Báo cáo khoa học: Transport of taurocholate by mutants of negatively charged amino acids, cysteines, and threonines of the rat liver sodium-dependent taurocholate cotransporting polypeptide Ntcp docx

Transport of taurocholate by mutants of negatively charged amino
acids, cysteines, and threonines of the rat liver sodium-dependent
taurocholate cotransporting polypeptide Ntcp
Daniel Zahner, Uta Eckhardt and Ernst Petzinger
Institute of Pharmacology and Toxicology, Justus-Liebig-University Giessen, Germany
The relevance of functional amino acids for taurocholate
transport by the sodium-dependent taurocholate cotrans-
porting polypeptide Ntcp was determined by site-directed
mutagenesis. cRNA from 28 single-points mutants of the rat
liver Ntcp clone was expressed in Xenopus laevis oocytes.
Mutations were generated in five conserved negatively
charged amino acids (aspartates and glutamates) which were
present in nine members of the SBAT-family, in two non-
conserved negatively charged amino acids, in all eight Ntcp-
cysteines, and in two threonines from a protein kinase C
consensus region of the Ntcp C-terminus. Functional amino
acids were Asp115, Glu257, and Cys266, which were found
to be essential for the maintenance of taurocholic acid
transport. Asp115 is located in the large intracellular loop
III, whereas Glu257 and Cys266 are located in the large
extracellular loop VI. Four mutations of threonines from the
C-terminus of the Ntcp by alanines or tyrosines showed no
effects on sodium-dependent taurocholate transport. Intro-
duction of the FLAG
Ò
motif into several transport negative
point mutations demonstrated that all mutated proteins
besides one were present within the cell membrane of the
oocytes and provided proof that an insertion defect has not
caused transport deficiency by these Ntcp mutants. The
latter was observed only with the transport negative mutant

Asp24Asn. In conclusion, loop amino acids are required for
sodium-dependent substrate translocation by the Ntcp.
Keywords: bile acids; P-loop; glutamate; aspartate; mem-
brane protein.
The sodium-dependent taurocholate cotransporting poly-
peptide Ntcp from rat liver is the major basolateral bile acid
transporter of rat hepatocytes. It was the first sodium-
dependent bile acid cotransporter (SBAT), that was
obtained by expression cloning in Xenopus laevis oocytes
[1]. It exhibits 77.4% identity and 88.8% similarity on
amino acid level with the human transporter NTCP [2]. The
proteins are coded by the Slc/SLC10 gene family in animals
and man. SBATs are involved in the maintenance of the
enterohepatic circulation of bile acids and therefore also
participate in the homoeostatis of cholesterol. Members of
SBATs are located either in apical membranes of ileum
enterocytes, kidney tubule cells and bile duct cells where
they perform bile acid reabsorption, or in the basolateral
membrane of hepatocytes where they initiate bile acid
secretion [1–9]. SBATs constitute a subgroup of the
superfamily of sodium-dependent cotransporters with
about 35% homology among the clones from different
species, e.g. from rat, mouse, rabbit, hamster, and human
[10]. Their molecular mass is about 50 kDa and the
predicted structure which is derived from hydrophobicity
analysis contains either seven or nine transmembrane
domains; all SBATs are glycosylated at the extracellular
N-terminus and contain a cytoplasmic C-terminus.
All carriers transport sodium ions together with an organic
substrate, e.g. a bile acid or an anionic sulfated or glucuroni-

dated estrogen conjugate. The stoichiometry of this process is
electrogenic; two sodium ions are supposed to be trans-
located with one taurocholate molecule by the rat Ntcp
[11,43,44]. Previous reports from Na
+
/H
+
proton exchanger
[12], Na
+
/Ca
2+
exchanger [13], proton pumps [14], sodium-
sensitive receptors [15] and sodium-coupled cotransporters
[16–18] indicated that negatively charged amino acids in
integral membrane channels or carrier proteins are binding
sites for sodium ions or other cationic electrolytes. Therefore,
an alignment of nine members of the SBAT-family for
negatively charged amino acids was made which revealed five
conserved glutamates and aspartates. The construction of
point mutations of all five conserved and two nonconserved
negatively charged amino acids into their noncharged
counterparts asparagine and glutamine revealed the func-
tional importance of two of them for taurocholate transport.
In previous studies, we had reported that SH-group
reagents with wide varying lipid–water partition values
reversibly blocked taurocholate uptake into isolated rat
hepatocytes [19,20]. We postulated that cysteines from intra-
and extramembrane domains of the Ntcp are essential for
the transport function of the sodium-dependent bile acid

cotransporter. Very recently a report on the human NTCP
indicated that Cys266, which is located in the final
extracellular loop (loop VI as predicted by the seven
Correspondence to E. Petzinger, Institute of Pharmacology
and Toxicology, Justus-Liebig-University Giessen,
Frankfurter Str. 107, D-35392 Giessen, Germany.
Fax: + 49 641 99 38409, Tel.: + 49 641 99 38400,
E-mail:
Abbreviations: SBAT, sodium-dependent bile acid cotransporter;
TM, transmembrane.
(Received 19 December 2001, revised 19 December 2002,
accepted 14 January 2003)
Eur. J. Biochem. 270, 1117–1127 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03463.x
transmembrane domains model), is involved in taurocholate
transport of the human isoform [21]. We therefore looked
for the role of each of the eight cysteines of the rat Ntcp for
taurocholate transport.
Finally, threonines, within a protein kinase C consensus
region located in the C-terminus of the Ntcp protein were
analyzed with regard to their role in taurocholate transport.
Such threonines might be prone to phosphorylation/
dephosphorylation reactions as it was shown that the Ntcp
is a serine/threonine phosphorylated phosphoprotein which
is dephosphorylated by cAMP [22]. Upon phosphorylation
of serine/threonine by a protein kinase A, taurocholate
transport is increased but upon phosphorylation of the Ntcp
by protein kinase C, taurocholate uptake is reduced [23].
Threonines from the C-terminal consensus region were
therefore converted to either tyrosines or alanines to
abrogate any phosphorylation signal by PKC.

Materials and methods
Site-directed mutagenesis, cloning procedures,
and DNA sequencing
The cDNA of the Ntcp was a kind gift of B. Hagenbuch,
University Hospital, Dept Clinical Pharmacology, Zu
¨
rich.
Point and deletion mutants of the rat liver Ntcp cDNA clone
prLNaBA [1] were generated by site-directed mutagenesis by
the use of the QuikChange
TM
kit from Stratagene, La Jolla,
USA. The primers were selected for each mutation according
to the manufacturer’s manual and were purchased from
MWG, Biotech AG, Ebersberg, Germany. They are shown
in Table 1. Mutants were generated by PCR using 16 cycles
according to the manufacturer’s protocol in a Perkin-Elmer
GenAmp cycler 2400 (Perkin Elmer, U
¨
berlingen, Germany).
The template DNA prLNaBA was digested with DpnI. Each
mutated plasmid was transformed into Epicurian Coli XL1-
Blue Supercompetent cells by heat pulse. Bacterial cells were
transferred to LB-ampicillin agar plates and single colonies
were isolated and further cultivated to subconfluency in LB
medium. Plasmid DNA was isolated according to the Qiagen
Midi kit instructions (Qiagen, Hilden, Germany). The insert
of 1663 bp length of each clone was upstream and down-
stream sequenced by a dye terminated method using the
ABI-Prism Dye Terminator Cycle Sequencing Ready Reac-

tion kit from Applied Biosystems Inc., Weiterstadt, Germany
in the DNA sequencer 373A from the same company.
Alignments
An alignment of nine members of the SBAT-family, five
basolateral (Ntcp rat [1], Ntcp mouse1 and 2 [9], Ntcp rabbit
[24], and NTCP human [2]) and four apical (Isbt rat [6], Isbt
mouse [25], Isbt rabbit [26] and ISBT human [27]) was
performed, using the
CLUSTAL W
1.6 program from the
Baylor College of Medicine Search Launcher (Houston,
USA) to identify conserved negatively charged amino acids
and cysteines.
Tagging of Ntcp mutants by the FLAG
Ò
motif
Todeterminewhetherthewild-typeandthemutantproteins
are expressed and located on the surface of the oocytes,
the cDNA was extended at the 3¢ end by the sequence
GATTACAAGGATGACGACGATAAG coding for the
FLAG
Ò
peptide. Insertion of the sequence was carried out
by site-directed mutagenesis using the QuikChange
TM
kit
from Stratagene, La Jolla, USA. The primers used for the
PCR are depicted in Table 1. Here, 18 PCR-cycles were
applied. Location of the insertion was verified by SeqLab
Laboratories, Go

¨
ttingen, Germany.
Immunofluorescence microscopy
X. laevis oocytes, prepared and maintained in culture as
described [28], were injected with 2.5 ng cRNA coding for
the wild-type and mutant Ntcp-protein, both elongated by
the FLAG
Ò
sequence. After 2 days of expression, the
vitelline membrane was removed by hand and the oocytes
were fixed in a solution of 80% methanol/20% dimethyl-
sulfoxide. Oocytes were washed in decreasing concentra-
tions of methanol in phosphate-buffered saline (NaCl/P
i
,
0.9%, pH 7.4) and were incubated with the mAb M2-anti-
FLAG
Ò
(Sigma-Aldrich, Taufkirchen, Germany). After a
second washing step with NaCl/P
i
buffer the oocytes were
fixed with 3.7% formaldehyde in NaCl/P
i
and incubated
with Alexa Fluor
Ò
488 goat anti-mouse IgG conjugate
(Molecular Probes, Leiden, Netherlands). They were again
washed with NaCl/P

i
and embedded in Technovit 7100
(Heraeus Kulzer, Wehrheim, Germany). Sections, 5-lm
thick, were cut and proteins were detected by reflective
fluorescence microscopy at 488 nm (Leitz Diaplan UV
Microscope, Wetzlar, Germany).
Heterologous expression of Ntcp-cRNA in
X. laevis
oocytes
Mutated and nonmutated plasmids were linearized by PvuI
(MBI Fermentas, Vilnius, Lithuania). Capped mRNA was
transcribed in vitro using T7 RNA polymerase (Promega,
Madison, USA) in the presence of capping analog
m
7
G(5¢)ppp(5¢)G from Pharmacia, Freiburg, Germany.
Unincorporated nucleotides were removed with a Sephadex
G-50 spin column (Boehringer, Mannheim, Germany).
cRNAs were recovered by ethanol precipitation and
resuspended in double distilled water for oocyte injection.
X. laevis oocytes were prepared and maintained in culture
as described [28]. They were microinjected with 2.5 ng of
Ntcp/mutant cRNA per oocyte in standard experiments. In a
series of saturation experiments, 0.46–6.9 ng cRNA per
oocyte were injected. For expression, oocytes were incubated
for 2 days at 18 °C in modified Barth solution. For uptake
measurements, 10–15 oocytes were incubated at 25 °Cina
medium containing 5 l
M
[

3
H]taurocholate (NEN Life
Science Products, Boston, MA, USA; specific activity
2–3.47 CiÆmmol
)1
), 10 m
M
Hepes/Tris pH 7.5, 2 m
M
KCl,
1m
M
CaCl
2
,1m
M
MgCl
2
and either 100 m
M
NaCl or
100 m
M
choline chloride in order to calculate the Ntcp-
mediated sodium-dependent taurocholate uptake. Hill
coefficient analysis of the sodium-coupled taurocholate
uptake by wild-type Ntcp and two Ntcp mutants with
mutated negatively charged amino acids (Asp115Asn and
Glu257Gln) was deduced from [
3

H]taurocholate uptake
experiments in the same Hepes/Tris buffer, however, with
sodium chloride concentrations of zero, 30, 50, 100, 150 and
1118 D. Zahner et al. (Eur. J. Biochem. 270) Ó FEBS 2003
Table 1. Primers used for generating the indicated Ntcp-mutations by QuikChange
TM
.
Desired mutation Primer name Sequence
Asp24Asn – F
Ggccaccgggccacaaacaaggcgcttagcatc
–R Gatgctaagcgccttgtttgtggcccggtggcc
Cys44Ala – F Gctctcactgggcgccaccatggaattcagc
–R Gctgaattccatggtggcgcccagtgagagc
Cys44Trp – F Catgctctcactgggctggaccatggaattcagc
–R gctgaattccatggtccagcccagtgagagcatg
Glu47Gln – F ctgggctgcaccatgcaattcagcaagatcaag
–R cttgatcttgctgaattgcatggtgcagcccag
Glu89Gln – F cacctgagcaacattcaagctctggccatcctc
–R gaggatggccagagcttgaatgttgctcaggtg
Cys96Ala – F ctggccatcctcatcgctggctgctctcccggg
–R cccgggagagcagccagcgatgaggatggccag
Cys96Trp – F ctggccatcctcatctggggctgctctcccggg
–R cccgggagagcagccccagatgaggatggccag
Cys98Ala – F catcctcatctgtggcgcctctcccggggggaac
–R gttccccccgggagaggcgccacagatgaggatg
Cys98Trp – F catcctcatctgtggctggtctcccggggggaac
–R gttccccccgggagaccagccacagatgaggatg
Asp115Asn – F ctggccatgaaggggaacatgaacctcagcatc
–R gatgctgaggttcatgttccccttcatggccag
Cys125Ala – F catcgtgatgaccaccgcctccagcttcagtgcc

–R ggcactgaagctggaggcggtggtcatcacgatg
Cys125Del – F catcgtgatgaccacctccagcttcagtgcc
–R ggcactgaagctggaggtggtcatcacgatg
Asp147Asn – F gcaaaggcatctacaatggagaccttaaggacaagg
–R ccttgtccttaaggtctccattgtagatgcctttgc
Cys170Ala – F gttctcattcctgccaccatagggatcgtcc
–R ggacgatccctatggtggcaggaatgagaac
Cys170Trp – F catagttctcattccttggaccatagggatcgtc
–R gacgatccctatggtccaaggaatgagaactatg
Cys250Ala – F caactcaatccaagcgccagacgcaccatcagc
–R gctgatggtgcgtctggcgcttggattgagttg
Cys250Del – F ccaactcaatccaagcagacgcaccatcagc
–R gctgatggtgcgtctgcttggattgagttgg
Asp257Asn – F gctgcagacgcaccatcagcatgcaaacaggattcc
–R ggaatcctgtttgcatgctgatggtgcgtctgcagc
Cys266Ala – F ccaaaacattcaactcgcttctaccatcctcaatgtg
–R cacattgaggatggtagaagcgagttgaatgttttgg
Cys266Del – F ggattccaaaacattcaactctctaccatcctcaatgtgacc
–R ggtcacattgaggatggtagagagttgaatgttttggaatcc
Asp277Asn – F cctcaatgtgaccttcccccctcaagtcattgggcc
–R ggcccaatgacttgaggggggaaggtcacattgagg
Cys306Ala – F catcattatcttccgggcctatgagaaaatcaagcctcc
–R ggaggcttgattttctcataggcccggaagataatgatg
Cys306Trp – F catcattatcttccggtggtatgagaaaatcaagcctcc
–R ggaggcttgattttctcataccaccggaagataatgatg
Cys306Del – F catcattatcttccggtatgagaaaatcaagcctc
–R gaggcttgattttctcataccggaagataatgatg
Thr317Ala – F gcctccaaaggaccaagcaaaaattacctacaaagc
–R gctttgtaggtaatttttgcttggtcctttggaggc
Thr317Tyr – F atcaagcctccaaaggaccaatacaaaattacctacaaagctgctg

–R cagcagctttgtaggtaattttgtattggtcctttggaggcttgat
Thr320Ala – F ggaccaaacaaaaattgcctacaaagctgctgcaac
–R gttgcagcagctttgtaggcaatttttgtttggtcc
Thr320Tyr – F ccaaaggaccaaacaaaaatttactacaaagctgctgcaactgagg
–R cctcagttgcagcagctttgtagtaaatttttgtttggtcctttgg
FLAG(R)-insert – F Ggtcagatggcaaatgattacaaggatgacgacgataagtagaatgtgaaacttcgaagc
–R Gcttcgaagtttcacattctacttatcgtcgtcatccttgtaatcatttgccatctgacc
Ó FEBS 2003 Site-directed mutagenesis of Ntcp (Eur. J. Biochem. 270) 1119
200 m
M
. The buffers of zero, 25, 50, and 100 m
M
NaCl were
substituted with the corresponding choline chloride concen-
tration (0/100, 25/75, 50/50, 100/0 NaCl/choline chloride).
The oocyte-associated radioactivity was determined in a
liquid scintillation counter (Wallac 1407, Wallac Inc., Turku,
Finland).
Results
Search for conserved negatively charged amino acids,
cysteines and C-terminal threonines
by sequence identity
An alignment of the amino acid sequence of nine SBAT
proteins, namely five basolateral Ntcp-proteins together
with four apical Isbt-proteins, revealed that the following
glutamates, aspartates, and cysteines in the rat Ntcp are
conserved in all of the nine family members: Cys44, Cys98,
Cys125, and Cys266 as well as Glu47, Asp115, Asp147,
Glu257, and Glu277. The threonines Thr317 and Thr320
are only found in the rat liver Ntcp (Fig. 1).

Mutations of negatively charged amino acids residues
The predicted seven transmembrane (TM) structure of rat
liver Ntcp according to [1] and all introduced mutations are
depicted in Fig. 2. The organic anion transporting
SBATs are cotransporters with sodium ions as the driving
ion gradient. Therefore, in addition to substrate binding
sites, regions for cation binding are also required. Earlier
reports have indicated the importance of negatively
charged amino acids for sodium-coupled substrate cotrans-
port or exchange [12,13,16–18]. Mutations of all conserved
and two nonconserved negatively charged amino acids to
the noncharged counterparts, i.e. Asp to Asn and Glu
to Gln, revealed that the aspartates Asp24 and Asp115 as
well as Glu257 are required for taurocholate transport
(Fig. 3).
The negatively charged Glu257 is exposed in an
extracellular loop of the Ntcp and could represent the
sodium ion sensor of sodium-coupled taurocholate trans-
port via Ntcp. In order to find out whether and to what
extent this amino acid affects sodium ion dependency of
taurocholate uptake, transport studies were performed in
the presence of varying amounts of extracellular sodium
chloride and Hill analysis was applied (Fig. 4). For
comparison the transport-negative Asp115Asn mutant
was investigated in the same manner. As a result, the
negative charge in Glu257 is an essential prerequisite for
sodium-dependent taurocholate uptake. The Hill coeffi-
cient of this cotransport by wild-type Ntcp is about 2–2.59
[43,44] but dropped to 0.32 (measured at 25–200 m
M

NaCl) if Glu257 was converted to Gln (Fig. 4). Increase
of the sodium gradient by applying concentrations up to
200 m
M
NaCl to the outside did not alter the abolished
transport of taurocholate significantly, although at 200 m
M
NaCl taurocholate transport slightly increased. In contrast,
significant sodium cooperativity was found, however, at a
much lower level, in Ntcp mutant Asp115Asn. The Hill
number was 1.15 for the Asp115Asn mutant (Fig. 4) which
corresponds to a sodium stoichiometry of one sodium ion
per taurocholate molecule.
As taurocholate transport via the carrier mutants
Glu257Gln and Asp115Asn was almost nil (2 and 15% of
wild-type Ntcp, respectively), tests were carried out to
determine whether insufficient expression of the injected
cRNA caused this lack of transport. Therefore, up to three
times the amount of the cRNA compared to the standard
amount was injected into oocytes, i.e. 6.9 ng instead of
2.3 ng cRNA. No improvement of taurocholate transport
was observed (Fig. 5).
Tests were then performed to determine whether the
absence of transport was caused by a sorting defect of these
mutant proteins. For this reason, the FLAG
Ò
motif was
Fig. 1. Alignment of nine members of the SBAT family. Ntcp mouse1,
mml1;Ntcpmouse2,mml2;Ntcprat,rnl;Ntcprabbit,oclm;NTCP
human, hsl; Isbt rat, rni; Isbt mouse, mmi; Isbt rabbit, oci; Isbt human,

hsi; conserved cysteines, c; conserved acidic amino acids, a.
1120 D. Zahner et al. (Eur. J. Biochem. 270) Ó FEBS 2003
cloned into each transport-negative mutant clone. With this
technique, insertion of the mutants Asp115Asn and
Glu257Gln within the cell membrane of X. laevis oocytes
was observed by use of antibodies raised against the
FLAG
Ò
peptide, and applied to permeabilized oocytes
(Fig. 6). An exception was observed, the transport-negative
mutant Asp24Asn, which did not appear in the membrane
(Fig. 6), indicating that Asp24 from the extracellular
N-terminus is not essential for transport but for appropriate
cell sorting of the Ntcp protein.
Cysteine mutants
Each of the eight cysteines, four in transmembrane
domains, three in cytoplasmic or extracellular loops, and
one at the beginning of the C-terminal tail was altered by
site-directed mutagenesis. The three cysteines from the
nontransmembrane domains and the one from the
C-terminus were substituted by alanine or were omitted
to attain deletion mutants. All deletion mutants, namely
Cys125Del, Cys250Del, Cys266Del, and Cys306Del were
transport-negative (Fig. 7), indicating that each cysteine
per se is required. If their alanine counterparts were
expressed in X. laevis oocytes, all except one showed
restored transport activity. Only the Cys266Ala mutant
remained transport-negative. We conclude that Cys266 is
the only cysteine of the rat liver Ntcp which appears to
be directly involved in taurocholate uptake into the

oocytes.
To show whether or not mutant Cys266Ala was
present in the cell surface of X. laevis oocytes, the corres-
ponding cDNA clone was also tagged by the FLAG
Ò
motif and cRNA from this construct was again injected
into oocytes. Immunofluorescence pictures confirm that
the mutant Cys266Ala protein is present in the cell
membrane in a similar amount as the wild-type Ntcp
protein (Fig. 6).
Eight further cysteine mutations were generated regard-
ing the four intramembrane cysteines (Fig. 7). Exchanges by
alanine or tryptophane were generated. With the exception
of Cys306 each tryptophane mutant was either transport
negative (Cys98Trp, Cys170Trp, Cys96Trp) or showed
decreased uptake (Cys44Trp). However, if these intramem-
brane cysteines were substituted by alanines, taurocholate
transport was fully regained. This indicates that none of the
transmembrane cysteines appears to be directly involved in
the transport process. An exception was the tryptophane
substitution of Cys306. This Cys306Trp mutant transported
taurocholate more effectively (more than 1.5-fold) than
wild-type Ntcp. Cys306, however, is located at the beginning
of the C-terminal tail of Ntcp (Fig. 7).
Fig. 3. Mutations of negatively charged conserved amino acids alters
taurocholate transport via Ntcp. Uptake of [
3
H]taurocholate by
X. laevis oocytes two days after microinjection of 50 nL containing
2.5 ng cRNA which was transcribed from wild-type or mutant Ntcp

clones. Uptake is given in percentage of wild-type uptake after 30 min
of exposure to 5 l
M
[
3
H]taurocholate.
Fig. 2. Topology model of rat Ntcp based on hydropathy analysis of the amino acid sequence (according to [1]). Transmembrane domains are
symbolized as blocks of amino acids. Mutated amino acids are highlighted in gray. The resulting mutants are shown in boxes, with deletions
indicated (del).
Ó FEBS 2003 Site-directed mutagenesis of Ntcp (Eur. J. Biochem. 270) 1121
Threonine mutants
The threonines Thr317 and Thr320 are located within the
protein kinase C consensus regions LysXXThrLys and
LysXThrXLys of the Ntcp [29]. Therefore, both threonines
were substituted by either tyrosine or alanine. None of these
mutations significantly altered taurocholate uptake. The
transport rate of each mutant was between 80 and 100% of
the wild-type Ntcp (Fig. 6).
Discussion
Hepatobiliary transport of the major bile acid taurocholate
in humans and rats begins by uptake across the baso-
lateral membrane of hepatocytes via the high affinity,
Fig. 5. The relationship between the amount of
injected cRNA and taurocholate uptake into
X. laevis oocytes via Ntcp and Ntcp mutants.
Uptake of [
3
H]taurocholate by cRNA-injected
oocytes after exposure to 5 l
M

[
3
H]taurocho-
late for 30 min. The amount of cRNA of
transport-negative mutants was increased
14-fold; the standard amount of cRNA which
was injected for comparison of transport by
mutated vs. wild-type Ntcp was 2.5 ngÆ
oocyte
)1
.
Fig. 4. Sodium dependency of taurocholate
uptake by Ntcp mutants. Uptake of 5 l
M
[
3
H]taurocholate was measured during 30 min
after injection of 2.5 ng cRNA subscribed
from wild-type and mutant Ntcp-clones into
oocytes. The oocytes were incubated in the
presence of increasing sodium chloride con-
centrations. The results obtained by the clones
Asp115Asn and Glu257Gln are also given in a
Hill plot.
Fig. 6. Detection of the presence of Ntcp proteins in the cell membrane
of X. laevis oocytes by the reporter FLAGÒ motif. The FLAGÒ
encoded amino acid sequence was detected by sandwich immuno-
fluorescence labeling with monoclonal anti-FLAGÒ Ig and subse-
quent labeling with Alexa FluorÒ 488 goat anti-mouse IgG conjugate
in permeabilized and fixed oocytes after two days of cRNA expression.

With the exception of Asp24Asn mutated Ntcp, each mutated protein
was detected in the cell membrane of oocytes. Negative control was
oocytes that were injected with water. From top left to right: upper,
Asp24Asn; Cys266Del; middle, Glu257Gln; Cys266Ala; lower,
Asp115Asn; water-injected oocyte (negative control); large picture,
wild-type Ntcp (positive control).
1122 D. Zahner et al. (Eur. J. Biochem. 270) Ó FEBS 2003
sodium-dependent and liver-specific basolateral bile acid
carriers NTCP (humans) and Ntcp (rats). Subsequent to
uptake the bile acid is released into the bile canaliculus by the
bile salt export pump BSEP, an ATP-driven ABC-cassette
protein related to mdr1 [30,31]. Disturbances of the
hepatocellular part of the enterohepatic circulation of bile
Ó FEBS 2003 Site-directed mutagenesis of Ntcp (Eur. J. Biochem. 270) 1123
acids causes intrahepatic cholestasis [32–35]. Whereas nat-
urally occurring mutations in the BSEP have been described,
causing the rare Byler syndrome in children [36], naturally
occuring mutations of the NTCP-gene locus have not yet
been observed. Our study with the rat Ntcp indicates,
however, that several amino acids may be essential for
hepatocellular taurocholate uptake because mutations in
these amino acids caused lack of transport; the amino acids
in question are Asp115, Glu257, and Cys266. All of these are
conserved in SBATs and are found also in the human NTCP
protein. Functional mutations of these amino acids in the
human NTCP gene locus would cause hypercholanaemia
but would result in low intrahepatic bile salt levels and
therefore little if any hepatocellular injury. This syndrome
has been already described in two children, however,
without mutations of the NTCP gene and therefore

remained unexplained [37]. The clinical picture of nonfunc-
tional NTCP carriers would differ from patients with
cholestasis where blockade of bile acid secretion at the
canalicula pole of hepatocytes leads to elevated intracellular
(and extracellular) bile acid concentration and therefore
causes severe liver injury. It should be noted that in such
cases of cholestasis, Ntcp expression as a protecting
mechanism decreases dramatically [38], but in the cases of
benign hypercholanemia, Ntcp expression was normal [37].
In the latter syndrome, taurocholate uptake and also bile
acid-dependent bile formation is not expected to cease as bile
acid uptake by liver-type organic anion transporting poly-
peptides OATP 8 and OATP-C continues.
All mutations from transport-negative mutants were
located in loop structures of the rat Ntcp; two of them,
Glu257 and Cys266, were located in loop VI, the final
extracellular loop (Fig. 2). This region also appears to have
key properties for taurocholate transport in other SBATs,
as it was already reported that a naturally occuring point
mutation of Thr262 in the human intestinal Na
+
/bile acid
cotransporter ISBT abolished reabsorption of bile acids and
caused primary bile acid malabsorption in patients [38]. This
conserved threonine is located in loop VI of ISBT and Ntcp
andisnexttoGlu257intheratNtcp,whichwereporthere,
is also required for hepatic taurocholate transport.
The negatively charged Glu257 is probably a binding site
for extracellular sodium ions. The driving force for substrate
transport via all SBATs is the sodium gradient across the cell

membrane. Two sodium ions are supposed to be translo-
cated together with one bile acid molecule via ileal Na
+
-bile
acid cotransporters such as human ASBT [46] or the rat liver
Ntcp [11]. Therefore, sodium-driven taurocholate transport
is electrogenic [40,46]. This 2 : 1 stoichiometry was altered in
the mutant Glu257Gln as revealed by Hill analysis. A Hill
number of almost zero was calculated indicating that this
mutant is unable to translocate sodium ions together with
taurocholate. Therefore we assume that Glu257 is the
extracellular sodium sensor for sodium taurocholate co-
transport. As taurocholate uptake with this Ntcp protein
was almost nil (residual 2% transport compared with wild-
type Ntcp), the long established importance of the sodium
ion for the translocation step of monoanionic bile acids was
reaffirmed. The cationic sodium ions are likely to interact
with negatively charged amino acid residues at the outer
surface of the Ntcp protein, but then need to be translocated
through pore-forming transmembrane helices to the cyto-
plasmic regions of the protein. It has been shown that
extracellular loops, containing charged amino acids, can
slide between TM domains into the membrane, forming
P-loops [40]. P-loops allow the introduction of charged
molecules into inner parts of the cell membrane from where
these can be overtaken by further binding sites originating
from the cytoplasmic region of the protein. It is tempting to
Fig. 7. Taurocholate uptake into X. laevis
oocytes after injection of cRNA of wild-type
and mutated Ntcp. Uptake of [

3
H]taurocholate
in X. laevis oocytes which were injected with
2.5 ng wild-type or mutant cRNA and incu-
bated for two days as described in Materials
and methods. The diagram depicts relative
uptake in percentage of uptake by wild-type
Ntcp (100%) after 30 min incubation with
5 l
M
[
3
H]taurocholate.
Fig. 8. P-loop model of rat Ntcp depicting Glu257 and Asp115 as
putative binding sites for sodium ions. The extracellular loop 6 between
TM VI and VII contains a sodium substrate-binding region for tauro-
cholate during sodium ion–taurocholate cotransport.
1124 D. Zahner et al. (Eur. J. Biochem. 270) Ó FEBS 2003
hypothesize that if such a translocation mechanism is active
in the Na
+
/bile acid cotransporter Ntcp, extracellular
Glu257 and cytoplasmic Asp115 may constitute an appro-
priate pair of binding sites for sodium ions allowing ion
translocation across the cell membrane. The cytoplasmic
Asp115 may detract the two sodium ions delivered by
extracellular Glu257 via P-loop formation (Fig. 8). Consis-
tent with this suggested model is the observation that charge
modification in the putative cytoplasmic sodium sensor
Asp115 through its conversion into Asn decreased sodium-

dependent taurocholate uptake to 15% of wild-type Ntcp,
probably because the sodium stoichiometry of 2 : 1 declined
to 1 : 1 (Fig. 4).
Whereas negatively charged residues are not suspected
to interact with the anionic organic substrates of SBATs
cysteines are. It has already been shown that Cys266 is
essential for taurocholate transport by the human NTCP
protein [21]. Here we report that the same amino acid in
the corresponding position is also required for taurocho-
late transport by the rat Ntcp. This cysteine appears to be
directly involved in taurocholate transport as it is the only
one which remained transport-negative when substituted
by alanine. However, this is in contrast to the report by
Halle
´
n et al. 2000 [21], showing that mutant Cys266Ala of
the human NTCP still transported taurocholate without
any marked change in K
m
and V
max
. These authors
obtained evidence for a separate function of that cysteine
by indirect means with SH-group reagents. The reason for
this discrepancy is unclear, but might be due to the
different expression systems used for detection (Xenopus
oocytes in this report vs. HEK293 cells in Halle
´
n’s report)
or to different local interactions of this cysteine within

loop VI of the different Ntcps. It should be noted that
loop VI of the human NTCP contains four cysteines
whereas in the rat Ntcp only two cysteines (Cys250,
Cys266) are present.
Other cysteines (seven out of eight) of the Ntcp may
have indirect effects on taurocholate transport. Such effects
were analyzed by cysteine deletion mutants and trypto-
phane substitutions. Indirect effects could be space-holding
properties of these cysteines tested by deletion mutants and
lipophilic binding properties other than by SH-groups
tested by tryptophane. The deletion mutants of the
cysteines from loops III and VI (Cys125, Cys250 and
Cys266) (Fig. 2) were transport-negative. Replacement by
alanine, however, restored uptake in the case of Cys125
and Cys250. Therefore, these cysteines appear to have
space holder functions for the loops. With respect to the
Cys250Ala mutant of the rat Ntcp, our finding is in full
agreement with the results observed with the human
NTCP, where taurocholate transport by the Cys250Ala
mutant was also not altered [21]. Because seven out of
eight cysteine/alanine substitutions were transport-positive
(with the exception of Cys266Ala), we conclude that no
disulfide bonding between cysteines within a monomeric
Ntcp protein has occurred.
Among the cysteine/tryptophane substitutions,
Cys306Trp was exceptional in that taurocholate transport
was not abolished but was even enhanced to 150% of wild-
type transport. Cys306 is located at the border of TM7 to
the cytoplasmic C-terminus. Cysteines in that position
might serve as an anchor for a palmitoyl/isoprenyl residue

which fixes the protein to the plasma membrane. If this is
true for the Ntcp protein, this could explain why the
hydrophobic amino acid tryptophane fully substituted
Cys306 only in that protein position and why in contrast
to all other tryptophane substitutions, taurocholate trans-
port was not abolished but was even enhanced by this
mutation.
Cys306 marks the border to a 56 amino acid tail which
stretches to the end of the final amino acid, Asn362, of
the Ntcp C-terminus. It was already shown that this
C-terminal tail is not required for transport properties [41].
A truncated rat liver Ntcp protein lacking all amino acids
beyond Cys306 transported taurocholate with a K
m
identical to that of wild-type Ntcp. Similarly, a trans-
port-positive Ntcp splicing variant which was shortened by
45 amino acids from the end of the C-terminus was cloned
from mice [9]. Thus the C-terminal tail appears to be
unnecessary for taurocholate uptake. However, it was
required for appropriate basolateral sorting of the protein,
because mutations of Tyr307 (following next to Cys306)
and Tyr321 (following next to Thr320) accumulated within
the cytosol but were absent from the cell membrane [42].
Apart from sorting signal motifs, other regulatory func-
tions might be phosphorylation/dephosphorylation reac-
tions. For this reason, two threonines, Thr317 and Thr320,
within a protein kinase C-consensus region were mutated
to alanines but also to tyrosines. None of these mutations
showed any effects on taurocholate transport into X. laevis
oocytes. Our results would not disprove such phosphory-

lation reactions being present in mammalian cells, but the
localization of receptive serine/threonine residues for a
particular protein kinase are unlikely to be expected within
that protein kinase C-consensus region, as even the alanine
substitutions were without any effect on taurocholate
transport.
Acknowledgments
The authors wish to acknowledge the receipt of the Ntcp-containing
plasmid prLNaBA from Dr Bruno Hagenbuch, Zurich. Support of this
project was given by Drs Frank and Marita Langewische who helped
to initiate the study by constructing cysteine mutants. Technical help
was provided by Mrs Elisabeth Ju
¨
ngst-Carter and Steffi Weghenkel.
Dr Bruce Boschek has provided critical liguistical advice in preparing
the manuscript.
References
1. Hagenbuch,B.,Stieger,B.,Foguet,M.,Lu
¨
bbert, H. & Meier, P.J.
(1991) Functional expression cloning and characterisation of the
hepatocyte Na
+
/bile acid cotransport system. Proc.NatlAcad.
Sci. USA 88, 10629–10633.
2. Hagenbuch, B. & Meier, P.J. (1994) Molecular cloning, chromo-
somal localization and functional characterisation of a human
liver Na
+
/bile acid cotransporter. J. Clin. Invest. 93, 1326–1331.

3. Hagenbuch, B. & Meier, P.J. (1996) Sinusoidal (basolateral) bile
salt uptake systems of hepatocytes. Semin. Liver Dis. 16, 129–136.
4. Wong, M.H., Oelkers, P., Craddock, A.L. & Dawson, P.A. (1994)
Expression cloning and characterization of the hamster ileal
sodium-dependent bile acid transporter. J. Biol. Chem. 269, 1340–
1347.
5. Wong, M.H., Oelkers, P. & Dawson, P.A. (1995) Identification of
a mutation in the ileal sodium-dependent bile acid transporter
Ó FEBS 2003 Site-directed mutagenesis of Ntcp (Eur. J. Biochem. 270) 1125
gene that abolishes transport activity. J. Biol. Chem. 270, 27228–
27234.
6. Shneider, W.L., Dawson, P.A., Christie, D M., Hardikar, W.,
Wong, M.H. & Suchy, F.J. (1995) Cloning and molecular char-
acterisation of the ontogeny of rat ileal sodium dependent bile acid
transporter. J. Clin. Invest. 95, 745–754.
7. Lazarides, K.N., Pham, L., Tietz, P., Marinelli, P.C., Levine, S.,
Dawson, P.A. & LaRusso, N.F. (1997) Rat cholangiocytes absorb
bile acids at their apical domain via the ileal sodium-dependent
bile acid transporter. J. Clin. Invest. 100, 2714–2721.
8.Lazarides,K.N.,Tietz,P.,Wu,T.,Kip,S.,Dawson,P.A.&
LaRusso, N.F. (2000) Alternatic splicing of the rat sodium/bile
acid transporter changes ist cellular localization and transport
properties. Proc. Natl Acad. Sci. USA 97, 11092–11097.
9. Cattori, V., Eckhardt, U. & Hagenbuch, B. (1999) Molecular
cloning and functional characterization of two alternatively
spliced Ntcp isoforms from mouse liver. Biochim. Biophys. Acta
1445, 154–159.
10. Hagenbuch, B. (1997) Molecular properties of hepatic uptake
systems for bile acids and organic anions. J. Membrane Biol. 160,
1–8.

11. Weinman, S.A. & Weeks, R.P. (1993) Electrogenicity of Na
+
-
coupled bile salt transport in isolated rat hepatocytes. Am. J.
Physiol. 265, G73–G80.
12. Murtazina, R., Booth, B.J., Bullis, B.L., Singh, D.N. & Fliegel, L.
(2001) Functional analysis of polar amino acids residues in
membrane associated regions of the NHE1 isoform of the mam-
malian Na
+
/H
+
exchanger. Eur. J. Biochem. 268, 4674–4685.
13. Nicoll, D.A., Hryshko, L.V., Matsuoka, S., Frank, J.S. & Phi-
lipson, K.D. (1996) Mutation of amino acid residues in the
putative transmembrane segments of the cardiac sarcolemmal
Na
+
–Ca
++
exchanger. J. Biol. Chem. 23, 13385–13391.
14. Lanyi, J.K. (1997) Mechanism of ion transport across membranes.
Bacteriorhodopsin as a prototype for proton pumps. J. Biol.
Chem. 272, 31209–31212.
15. Martin, S., Botto, J.M., Vincent, J.P. & Mazella, J. (1999) Pivotal
role of an aspartate residue in sodium sensitivity and coupling to G
proteins ot neurotensin receptors. Mol. Pharmacol. 55, 210–215.
16. Quick, M. & Jung, H. (1997) Aspartate 55 in the Na
+
/proline

permease of Escherichia coli is essential for Na
+
-coupled proline
uptake. Biochemistry 36, 4631–4636.
17. Jung, H. (2001) Towards the molecular mechanism of Na
+
/
solute symport in prokaryotes. Biochim. Biophys. Acta 1505,
131–143.
18. Poolman, B., Knol, J., van der Does, C., Henderson, P.J.F.,
Liang, W J., Leblanc, G., Pourcher, T. & Mus-Veteau, I. (1996)
Cation and sugar selectivity determinats in novel family of trans-
port proteins. Molec. Microbiol. 19, 911–922.
19. Blumrich, M. & Petzinger, E. (1990) Membrane transport of
conjugated and unconjugated bile acids into hepatocytes is
susceptible to SH-blocking reagents. Biochim. Biophys. Acta 1029,
1–12.
20. Blumrich, M. & Petzinger, E. (1993) Two distinct types of
SH-groups are necessary for bumetanide and bile acid uptake into
isolated rat hepatocytes. Biochim. Biophys. Acta 1149, 278–284.
21. Halle
´
n, S., Fryklund, J. & Sachs, G. (2000) Inhibition of the
human sodium/bile acid cotransporters by side-specific methane-
thiosulfonate sulfhydryl reagents: substrate-controlled accessi-
bility of site of inactivation. Biochemistry 39, 6743–6750.
22. Mukhopadhayay, S., Ananthanarayanan, M., Stieger, B., Meier,
P.J., Suchy, F.J. & Anwer, M.S. (1998) Sodium taurocholate
cotransporting polypeptide is a serine, threonine phosphorprotein
and is dephosphorylated by cyclic AMP. Hepatology 28, 1629–

1636.
23. Gru
¨
ne, S., Engelking, L.R. & Anwer, M.S. (1993) Role of
intracellular calcium and protein kinases in the activation of
hepatic Na
+
/taurocholate cotransport by cyclic AMP. J. Biol.
Chem. 268, 17743–17741.
24. Stengelin, S., Becker, W., Maier, M., Noll, R. & Kramer, W.
(1998) Rabbit cDNA encoding hepatic sodium-dependent bile
acid transporter. GeneBank accession number AJ131361.
25. Saeki, T., Motoba, K., Furukawa, H., Kirifiji, K., Kanamoto, R.
& Iwami, K. (1999) Characterisation, cDNA cloning, and func-
tional expression of mouse ileal sodium-dependent bile acid
transporter. J. Biochem. (Tokyo) 125, 846–851.
26. Stengelin, S., Apel, S., Becker, W., Maier, M., Rosenberger, J.,
Wess, G. & Kramer, W. (1997) Ileal sodium/bile acid
cotransporter; direct submission, GeneBank accession number
Q28727.
27. Craddock, A.L., Love, M.W., Daniel, R.W., Kirby, L.C., Walters,
H.C., Wong, M.H. & Dawson, P.A. (1998) Expression and
transport properties of the human ileal and renal sodium-depen-
dent bile acid transporter. Am.J.Physiol.274, G157–G169.
28. Eckhardt, U., Horz, J.A., Petzinger, E., Stu
¨
ber, W., Reers, M.,
Dickneite, G., Daniel, H., Wagener, M., Hagenbuch, B., Stieger, B.
& Meier, P.J. (1996) The peptide-based thrombin inhibitor
CRC 220 is a new substrate of the basolateral rat liver organic

anion-transporting polypeptide. Hepatology 24, 380–384.
29. Pearson, R.B. & Kemp, B.E. (1991) Proteinkinase phosphoryla-
tion site sequences and consensus specificity motifs. Tabulations.
Methods Enzymol. 200, 62–82.
30. Gerloff, T., Stieger, B., Hagenbuch, B., Madon, J., Landmann, L.,
Roth, J., Hofmann, A.F. & Meier, P.J. (1998) The sister of
P-glycoprotein represents the canalicular bile salt export pump
of mammalian liver. J. Biol. Chem. 273, 10046–10050.
31. Bahar, R. & Stolz, A. (1999) Bile acid transport. Gastroenterol.
Clin. North Am. 28, 27–58.
32. Petzinger, E. (1994) Transport of organic anions in the liver. Rev.
Physiol. Biochem. Pharmacol. 123, 47–211.
33. Eckhardt, U., Schroeder, A., Stieger, B., Ho
¨
chli, M., Landmann,
L., Tynes, R., Meier, P.J. & Hagenbuch, B. (1999) Poly-
specific uptake of the hepatic organic anion transporter Oatp1
in stably transfected CHO cells. Am.J.Physiol.276, G1037–
G1042.
34. Trauner, M., Meier, P.J. & Boyer, J.L. (1998) Molecular patho-
genesis of cholestasis. N.Engl.J.Med.339, 1217–1227.
35. Kullak-Ublick, G.A., Beuers, U. & Paumgartner, G. (2000)
Hepatobiliary transport. J. Hepatol. 32 (Suppl. 1), 3–18.
36. Strautnieks, S.S., Kagalwalla, A.F., Tanner, M.S., Knisely, A.S.,
Bull, L., Freimer, N., Kocoshis, S.H., Gardiner, R.M. &
Thompson, R.J. (1997) Identification of a locus for progressive
familial intrahepatic cholestasis PFIC2 on chromosome 2q24.
Am.J.Hum.Genet.61, 630–632.
37. Shneider, B.L., Fox, V.L., Schwarz, K.B., Watson, C.L., Anan-
thanarayanan, M., Thevananther, S., Christie, D.M., Hardikar,

W., Setchell, K.D.R., Mieli-Vergani, G., Suchy, F.J. & Mowat,
A.P. (1997) Hepatic basolateral sodium-dependent bile acid
transporter expression in two unusual cases of hyper-
cholanemia and in extrahepatic biliary atresia. Hepatology 25,
1176–1183.
38. Gartung, C., Ananthanarayanan, M., Rahman, M., Shuele, S.,
Nundy, S., Soroka, C. & Stolz, A. (1996) Down-regulation of
expression and function of the rat liver Na/bile acid cotransporter
in extrahepatic cholestasis. Gastroeneteology 110, 199–209.
39. Oelkers, P., Kirby, L.C., Heubi, J.E. & Dawson, P.A. (1997)
Primary bile acid malabsorption caused by mutations in the ileal
sodium-dependent bile acid transporter gene (SLC10A2). J. Clin.
Invest. 99, 1880–1887.
40. Lidofsky, S.D., Fitz, J.G., Weisiger, R.A. & Scharschmidt, B.F.
(1993) Hepatic taurocholate uptake is electrogenic and influenced
by transmembrane potential difference. Am.J.Physiol.264
(Gastrointest. Liver Physiol. 27), G478–G485.
1126 D. Zahner et al. (Eur. J. Biochem. 270) Ó FEBS 2003
41. Kirsch, G.E., Pascual, J.M. & Shieh, C.C. (1995) Functional role
of a conserved aspartate in the external mouth of voltage-gated
potassium channels. Biophys. J. 68, 1804–1813.
42. Sun,A.Q.,Arrese,M.A.,Zeng,L.,Swaby,I.,Zhou,M M.&
suchy, F.J. (2001) The rat liver Na
+
/bile acid cotransporter.
Importance of the cytoplasmic tail to function and plasma
membrane targeting. J. Biol. Chem. 276, 6825–6833.
43. Sun, A.Q., Ananthanarayanan, M., Soroka, C.J., Thevananther,
S., Shneider, B.L. & Suchy, F.J. (1998) Sorting of rat liver ileal
sodium-dependent bile acid transporters in poilarized epithelial

cells. Am. J. Physiol. 275, G1045–G1055.
44. Weinman, S.A. (1997) Electrogenicity of Na
+
-coupled bile acid
transporters. Yale J. Biol. Med. 70, 331–340.
45. Edmondson, J.W., Miller, B.A. & Lumeng, L. (1985) Effect of
glucagon on hepatic taurocholate uptake: relationship to mem-
brane potential. Am.J.Physiol.249 (Gastrointest. Liver Physiol.
12), G427–G433.
46. Weinman, S.A., Carruth, M.W. & Dawson, P.A. (1998) Bile acid
uptake via human apical sodium-bile acid cotransporter is elec-
trogenic. J. Biol. Chem. 273, 34691–34695.
Ó FEBS 2003 Site-directed mutagenesis of Ntcp (Eur. J. Biochem. 270) 1127