; ADH4; ALDH1; epithelium; in situ
hybridization
Correspondence
D. Galter, Department of Neuroscience,
Karolinska Institutet, 171 77 Stockholm,
Sweden
Tel: +46 8 524 870 18
Fax: +46 8 32 37 42
E-mail:
Website:
(Received 29 September 2006, revised
12 December 2006, accepted 22 December
2006)
doi:10.1111/j.1742-4658.2007.05665.x

Parkinson’s disease (PD) is a heterogeneous movement disorder characterized by progressive degeneration of dopamine neurons in substantia nigra.
We have previously presented genetic evidence for the possible involvement
of alcohol and aldehyde dehydrogenases (ADH; ALDH) by identifying
genetic variants in ADH1C and ADH4 that associate with PD. The
absence of the corresponding mRNA species in the brain led us to the
hypothesis that one cause of PD could be defects in the defense systems
against toxic aldehydes in the gastrointestinal tract. We investigated cellular
expression of Adh1, Adh3, Adh4 and Aldh1 mRNA along the rodent GI

tract. Using oligonucleotide in situ hybridization probes, we were able to
resolve the specific distribution patterns of closely related members of the
ADH family. In both mice and rats, Adh4 is transcribed in the epithelium
of tongue, esophagus and stomach, whereas Adh1 was active from stomach
to rectum in mice, and in duodenum, colon and rectum in rats. Adh1 and
Adh4 mRNAs were present in the mouse gastric mucosa in nonoverlapping
patterns, with Adh1 in the gastric glands and Adh4 in the gastric pits.
Aldh1 was found in epithelial cells from tongue to jejunum in rats and
from esophagus to colon in mice. Adh3 hybridization revealed low mRNA
levels in all tissues investigated. The distribution and known physiological
functions of the investigated ADHs and Aldh1 are compatible with a role
in a defense system, protecting against alcohols, aldehydes and formaldehydes as well as being involved in retinoid metabolism.

Although the etiology of the neurodegenerative events
in Parkinson’s disease (PD) remains largely unknown,
evidence suggests that both environmental and genetic
factors are involved. The disease is characterized by
loss of dopamine (DA) neurons in substantia nigra
pars compacta (SNpc) and later in the ventral tegmental area. These events are accompanied by progressive
loss of DA innervation of nucleus caudatus and
putamen, resulting primarily in movement disabilities.
However, degenerative events are also known to

involve other neuron populations. Suggested causes for
the neurodegeneration include oxidative stress, misfolded proteins, inflammation, mitochondrial and
ubiquitin–proteasome dysfunction and impaired protection against potentially harmful substances.
Recently however, several genes have been identified in
which mutations are either linked to or associated with
disease, shifting the weight of evidence towards genetic
causes and complex genetic risk factors in PD. Parkinson-linked genes include a-synuclein (SNCA), DJ-1,

Abbreviations
ADH, alcohol dehydrogenase; ALDH, aldehyde dehydrogenase; DA, dopamine; DOPAC, di-hydroxyphenylacetic acid; DOPAL, 3,4dihydroxyphenylacetaldehyde; DOPET, 3,4-dihydroxyphenylethanol; GI, gastrointestinal; PD, Parkinson’s disease; RA, retinoic acid; SNpc,
substantia nigra pars compacta.

1212

FEBS Journal 274 (2007) 1212–1223 ª 2007 The Authors Journal compilation ª 2007 FEBS


M. Westerlund et al.

Parkin, PINK-1, LRRK2 and UCH-L1 [1]. Genes
implicated in PD are typically not specifically
expressed in DA neurons and sometimes not even in
the brain itself, but are instead active in various other
tissues. Two such genes are alcohol dehydrogenase 1
(ADH1) and ADH4 for which a truncating G78stop
mutation (rs283413) and a functionally impaired allele
comprising two linked SNPs (rs34925826 and
rs11480228), respectively, have been identified to significantly associate with PD [2,3].
Aldehyde dehydrogenase 1 (ALDH1), by contrast, is
expressed strongly and selectively in the mesencephalic
DA neurons, possibly to protect them against the high
intracellular levels of aldehydes formed during DA
metabolism. Notably, ALDH1 mRNA levels have been
shown to be specifically downregulated in DA neurons
in PD by the use of in situ hybridization [4] and microarray methods [5–7]. In the periphery, ADHs and
ALDH1 are expressed mainly in the digestive tract and
are implicated in detoxification reactions. It is thus

possible that impaired function of these genes in the
lining of the gastrointestinal (GI) tract could cause
toxic compounds, such as aldehydes, to reach the circulation and eventually central nervous system neurons. A recent study analyzed the enteric nervous
system in PD and found that both Meissner’s and
Auerbach’s plexuses were affected already in early stages of disease and terminal axons of postganglionic
and preganglionic neurons contained a-synuclein-positive aggregates [8]. The hypothesis was put forward [8]
that a putative environmental pathogenic agent, capable of passing the GI epithelial lining, might induce
a-synuclein misfolding and aggregation in specific neurons of the intestinal neuronal plexuses and possibly
also reach the central nervous system.
The mammalian ADHs (EC 1.1.1.1) constitute a
complex family of enzymes exhibiting extensive multiplicity with respect to substrate repertoire and tissue
distribution. They are dimeric, zinc-dependent
enzymes, which oxidize and reduce various alcohols
and aldehydes using NAD+ ⁄ NADH as electron acceptor and donor, respectively. ADHs appear to participate in a general defense towards alcohols and
aldehydes, without generating toxic radicals, as is the
case for the cytochrome P450 system [9]. Even though
the ADHs are known to be involved in both retinoid
transformation and formaldehyde scavenging, their
physiological functions have not been fully revealed.
Based on their catalytic properties, ADHs have been
suggested to be involved in the metabolism of lipid
peroxidation products, x-hydroxy fatty acids, xenobiotic alcohols, aldehydes, steroids and biogenic amines.
According to the most recent nomenclature [10], the

Expression of ADH and ALDH in the rodent GI tract

ADH classes are designated ADH1–ADH6 (or class
I–VI ADH), five of which have been identified in
humans. ADH1 is abundant in liver where it participates in the oxidation of ingested ethanol [11]. Human
ADH1 is the only class consisting of isoenzymes,

namely ADH1A, ADH1B and ADH1C, although
rodents do not show this diversity [10]. Human ADH2
was first isolated from liver and has a high Km for
ethanol [12]. ADH3, from which all ADHs are thought
to have evolved, is present in all living species investigated to date [13] and exhibits characteristic differences
compared with the other classes of ADHs. It functions
as a glutathione-dependent formaldehyde dehydrogenase and has been shown to catalyze the reductive
breakdown of S-nitrosoglutathione, indicating involvement in the metabolism of nitric oxide [14]. ADH4
was first identified in gastric mucosa [15] and is the
only form of ADH not expressed in liver. ADH4
appears to be mainly involved in retinoid metabolism
and probably also in first-pass metabolism of ethanol
[16]. Limited information on substrate specificities is
available for ADH5 and ADH6, because these two
enzymes have not yet been identified at the protein
level. Sequence alignment and phylogenetic studies
indicate that human ADH5 and rat ADH6 should
probably be included in the same class, whereas mouse
ADH5 should be regarded as a separate variant [14].
Another enzyme superfamily, which operates in
close relation to the ADHs, is the ALDHs
(EC 1.2.1.3). They catalyze the oxidation of endogenous and exogenous aldehydes into the corresponding
acids [17,18]. Human ALDH1 (or class I ALDH), is
involved primarily in retinoid metabolism where it
oxidizes retinal aldehyde to retinoic acid (RA), regulating growth, development and cell differentiation [19].
The rat homolog of ALDH1 is also known as
RALDH or RalDH-I and the mouse homolog was formerly known as AHD2. There are two other classes of
ALDHs, mitochondrial ALDH2 and stomach cytosolic
ALDH3, neither of which has been found to participate in RA synthesis in vitro [20]. In addition to the
exogenous substrates for the ALDHs produced during

drug and xenobiotic metabolism, there are a number
of endogenous substrates, including biogenic amines
and other neurotransmitters, retinal aldehyde, corticosteroids, and products of amino acid catabolism and
membrane lipid peroxidation [21].
In the light of these observations, the detoxification
systems in the epithelial lining of the GI tract deserve
further investigation as to their possible etiological
roles for forms of PD. Here we map the expression
pattern of the Adh1, Adh3, Adh4 and Aldh1 genes in
the adult mouse and rat GI tract. Revealing the tissue

FEBS Journal 274 (2007) 1212–1223 ª 2007 The Authors Journal compilation ª 2007 FEBS

1213


Expression of ADH and ALDH in the rodent GI tract

M. Westerlund et al.

expression patterns will help explain the physiological
functions of these enzymes and also how genetically
dysfunctional ADHs and ALDHs might be involved in
PD pathology.
To allow accurate identification of the closely related
Adh1 and Adh4 gene products, we used multiple specific oligonucleotide probes, and ascertained specificity
by tests on Adh1 and Adh4 null-mutated mice. We present novel data about the distribution patterns of all
investigated genes, and can correct a previous study in
which Adh1 and Adh4 were not correctly separated.
We found that the cellular distribution of the enzymes

described here, reflects what has been known about
their properties from biochemical studies including
investigations in human tissues, and that this has
implications for how to interpret the role of the studied enzymes in health and disease.

Results
The distribution and relative intensity of expression of
the Adh1, Adh3, Adh4 and Aldh1 genes in the GI tract
of rats and mice is summarized in Fig. 1 and Table 2.
Figures 2 and 3 document key findings and Fig. 4
documents probe controls. Figure 5 summarizes details
of localization of the mRNA species at different
depths of the GI epithelium: stomach (Fig. 5A), small
intestine (Fig. 5B) and large intestine (Fig. 5C).
Adh1, Adh3, Adh4 and Aldh1 transcription
in mouse tissues
Adh1 and Adh4 mRNAs were expressed along the
entire mouse GI tract (Fig. 2), in different patterns
and intensities. High Adh4 and low Adh1 expression
was found in the upper part of the digestive tract,
including the tongue and esophagus. The mRNA signal was located at the base of the stratified squamous
epithelium, with a gradient observed towards the
superficial layers, while the submucosa showed no
expression. Both enzyme classes were expressed in gastric mucosa, mainly with complementary, rather than
overlapping patterns. The Adh1 signal was restricted
mainly to the neck of the gastric gland, whereas Adh4
was restricted to the gastric pit closer to the lumen. At
the gastroduodenal junction there was an abrupt termination of Adh4 expression, such that the gut
expressed only Adh1 from duodenum through jejunum,
ileum, colon and rectum. In duodenum, the Adh1 signal was found in the outer epithelial border of the villi.

Expression was found to be highest at the base of the
villi and in the intestinal glands, while submucosal
glands were empty. In jejunum and ileum, Adh1
1214

mRNA showed a similar expression pattern as described for duodenum. In colon and rectum, the Adh1
signal was found to be restricted to the base of the
crypts, leaving the upper part devoid of signal. Low
levels of Adh1 mRNA were also observed in striated
muscles of the tongue and upper part of esophagus, as
well as in the smooth muscle layers in the walls of the
GI tract from esophagus to rectum. Unlike Adh1,
Adh4 and Aldh1, Adh3 was not restricted to certain tissues but was ubiquitously expressed in almost all tissues investigated. Notably, the levels of Adh3 mRNA
were much lower than those of the other classes of
investigated enzymes.
High levels of Aldh1 mRNA were found in the basal
epithelial cell layers of esophagus with a decrease in
signal intensity observed towards the superficial layers.
In the stomach, Aldh1 mRNA was present in the epithelial cells of the gastric pits and in the neck of the
gastric glands. Aldh1 expression continued in duodenum with the signal confined to the epithelial cells of
the villi, whereas the lamina propria showed no expression. In jejunum and ileum, a similar expression pattern as in duodenum was observed showing Aldh1
mRNA signal in epithelial cells at the base of the villi.
In colon, Aldh1 gene activity was detected in the upper
parts of the crypts of Lieberkuhn, whereas the lower
ă
parts of the crypts, the submucosa and underlying
muscle layers were negative. Aldh1 was thus transcribed in the mucosa from esophagus to colon, while
rectum was mainly devoid of detectable levels of Aldh1
mRNA.
Adh1, Adh3, Adh4 and Aldh1 transcription in rat

tissues
In the rat GI tract (Fig. 3) a similar Adh4 mRNA
expression pattern as described for mice was observed.
Adh4 mRNA was found in the upper part of the tract
including the epithelial cells of the tongue, esophagus
and stomach, where it was expressed from the cardiac
to the pyloric region, down to the gastroduodenal
junction. By contrast to mouse, the rat showed no
expression of Adh1 mRNA in jejunum or ileum. However, in colon and rectum, Adh1 was found to be present in the epithelial cells in the lower parts of the
intestinal glands. As in mice, low levels of Adh3
mRNA expression were found in almost all the tissues
investigated.
In the rat GI tract, Aldh1 mRNA was found in
the epithelial cells from tongue to jejunum. The
tongue and esophagus expressed Aldh1 mRNA in the
basal layer of the stratified squamous epithelium,
whereas the outermost layers facing the lumen as well

FEBS Journal 274 (2007) 1212–1223 ª 2007 The Authors Journal compilation ª 2007 FEBS


M. Westerlund et al.

Expression of ADH and ALDH in the rodent GI tract

Fig. 1. Localization of alcohol dehydrogenase 1 (Adh1), Adh4 and Aldh1 mRNAs at eight different levels of the mouse and rat GI tracts from
tongue to rectum. Tissues were radioactively labeled with oligo probes for in situ hybridization followed by exposure to autoradiographic film.
Adh1 is present at low levels in tongue and esophagus and at higher levels from stomach to rectum in mice, whereas corresponding rat tissues show expression only in duodenum, colon and rectum. In both mouse and rat, Adh4 is found in the epithelial lining of upper GI tract
including the tongue, esophagus and stomach, but not in the small and large intestines. In the rat, Aldh1 is present higher up in the GI tract
from tongue to jejunum compared with the mouse where the expression can be observed from esophagus to colon. Arrows are pointing at

the epithelium. The scale bar ¼ 2 mm. Figure 1 provides an overview of the distribution of mRNA signals. For comparisons of labeling intensities between mRNA species and tissues, refer to Table 2.

as the underlying submucosa were negative. Aldh1
was also active in the stomach mucosa, restricted
mainly to the neck of the gastric glands. In

duodenum and jejunum a similar expression as described for mice was observed showing Aldh1 mRNA
at the base of the villi.

FEBS Journal 274 (2007) 1212–1223 ª 2007 The Authors Journal compilation ª 2007 FEBS

1215


Expression of ADH and ALDH in the rodent GI tract

M. Westerlund et al.

Fig. 2. Alcohol dehydrogenase (Adh) and aldehyde dehydrogenase (Aldh) mRNA expression in the mouse GI tract as revealed by in situ
hybridization. Left-hand panels were counter-stained with cresyl violet and photographed under bright field microscopy to illustrate tissue
morphology. The other panels are dark-field photomicrographs of corresponding sections at the same magnification. Together, Adh1 and
Adh4 provide a continuous expression pattern in the epithelial cells of the mucosa in the GI tract. Moderate to high levels of Adh1 mRNA
are observed in stomach, jejunum and rectum, while Adh4 expression is observed from tongue to stomach, but not in small and large intestines. Adh3 shows low and ubiquitous expression in all tissues and Aldh1 is observed at low to moderate levels in esophagus, stomach and
jejunum, but not in rectum. The apparent signal in the outer keratinized layer of the tongue and esophagus is due to light scatter. The scale
bar ¼ 100 lm.

Probe specificity
Adh1 and Adh4 probe-specificities were tested on tissues from wild-type, Adh1– ⁄ – and Adh4– ⁄ – mice. Liver
1216

and esophagus were used, as these tissues are known
to express high levels of Adh1 and Adh4 mRNA,
respectively. Adh1 hybridization revealed expression in
liver of wild-type (Fig. 4A) but not in knockout

FEBS Journal 274 (2007) 1212–1223 ª 2007 The Authors Journal compilation ª 2007 FEBS


M. Westerlund et al.

Expression of ADH and ALDH in the rodent GI tract

Fig. 3. Alcohol dehydrogenase (Adh) and aldehyde dehydrogenase (Aldh) mRNA expression in the rat gastrointestinal tract. Left-hand panels
were counter-stained with cresyl violet and photographed under bright-field microscopy, the other panels are dark-field photomicrographs of
corresponding sections at the same magnification. High levels of Adh1 mRNA are observed in the epithelial cells at the base of the intestinal
glands in rectum and moderate levels of Adh4 are present in the epithelial cell layer of tongue, esophagus and stomach, where the signal is
located to the gastric pits. Adh3 does not show restriction to the epithelium, but is expressed ubiquitously and at low levels in all tissues.
Low to moderate Aldh1 gene activity is observed in the epithelial cells of the tongue and esophagus, in the gastric glands and at the base of
the villi in jejunum. The apparent signal in the outer keratinized layer of the tongue and esophagus is due to light scatter. Scale bar ¼
100 lm.

(Fig. 4B) mice, whereas Adh4 hybridization showed a
corresponding pattern with a positive signal in esophagus epithelium of wild-type (Fig. 4C) but not knockout

mice (Fig. 4D), as expected. Hybridization of colon, to
represent GI tract tissues, with a random probe generated no signal above background level (Fig. 4E).

FEBS Journal 274 (2007) 1212–1223 ª 2007 The Authors Journal compilation ª 2007 FEBS

1217

Expression of ADH and ALDH in the rodent GI tract

A

C

B

M. Westerlund et al.

D

E

Fig. 4. Microscopic pictures of control
mouse tissues hybridized with Adh1, Adh4
or a random probe. Liver from an Adh1– ⁄ –
mouse showed no signal for the Adh1
probe used, and esophagus from an Adh4 – ⁄ –
mouse showed no specific signal in the epithelial lining as expected. Colon showed no
specific signal when hybridized to a random
probe. Scale bar ¼ 20 lm.

Discussion
We undertook this investigation because polymorphisms in the genes encoding human ADH1 and
ADH4 have previously been associated with an
increased risk of PD, even though these genes are not
expressed by neurons or glial cells in the brain [22]. A

prerequisite for the hypothesis that mutations of these
two enzyme families may increase PD risk, by decreasing the defense against reactive aldehydes present in
food or produced during lipid peroxidation, is that the
genes are active in the GI tract. In this study we therefore mapped the cellular expression of Adh1, Adh3,
Adh4 and Aldh1 genes along the entire GI tract of
mice and rats.
Increased levels of aldehydes reaching the brain
may explain why both DA neurons and a plethora of
other neurons are also affected in PD. The particular
vulnerability of DA neurons may be explained by the
high levels of DA metabolites, including the aldehyde
3,4-dihydroxyphenylacetaldehyde (DAL) and the fact
that DA itself can react with aldehydes to form toxic
isoquinolines such as salsolinol [23]. In line with the
suggested role of ADHs and ALDHs in protection
against toxic insults, mRNAs encoding these enzymes
have previously been identified in tissues forming a
physiological and enzymatic barrier against the environment. Adh1 and Adh4 have been observed in the
epithelial lining of the human [24,25] and rodent GI
tract [26–29] as well as in rodent epidermis [30],
which together form a first line of defense against
toxic insults. In addition to adult rodents, Adh1 and
Adh4 have also been identified in various embryonic
1218

tissues [30,31]. Upon entering the body, toxins may
also become enzymatically degraded in the liver,
which expresses high levels of both Adh [32] and
Aldh [33,34].
Our results demonstrate ADH and ALDH mRNA

expression along the entire GI tract, with specific gene
activity patterns observed for each enzyme, showing
restriction both to specific regions of the tract as well
as to certain cell types. Our findings are mainly in
agreement with a previous study by Vaglenova et al.
[26] with regard to the patterns of localization of Adh1
and Adh4 mRNAs in the GI tract. However, since
Vaglenova et al. reported presence of Adh4 message
also below the level of the stomach, we took particular
care in verifying the absence of Adh4 activity in
the small and large intestines by using three different
Adh4-specific oligo probes. While all our three probes
hybridized in the same manner to epithelial cells from
tongue to stomach, none of them generated signals
below this level of the GI tract. There are significant
sequence similarities between the Adh1 and Adh4 genes,
and it is thus possible that long riboprobes as used by
Vaglenova et al. may be less efficient in discriminating
these two genes, possibly leading to a degree of crosshybridization of their Adh4 probe to Adh1.
The characteristic expression patterns observed for
Adh1 and Adh4 along the GI tract reflect different
functional requirements of the two classes of enzymes.
Expression of Adh4 in the upper part of the tract close
to the external environment, where the epithelial cell
turnover is high, fits well with the known involvement
of the enzyme in RA synthesis required for cell proliferation [26]. Expression of Adh1 in deeper layers of the

FEBS Journal 274 (2007) 1212–1223 ª 2007 The Authors Journal compilation ª 2007 FEBS

M. Westerlund et al.

Fig. 5. Schematic drawings of the stomach (A), small (B) and large
(C) intestinal walls. The figure shows the localization of Adh1,
Adh3, Adh4 and Aldh1 mRNA expression in the rat (R) and mouse
(M) gastrointestinal mucosa. The results from duodenum, jejunum
and ileum are collectively presented in (B) and the results from
colon and rectum are collectively presented in (C). The Adh1 mRNA
signal in rat small intestine represents duodenum only, the Aldh1
signal in rat small intestine represents duodenum and jejunum and
the Aldh1 signal in mouse large intestine represents colon only.
(Reprinted from Schultzberg et al. [46] with permission from Elsevier Science.)

stomach mucosa as well in the lower tract including
small and large intestines fits with the role of this
enzyme in metabolism of ingested alcohols, because
ADH1 has been shown to have a high efficiency for
ethanol metabolism.
Whereas Adh1 and Adh4 expression was highly
restricted to the epithelial cells of the GI mucosa,
Adh3 was observed at much lower levels in all tissues
in both mice and rats. This is in line with the different
substrate repertoire known for this enzyme. Rather
than being involved in ethanol and retinol oxidation,
Adh3 is mainly active towards glutathione-coupled
formaldehydes [35], but also towards free hydroxyfatty
acids and leukotrienes Owing to its ubiquitous tissue
expression, the gene encoding Adh3 has been suggested
to have a house keeping function. This hypothesis is
further supported by the fact that ADH3 is the highly

conserved ancestral form from which all classes of
ADHs have evolved [36].
Aldh1 has previously been found to be specifically
and strongly expressed by DA neurons in SN, which
might reflect the need for efficient RA formation
and ⁄ or aldehyde detoxification by these neurons [4].
The main function of ALDH is in the last step of retinoid metabolism where it catalyzes oxidation of retinal
aldehyde to RA, which is essential for cell growth and
development. ALDH is also involved in the conversion
of the DA metabolite DOPAL to di-hydroxyphenylacetic acid (DOPAC) [37]. Like other endogenous aldehydes, DOPAL has been shown to be toxic to DA
neurons both in vitro and in vivo [38,39]. Intracellular
formation of aldehydes might be associated with the
specific vulnerability of DA neurons in SN and in line
with this hypothesis, DOPAL has been found to be
more toxic to neurons of SN compared to ventral tegmental area [40]. Mitochondrial dysfunction is another
event implicated in PD pathogenesis and inhibition of
mitochondrial complex I and III leads to elevated
levels of DOPAL and 3,4-dihydroxyphenylethanol
(DOPET) in vitro [41].

Expression of ADH and ALDH in the rodent GI tract

A

B

C

In conclusion, we have detected Adh1, Adh3, Adh4
and Aldh1 transcription in the mucosal layer of the

rodent GI tract, with characteristic regional differ-

FEBS Journal 274 (2007) 1212–1223 ª 2007 The Authors Journal compilation ª 2007 FEBS

1219


Expression of ADH and ALDH in the rodent GI tract

M. Westerlund et al.

Table 1. Oligonucleotide probe sequences complementary to mouse and rat Adh1, Adh3, Adh4 and Aldh1.
Probe

Gene

Species

Sequence 5’- to 3’

Adh1
Adh1-1
Adh1-2
Adh3
Adh3
Adh4
Adh4-1
Adh4-2
Adh4-3
Aldh1

Random

Adh1 (class I Adh)
Adh1 (class I Adh)
Adh1 (class I Adh)
Adh3 (class III Adh)
Adh3 (class III Adh)
Adh4 (class IV Adh)
Adh4 (class IV Adh)
Adh4 (class IV Adh)
Adh4 (class IV Adh)
Aldh1 (class I Aldh)
–

Mouse
Rat
Rat
Mouse
Rat
Mouse
Rat
Rat
Rat
Rat ⁄ mouse
Rat ⁄ mouse

ACAGCCAATGATGACAGACAGACCGACACCTCCGAGGCCAAACACGGC
GGTTAACGGAGAGGCTTTGGGCACTGGGAGGCACCCCGACAATGACGCT
TGGCCTAGAACTGCAGGAAGAGGCGTGAACAGGGATCCACTAACCGCGT
CTCTCCACACTCTTCCATCCTCCAAAGGCGGTGCCTTTCCATGTGCGTC

GACACTCTCCACACTCTTCCAGCCTCCAAAGGCAGTGCCTTTCCACGTG
TCATCTCTGCTCTTCCACCCTCCAAAGACGCAGCCCTTCCACGTACGCC
CCCAGCACAGAACACCCAGCTCTCTGGATCTCAAAATGTCAGGACAGTCCG
CATCATCTCTGCTCTTCCAACCACCAAAGACGCAGCCCTTCCATGTCCG
GTGATATCAGAGAACACTGTCAGGAACAAGGCTTCAGGTCACGGTCGC
GGCCTTCACAGCTTTGTCAACATCTGCCTTGTCCCCTTCTTCCACATGGC
ATGGTGGTGCGTTTGAGGTAATGGAGGGCTGCGATCGTTTTCCGTTGGGG

Table 2. mRNA expression levels of Adh1, Adh3, Adh4 and Aldh1
in the rat and mouse GI tract. Tissues were investigated using
radioactive oligonucleotide in situ hybridization and the signals were
scored semiquantitatively (see Experimental procedures) using
bright- and dark-field microscopy.

Tissue

Adh1
Adh3
Adh4
Aldh1
Rat Mouse Rat Mouse Rat Mouse Rat Mouse

Tongue
Esophagus
Stomach
Duodenum
Jejunum
Ileum
Colon
Rectum

–
–
–
++
–
–
++
++

+–
+–
+
++
++
+
+
+

+–
+–
+–
+–
+–
+–
+–
+–

+–
+–

+–
+–
+–
+–
+–
+–

+
++
++
–
–
–
–
–

+
++
++
–
–
–
–
–

++
++
+
+
+

–
–
–

–
+
+
+
+
+
+
–

part of the Adh1 gene, an advantage when double and triple
knockouts are used. Genotyping was carried out using previously described methods and primers [44]. Animals were
killed by cervical dislocation and tissues including tongue,
esophagus, stomach, duodenum, jejunum, ileum, colon, rectum and liver were dissected and rapidly frozen on dry ice.
Stomach and intestines were washed with Ringer’s solution
to remove contents. Tissues were sectioned at 14 lm, thawed
onto coated glass slides (Menzel-Glaser, Braunschweig,
ă
Germany) and stored at )20 °C until use. Serial sectioning
and hybridization of adjacent sections was performed.
Results were based on five observations per tissue type and
probe. Animal experiments were approved by the Swedish
Animal Ethics Committee (Stockholm, Sweden).

Probes
ences. Characterization of the expression patterns of
the two enzyme superfamilies might help evaluating

their possible involvement in PD pathology. The distribution in the lining of the GI tract suggests that
ADHs may function as defense enzymes, protecting
against alcohols (ADH1, ADH4), aldehydes (ALDH1)
and formaldehydes (ADH3) as well as being involved
in retinoid metabolism (ADH4).

Experimental procedures
Animal tissues
Adult Sprague–Dawley rats (n ¼ 2) (Scanbur BK, Sollentuna, Sweden), C57BL ⁄ 6 (B6) mice (n ¼ 2), B6.Adh1– ⁄ –
(n ¼ 1) [42] and Adh4– ⁄ – (n ¼ 1) [43], were kept under standardized temperature, light and humidity conditions and
given food and water ad libitum. The B6.Adh1– ⁄ – strain was
obtained by backcrossing Adh1– ⁄ – mice [42] for six generations to the congenic B6.S line homozygous for the Adh1a
allele. The Adh1– ⁄ –-targeted allele is derived from the Adh1b
allele and can be identified by variations outside the deleted

1220

Species-specific oligonucleotide probes targeting Adh1
(class I Adh), Adh3 (class III Adh) and Adh4 (class IV
Adh) mRNAs and a species combined probe targeting
mouse and rat Aldh1 (class I Aldh) mRNA (Table 1) were
used. Probes directed against different sequences within the
same gene, gave coherent results according to signal intensity and area of expression. A random probe with similar
length and GC content to the probes listed in Table 1
showed no localized or specific binding to tissue components. Signal intensities were scored using a semiquantitative scale with five steps (–,+),+,++ and +++). Scores
were based on several sections ⁄ animal and several animals ⁄ observation and confirmed by two experienced
observers. Reliability of the scores was ascertained by the
positive correlation between different probes targeting the
same mRNA species, between multiple tissue samples from
individual animals, between animals as well as between

observers (Table 2).

In situ hybridization
In situ hybridization was carried out according to a
published protocol [45] with some modifications: Tissue

FEBS Journal 274 (2007) 1212–1223 ª 2007 The Authors Journal compilation ª 2007 FEBS


M. Westerlund et al.

sections were air-dried at room temperature prior to use.
Probes were 3¢-end labeled with dATP (Perkin–Elmer, Boston, MA) using terminal deoxynucleotidyl transferase (TdT;
Amersham Biosciences, Little Chalfont, UK) and washed
using ProbeQuant G50-Micro Columns (Amersham Biosciences). Labeled probes were diluted in hybridization
solution containing 4· NaCl ⁄ Cit (0.6 m NaCl, 0.06 m
sodium citrate), 0.02 m Na3PO4 (pH 7.0), 10% w ⁄ v dextran
sulfate, 0.2 m dithiothreitol, 1· Denhardt’s solution, 1%
sarcosyl, 50% formamide and 0.5 lgỈlL)1 sheared salmon
sperm DNA. Hybridization of sections with probe-containing hybridization solution (150 lLỈslide)1) was carried out
over night (16–18 h) at 42 °C followed by washing
5 · 15 min in 60 °C 1· NaCl ⁄ Cit and in deionized water at
room temperature. Sections were dehydrated in increasing
concentrations of ethanol and finally air-dried. Parallel sets
of slides were exposed to autoradiographic films (Biomax,
Eastman Kodak Co, Rochester, NY) for 14 days or to photographic emulsion (NTB2, Eastman Kodak) diluted 1 : 2
for 21 days, developed, counter-stained with 0.5% cresyl
violet, mounted and analyzed by bright and dark field microscopy. Autoradiographic films were digitalized (adobe
photoshop 7.0) and artifacts were removed.

Expression of ADH and ALDH in the rodent GI tract

5

6

7

8

Acknowledgements
We thank Eva Lindqvist and Karin Lundstromer for
ă
excellent technical assistance. This study was supported
by the Swedish Research Council, the Swedish Brain
˚
Foundation and the Hallsten Foundation, the Swedish
Parkinson Foundation, Swedish Brain Power, Bjorn
ă
Oscarssons Stiftelse, USPHS grants and Karolinska
Institutet Funds. The Adh4 knockout mice were kindly
provided by Dr Gregg Duester from the Burnham
Institute for Medical Research. Support for construction of the B6.Adh1– ⁄ – congenic strain was provided
by NIH grant AA11828.

9

10

11

12

References
13
1 Farrer MJ (2006) Genetics of Parkinson disease: paradigm shifts and future prospects. Nat Rev Genet 7, 306–
318.
2 Buervenich S, Sydow O, Carmine A, Zhang Z, Anvret
M & Olson L (2000) Alcohol dehydrogenase alleles in
Parkinson’s disease. Mov Disord 15, 813–818.
3 Buervenich S, Carmine A, Galter D, Shahabi HN, Johnels B, Holmberg B, Ahlberg J, Nissbrandt H, Eerola J,
Hellstrom O et al. (2005) A rare truncating mutation in
ă
ADH1C (G78Stop) shows signicant association with
Parkinson disease in a large international sample. Arch
Neurol 62, 74–78.
4 Galter D, Buervenich S, Carmine A, Anvret M &
Olson L (2003) ALDH1 mRNA: presence in human

14

15

16

DAmine neurons and decreases in substantia nigra in
Parkinson’s disease and in the ventral tegmental area in
schizophrenia. Neurobiol Dis 14, 637–647.
Grimm J, Mueller A, Hefti F & Rosenthal A (2004)
Molecular basis for catecholaminergic neuron diversity.
Proc Natl Acad Sci USA 101, 13891–13896.

Mandel S, Grunblatt E, Riederer P, Amariglio N,
Jacob-Hirsch J, Rechavi G & Youdim MB (2005) Gene
expression profiling of sporadic Parkinson’s disease substantia nigra pars compacta reveals impairment
of ubiquitin-proteasome subunits, SKP1A, aldehyde
dehydrogenase, and chaperone HSC-70. Ann NY Acad
Sci 1053, 356–375.
Grunblatt E, Mandel S, Jacob-Hirsch J, Zeligson S,
Amariglo N, Rechavi G, Li J, Ravid R, Roggendorf W,
Riederer P et al. (2004) Gene expression profiling of
parkinsonian substantia nigra pars compacta; alterations in ubiquitin-proteasome, heat shock protein, iron
and oxidative stress regulated proteins, cell adhesion ⁄ cellular matrix and vesicle trafficking genes.
J Neural Transm 111, 1543–1573.
Braak H, de Vos RA, Del Bohl J & TK (2006) Gastric
alpha-synuclein immunoreactive inclusions in Meissner’s
and Auerbach’s plexuses in cases staged for Parkinson’s
disease-related brain pathology. Neurosci Lett 396,
67–72.
Hoog JO, Hedberg JJ, Stromberg P & Svensson S
ă ă
ă
(2001) Mammalian alcohol dehydrogenase functional
and structural implications. J Biomed Sci 8, 71–76.
Duester G, Farres J, Felder MR, Holmes RS, Hoog
ă ă
JO, Pares X, Plapp BV, Yin SJ & Jornvall H (1999)
ă
Recommended nomenclature for the vertebrate alcohol
dehydrogenase gene family. Biochem Pharmacol 58,
389–395.
Crabb DW, Bosron WF & Li TK (1987) Ethanol metabolism. Pharmacol Ther 34, 59–73.

Li TK, Bosron WF, Dafeldecker WP, Lange LG &
Vallee BL (1977) Isolation of pi-alcohol dehydrogenase
of human liver: is it a determinant of alcoholism? Proc
Natl Acad Sci USA 74, 4378–4381.
Jornvall H, Hoog JO & Persson B (1999) SDR and
ă
ă ă
MDR: completed genome sequences show these protein
families to be large, of old origin, and of complex nature. FEBS Lett 445, 261–264.
Hoog JO, Stromberg P, Hedberg JJ & Grifths WJ
ă ă
ă
(2003) The mammalian alcohol dehydrogenases interact
in several metabolic pathways. Chem Biol Interact
143–144, 175–181.
Yin SJ, Wang MF, Liao CS, Chen CM & Wu CW
(1990) Identification of a human stomach alcohol dehydrogenase with distinctive kinetic properties. Biochem
Int 22, 829–835.
Yin SJ, Chou CF, Lai CL, Lee SL & Han CL (2003)
Human class IV alcohol dehydrogenase: kinetic

FEBS Journal 274 (2007) 1212–1223 ª 2007 The Authors Journal compilation ª 2007 FEBS

1221


Expression of ADH and ALDH in the rodent GI tract

17

18

19

20

21

22

23

24

25

26

27

28

29

30

M. Westerlund et al.

mechanism, functional roles and medical relevance.
Chem Biol Interact 143–144, 219–227.

Vasiliou V, Bairoch A, Tipton KF & Nebert DW (1999)
Eukaryotic aldehyde dehydrogenase (ALDH) genes:
human polymorphisms, and recommended nomenclature based on divergent evolution and chromosomal
mapping. Pharmacogenetics 9, 421–434.
Perozich J, Nicholas H, Wang BC, Lindahl R &
Hempel J (1999) Relationships within the aldehyde
dehydrogenase extended family. Protein Sci 8, 137–146.
Dockham PA, Lee MO & Sladek NE (1992) Identification of human liver aldehyde dehydrogenases that
catalyze the oxidation of aldophosphamide and retinaldehyde. Biochem Pharmacol 43, 2453–2469.
Yoshida A, Hsu LC & Dave V (1992) Retinal oxidation
activity and biological role of human cytosolic aldehyde
dehydrogenase. Enzyme 46, 239–244.
Pappa A, Sophos NA & Vasiliou V (2001) Corneal and
stomach expression of aldehyde dehydrogenases: from
fish to mammals. Chem Biol Interact 130–132, 181–191.
Galter D, Carmine A, Buervenich S, Duester G &
Olson L (2003) Distribution of class I, III and IV alcohol dehydrogenase mRNAs in the adult rat, mouse and
human brain. Eur J Biochem 270, 1316–1326.
Yamanaka Y, Walsh MJ & Davis VE (1970) Salsolinol,
an alkaloid derivative of DAmine formed in vitro during
alcohol metabolism. Nature 227, 1143–1144.
Estonius M, Svensson S & Hoog JO (1996) Alcohol
ă ă
dehydrogenase in human tissues: localisation of transcripts coding for five classes of the enzyme. FEBS Lett
397, 338–342.
Yin SJ, Chou FJ, Chao SF, Tsai SF, Liao CS, Wang
SL, Wu CW & Lee SC (1993) Alcohol and aldehyde
dehydrogenases in human esophagus: comparison with
the stomach enzyme activities. Alcohol Clin Exp Res 17,
376–381.

Vaglenova J, Martinez SE, Porte S, Duester G, Farres J
& Pares X (2003) Expression, localization and potential
physiological significance of alcohol dehydrogenase in the
gastrointestinal tract. Eur J Biochem 270, 2652–2662.
Tietjen TG, Mjaatvedt CH & Yang VW (1994) Cellular
localization of the class I alcohol dehydrogenase transcript in adult rat tissues. Histochem J 26, 526–532.
Haselbeck RJ & Duester G (1997) Regional restriction
of alcohol ⁄ retinol dehydrogenases along the mouse gastrointestinal epithelium. Alcohol Clin Exp Res 21, 1484–
1490.
Koivisto T & Salaspuro M (1996) Aldehyde dehydrogenases of the rat colon: comparison with other tissues
of the alimentary tract and the liver. Alcohol Clin Exp
Res 20, 551–555.
Westerlund M, Galter D, Carmine A & Olson L (2005)
Tissue- and species-specific expression patterns of class
I, III, and IV Adh and Aldh1 mRNAs in rodent
embryos. Cell Tissue Res 322, 227–236.

1222

31 Ang HL, Deltour L, Zgombic-Knight M, Wagner MA
& Duester G (1996) Expression patterns of class I and
class IV alcohol dehydrogenase genes in developing
epithelia suggest a role for alcohol dehydrogenase in
local retinoic acid synthesis. Alcohol Clin Exp Res 20,
1050–1064.
32 Maly IP, Toranelli M & Sasse D (1999) Distribution of
alcohol dehydrogenase isoenzymes in the human liver
acinus. Histochem Cell Biol 111, 391–397.
33 Stewart MJ, Malek K & Crabb DW (1996) Distribution
of messenger RNAs for aldehyde dehydrogenase 1,

aldehyde dehydrogenase 2, and aldehyde dehydrogenase
5 in human tissues. J Invest Med 44, 42–46.
34 Hsu LC, Chang WC, Hoffmann I & Duester G (1999)
Molecular analysis of two closely related mouse aldehyde dehydrogenase genes: identification of a role for
Aldh1, but not Aldh-pb, in the biosynthesis of retinoic
acid. Biochem J 339 (2), 387–395.
35 Koivusalo M, Baumann M & Uotila L (1989) Evidence
for the identity of glutathione-dependent formaldehyde
dehydrogenase and class III alcohol dehydrogenase.
FEBS Lett 257, 105–109.
36 Jornvall H, Hoog JO, Persson B & Pares X (2000)
ă
ă ă
Pharmacogenetics of the alcohol dehydrogenase system.
Pharmacology 61, 184–191.
37 Tank AW, Weiner H & Thurman JA (1981) Enzymology and subcellular localization of aldehyde oxidation
in rat liver. Oxidation of 3,4-dihydroxyphenylacetaldehyde derived from DAmine to 3,4-dihydroxyphenylacetic acid. Biochem Pharmacol 30, 3265–3275.
38 Mattammal MB, Haring JH, Chung HD, Raghu G &
Strong R (1995) An endogenous DAminergic neurotoxin: implication for Parkinson’s disease. Neurodegeneration 4, 271–281.
39 Esterbauer H, Schaur RJ & Zollner H (1991) Chemistry
and biochemistry of 4-hydroxynonenal, malonaldehyde
and related aldehydes. Free Radical Biol Med 11,
81–128.
40 Burke WJ, Li SW, Williams EA, Nonneman R & Zahm
DS (2003) 3,4-Dihydroxyphenylacetaldehyde is the toxic
DAmine metabolite in vivo: implications for Parkinson’s
disease pathogenesis. Brain Res 989, 205–213.
41 Lamensdorf I, Eisenhofer G, Harvey-White J,
Hayakawa Y, Kirk K & Kopin IJ (2000) Metabolic
stress in PC12 cells induces the formation of the endogenous DAminergic neurotoxin, 3,4-dihydroxyphenylacetaldehyde. J Neurosci Res 60, 552–558.

42 Deltour L, Foglio MH & Duester G (1999) Metabolic
deficiencies in alcohol dehydrogenase Adh1, Adh3, and
Adh4 null mutant mice. Overlapping roles of Adh1 and
Adh4 in ethanol clearance and metabolism of retinol to
retinoic acid. J Biol Chem 274, 16796–16801.
43 Deltour L, Foglio MH & Duester G (1999) Impaired
retinol utilization in Adh4 alcohol dehydrogenase
mutant mice. Dev Genet 25, 1–10.

FEBS Journal 274 (2007) 1212–1223 ª 2007 The Authors Journal compilation ª 2007 FEBS


M. Westerlund et al.

44 Szalai G, Xie D, Wassenich M, Veres M, Ceci JD, Dewey
MJ, Molotkov A, Duester G & Felder MR (2002) Distal
and proximal cis-linked sequences are needed for the total
expression phenotype of the mouse alcohol dehydrogenase 1 (Adh1) gene. Gene 291, 259–270.
45 Dagerlind A, Friberg K, Bean AJ & Hokfelt T (1992)
ă
Sensitive mRNA detection using unxed tissue: combined radioactive and non-radioactive in situ hybridization histochemistry. Histochemistry 98, 39–49.

Expression of ADH and ALDH in the rodent GI tract

46 Schultzberg M, Hokfelt T, Nilsson G, Terenius L,
Rehfeld JF, Brown M, Elde R, Goldstein M & Said S
(1980) Distribution of peptide- and catecholaminecontaining neurons in the gastro-intestinal tract of rat
and guinea-pig: immunohistochemical studies with antisera to substance P, vasoactive intestinal polypeptide,
enkephalins, somatostatin, gastrin ⁄ cholecystokinin, neurotensin and dopamine beta-hydroxylase. Neuroscience
5, 689–744.

FEBS Journal 274 (2007) 1212–1223 ª 2007 The Authors Journal compilation ª 2007 FEBS

1223