Báo cáo Y học: Differential regulation of telomerase activity by six telomerase subunits potx

Differential regulation of telomerase activity by six telomerase
subunits
Joseph Tung-Chieh Chang
1
, Yin-Ling Chen
2
, Huei-Ting Yang
2
, Chi-Yuan Chen
2
and Ann-Joy Cheng
2
1
Department of Radiation Oncology, Chang Gung Memorial Hospital, Taoyuan, Taiwan;
2
School of Medical Technology and
Graduate School of Basic Medical Science, Chang Gung University, Taoyuan, Taiwan
Telomerase is a specialized reverse transcriptase responsible
for synthesizing telomeric DNA at the ends of chromo-
somes. Six subunits composing the telomerase complex have
been cloned: hTR (human telomerase RNA), TEP1
(telomerase-associated protein 1), hTERT (human telom-
erase reverse transcriptase), hsp90 (heat shock protein 90),
p23, and dyskerin. In this study, we investigated the role of
each the telomerase subunit on the activity of telomerase.
Through down- or upregulation of telomerase, we found
that only hTERT expression changed proportionally with
the level of telomerase activity. The other components,
TEP1, hTR, hsp90, p23, and dyskerin remained at high and
unchanged levels throughout modulation. In vivo and in vitro
experiments with antisense oligonucleotides against each

telomerase component were also performed. Telomerase
activity was decreased or abolished by antisense treatment.
To correlate clinical sample status, four pairs of normal and
malignant tissues from patients with oral cancer were
examined. Except for the hTERT subunit, which showed
differential expression in normal and cancer tissues, all other
components were expressed in both normal and malignant
tissues. We conclude that hTERT is a regulatable subunit,
whereas the other components are expressed more
constantly in cells. Although hTERT has a rate-limiting
effect on enzyme activity, the other telomerase subunits
(hTR, TEP1, hsp90, p23, dyskerin) participated in full
enzyme activi‘ty. We hypothesize that once hTERT is
expressed, all other telomerase subunits can be assembled to
form a highly active holoenzyme.
Keywords: hTERT; hTR; telomerase activity; telomerase
subunit; TEP1.
Normal human somatic cells have a limited proliferative
capacity. Malignant cells, in contrast, have acquired the
ability to override senescence. Telomere length and telom-
erase activity have recently been implicated in the control
of the proliferative capacity of normal and malignant cells
[1,2]. Telomeres consist of hundreds to thousands of
tandem repeats of the sequence TTAGGG, which are
specifically extended by telomerase [1,2]. In most human
somatic cells, except for regenerating tissues and activated
lymphocytes, telomerase activity is undetectable and telo-
mere length is progressively shortened during cell replica-
tion [3,4]. Cell senescence is though to occur when the
telomere length is critically shortened. On the other hand,

most immortalized and human cancer cells exhibit stabil-
ized telomere lengths, and are positive for telomerase
activity [5–7]. The above evidence suggests that mainten-
ance of telomeric length is required for cells to escape from
replicative senescence and to acquire the ability to
proliferate indefinitely. Telomerase reactivation thus
appears to play an important role in cellular immortality
and oncogenesis.
The subunits comprising the human telomerase complex
have been identified: human telomerase RNA (hTR),
telomerase-associated protein 1 (TEP1), and human
telomerase reverse transcriptase (hTERT). hTR functions
as a template for telomere elongation by telomerase [8].
TEP1, which is homologous to the gene of Tetrahymena
telomerase component p80, contains WD40 repeats [9,10].
As p80 interacts with telomerase RNA, the function of
TEP1 is suspected to be associated with RNA and protein
binding. hTERT contains reverse transcriptase motifs and
functions as the catalytic subunit of telomerase [11,12].
Recently, other proteins associated with the telomerase
holoenzyme have been reported. Heat shock protein 90
(hsp90) and molecular chaperon p23 have been demon-
strated to bind to hTERT and contribute to telomerase
activity [13]. Another nucleolar protein, dyskerin, which is
the pseudouridine synthase component of the box
H + ACA snoRNAs, also interacts with hTR [14,15]. It
is conceivable that dyskerin mediates interaction of the
telomerase ribonuclear protein with the nucleolus to
facilitate hTR processing or assembly of the telomerase
complex [14–16]. Greater expression of hTERT, but less of

hTR or TEP1, has been reported to correlate with
telomerase activity in cancer cells [17,18]. An association
of telomerase activity with the expression of hsp90, p23 or
dyskerin has not been reported.
Correspondence to A J. Cheng, School of Medical Technology,
Chang Gung University, 259 Wen-Hwa 1st Road,
Taoyuan 333, Taiwan.
Fax: + 886 3328 0174,
E-mail:
Abbreviations: hTR, human telomerase RNA; TEP1, telomerase
associated protein 1; hTERT, human telomerase reverse
transcriptase; hsp90, head shock protein 90; PTA, phorbol-
12-myristate-13 acetate; PHA, phytohaemagglutinin; PBMC,
peripheral blood mononuclear cells; SFM, serum-free medium;
TRAP/EIA, telomeric repeat amplification protocol-enzyme
immunoassay; TBP, TFIID-binding protein; TAF, TBP-associated
factors; mTEP1, mouse TEP1.
(Received 13 December 2001, revised 25 April 2002,
accepted 28 May 2002)
Eur. J. Biochem. 269, 3442–3450 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.03025.x
The mechanism by which telomerase is activated in
human cancers is unclear. In vitro reconstitution experi-
ments have shown that hTR and hTERT are sufficient for
telomerase activity, suggesting minimal catalytic function of
the enzyme [19]. Ectopic expression of hTERT in normal
human cells restored telomerase activity, extended the
replicative life span of the cells [20,21], maintained telomere
length, and eliminated tumorigenicity [22,23]. The level of
hTERT in cells seems to be a sole component necessary for
regulation of the enzyme’s activity. Nevertheless, it remains

unclear whether other telomerase subunits are essential for
the holoenzyme function. Down-regulation of telomerase
activity by induction of differentiation of HL-60 cells has
been reported [24,25]. To understand the role of each
telomerase subunit in enzyme activity, we used down-
regulation of telomerase by inducing differentiation of
HL-60 cells, and up-regulation of telomerase by stimulating
proliferation of peripheral blood mononuclear cells
(PBMC) to evaluate changes in the telomerase components.
We then investigated alterations in telomerase activity after
blocking each telomerase component by antisense oligonu-
cleotides using in vitro and cellular models. We also
examined normal and malignant human tissue samples for
the expression of each telomerase subunit and correlated it
with telomerase activity.
MATERIALS AND METHODS
Chemicals
Dimethylsulfoxide, phorbol-12-myristate-13 acetate (PTA),
phenylmethanesulfonyl fluoride, and Wright and Trypan
blue dyes were from Sigma. Giemsa stain was from Aldrich,
and phytohaemagglutinin (PHA) and lipofectin reagent
were from Gibco BRL.
Oligonucleotides
The oligonucleotides used for PCR amplification are listed
in Table 1. The antisense oligonucleotide against the hTR
gene (anti-hTR) was designed to be complementary to the
template region sequences. Other antisense oligonucleo-
tides against TEP1 (anti-TEP1), hsp90 (anti-hsp90), p23
(anti-p23), dyskerin (anti-dkc) were designed to be comple-
mentary to the region )2 to +20 of the coding sequences.

All gene sequences were found in the GenBank database.
Non-specific oligonucleotides, designated as non-hTR, non-
TEP1, non-hsp90, non-p23, and non-dkc, having the same
base composition as the antisense oligonucleotides but with
different sequences, were used as controls. Oligonucleotides
used for transfection experiments were modified by phos-
phorothiolation. All oligonucleotides were from Genasia
Scientific Inc., Taipei, Taiwan.
Tissue samples, cell lines, and cell culture
Human tissues used for this study were from oral cancer
patients, admitted to Chang Gung Memorial Hospital of
Taiwan. Written consent was obtained before use of the
tissues in our experiments. For each patient, one sample
each of malignant tissue and normal mucosa were surgically
dissected and frozen immediately in liquid nitrogen until
used for molecular assay.
Cells used included oral cancer cell lines OECM1, OC2
[26], KB, the cervical cancer cell line HeLa, and the
leukaemia cell line HL-60. HL-60 cells were grown in
RPMI-1640 (Gibco BRL), while others were maintained in
Dulbecco’s modified Eagle’s medium (Gibco BRL). Both
media were supplemented with 10% fetal bovine serum and
antibiotics, and the cells were cultured in a humidified
atmosphere containing 5% CO
2
. Cultures from each cell
were harvested every 24 h and monitored for cell number by
counting cell suspensions with a haemocytometer. Cell
viability was determined by staining cells with 0.25%
Trypan blue, with the fraction of stain-negative cells taken

as the surviving fraction. In all experiments, the cell viability
rates were >75%.
Induction and assessment of differentiated HL-60 cells
Induction of differentiation in HL-60 cells was performed
either by treatment with 1.4% dimethylsulfoxide or with
100 ngÆmL
)1
TPA for up to 4 days. The differentiated
HL-60 cells were assessed by morphological change.
Induction with dimethylsulfoxide led to granulocytic differ-
entiation, which was assessed using Wright–l Giemsa stain.
Cells (5 · 10
4
) were prepared on slides by Cytospin
(Shandon Southern) and stained, then examined under a
light microscope (·1000). Granulocytic differentiation was
determined according to the presence of an eccentric or
segmented nucleus and the increase in the nucleus/
cytoplasm ratio. Induction with TPA led to monocytic
differentiation and attachment to the bottom of the culture
flask. For morphological assessment, the supernatant was
aspirated and the TPA-treated cells were examined with a
phase contrast microscope (·400). Monocytic cells were
identified by the presence of dendriform cytoplasm.
Isolation, culture, and activation of PBMC
Heparinized peripheral blood was drawn from normal
volunteer donors, and the PBMC were separated and
isolated from the interface of Ficoll-Hypaque (Pharmacia
Biotech). The isolated PBMC were washed three times with
Table 1. Names and the sequences of oligodeoxyribonucleotides used for

RT-PCR analysis.
Gene Name Sequences (5¢fi3¢)
Annealing
temperature
hTR F2b tccctttataagccgactcg 58 °C
R3c gtttgctctagaatgaacggtggaag
TEP1 TEP1.1 tcaagccaaacctgaatctgag 58 °C
TEP1.2 ccccgagtgaatctttctacgc
hTERT LT5 cggaagagtgtctggagcaa 56 °C
LT6 ggatgaagcggagtctgga
hsp90 hsp90-f tccttcgggagttgatctctaatgc 60 °C
hsp90-r gaattttgagctctttaccactgtccaa
p23 p23-f accagttcgcccgtccc 60 °C
p23-r ccttcgatcgtaccactttgcaga
Dyskerin dkc-f cctcggctgtggaccgg 60 °C
dkc-r aaataattacttccgcatccgcca
Actin actin-s gtggggcgccccaggcacc 58 °C
actin-a ctccttaatgtcacgcacgatttc
Ó FEBS 2002 Telomerase activity and the six subunits (Eur. J. Biochem. 269) 3443
HBSS solution (Gibco BRL) and resuspended at a
density of 2 · 10
6
cellsÆmL
)1
in RPMI-1640 supplemented
with 20% fetal bovine serum and antibiotics. PBMC
(1 · 10
6
cellsÆmL
)1

) were cultured in the presence or absence
of PHA (20 lLÆmL
)1
PBMC), and incubated at 37 °Cina
humidified atmosphere containing 5% CO
2
.
Transfection with antisense and nonspecific
oligonucleotides
For the transfection of HL-60 cells, cells were seeded at a
density of 2 · 10
6
per well in a six-well culture plate in
0.8 mL serum-free medium (SFM). Antisense or nonspecific
oligonucleotides in a final concentration of up to 0.7 l
M
and
20 lL of lipofection reagent in a total of 0.2 mL SFM were
mixed gently at room temperature for 45 min. The DNA
mixture was added to the HL-60 cells and incubated for
20 h at 37 °CinaCO
2
incubator. The culture medium was
then replaced with fresh complete RPMI and further
incubated for 3 days. For the transfection of PBMC, cells
were seeded at a density of 2 · 10
6
cellsÆmL
)1
in SFM,

followed by transfection with the DNA mixture as described
above. After DNA transfection, the culture medium was
replaced with fresh complete RPMI containing 20 lLÆmL
)1
PHA, and incubated for a further 3 days. Protocols for
transfection of other cells were similar as described above,
except that final concentrations of up to 0.7 l
M
oligonuc-
leotides and 15 lL lipofection reagent were used to
maintain cell viability.
Cellular protein extraction and analysis of telomerase
activity
Treated cells were suspended in a lysis buffer (10 m
M
Tris/
HCl, pH 7.5, 1 m
M
MgCl
2
,1m
M
EGTA, 0.5% Chaps,
10% glycerol, 0.1 m
M
phenylmethanesulfonyl fluoride and
5m
M
2-mercaptoethanol), and incubated for 30 min at
4 °C while being gently mixed. After centrifuging at

14 000 g for 30 min at 4 °C, the supernatants were trans-
ferred to fresh tubes for the telomerase activity assay.
Protein concentrations were determined using the Coomas-
sie Protein Assay Reagent (Pierce).
Assay of telomerase activity was performed by the
telomeric repeat amplification protocol-enzyme immunoas-
say (TRAP/EIA) as described previously [27]. Telomerase
activity was determined by the ability to produce telomere
repeats by a PCR-based TRAP assay and measuring the
PCR products using a EIA-based assay. Briefly, 0.3 lg
proteinextractwasaddedto30lL of the TRAP reaction
buffer and incubated at 25 °C for 15 min, followed by
amplification by 25 cycles of PCR at 94 °C for 30 s, 55 °C
for 30 s, and 72 °C for 1 min in a DNA Thermal Cycler.
After the PCR reactions, 5 lL of the PCR products were
dispensed into streptavidin-coated wells and incubated with
100 lL of antidigoxigenin antibody conjugated with horse-
radish peroxidase (10 mUÆmL
)1
) at room temperature for
60 min in an EIA reaction buffer. After washing, enzyme
reactions were initiated by the addition of 100 lLof
tetramethylbenzidine substrate solution to each well. Ten
min later, the reactions were stopped by the addition of
100 lL2
M
HCl to each well. Colorimetric signals were
determined by measuring the absorbance at 450 nm using
an automatic microwell reader.
RNA extraction and analysis of telomerase subunit genes

The expression of each of the telomerase subunit genes
(hTR, TEP1, hTERT, hsp90, p23 and dyskerin) were
analysed by using RT/PCR. Total RNA from cells or
tissues was isolated by using the TRIzol reagent (Gibco
BRL) following the manufacturer’s instructions. The con-
centration, purity, and amount of total RNA were deter-
mined by ultraviolet spectrophotometry.
The reverse transcription reaction was performed in a
total volume of 30 lL containing 30 ng RNA, 100 pmol
poly T oligonucleotide, 4 U avian myeloblastosis virus
reverse transcriptase (HT Biotech Ltd, UK), 10 U RNase
inhibitor (CalBiochem), and 25 m
M
dNTP at 42 °Cfor1h.
The number of PCR cycles was titrated to avoid reaching
the amplification plateau. PCR was performed with 30
cycles of denaturation at 94 °C for 40 s, annealing at 56–
60 °C for 40 s and extension at 72 °Cfor1minPCR
products were analysed by either 8% polyacrylamide or
1.5% agarose gel electrophoresis, stained with SyBr Green I
(Molecular Probes), then visualized and photographed by
illuminating with 254 nm UV.
RESULTS
Cellular changes in HL-60 cells after induction
of differentiation
Over 80% of the HL-60 cells remained viable over the entire
course of treatment with dimethylsulfoxide . The ratio of
differentiated cells (Fig. 1A and B) was estimated to be 25%
after 2 days of treatment and 70% after 4 days. After
4 days of treatment with 100 ngÆmL

)1
TPA, > 90% of the
HL-60 cells became attached to the flask and developed
dendriform cytoplasm, indicating successful induction
(Fig. 1C and D). Longer treatment led to cell death, with
an increased fraction of floating rather than attached cells.
Therefore, we harvested cells treated only for up to 4 days
for evaluation of telomerase activity and the subunit
expression studies.
hTERT expression after modulation of telomerase
activity
DMSO treatment led to a decrease in telomerase activity to
 70% of baseline after 1 day, 40% after 2 days, and
> 10% after 4 days (Fig. 2A). The expression of hTERT
was dramatically decreased after 1 day of treatment,
indicating that the hTERT subunit was significantly corre-
lated with the decrease in telomerase activity, and was
an earlier event than the change in holoenzyme acti-
vity.However, other telomerase components remained
unchanged during the entire course of treatment (Fig. 2B).
Similar results were found in the TPA-treated HL-60 cells.
Telomerase activity was gradually decreased over 4 days of
treatment, accompanied by diminished hTERT expression
but little change in other telomerase components (data not
shown). Both of these results indicate that hTERT is
the component primarily responsible for regulation of
telomerase activity.
As shown in Fig. 3, telomerase activity was up-regulated
after 8 h of PHA treatment of PBMC, reaching the highest
level at 2–4 days, and gradually decreasing after 4 days.

3444 J. Tung-Chieh Chang et al. (Eur. J. Biochem. 269) Ó FEBS 2002
hTERT expression increased with the increase in telomerase
activity, while expression of the other telomerase subunits
remained unchanged. This result further demonstrates that
hTERT is the major component responsible for the
regulation of telomerase activity.
Telomerase activity after blockade of telomerase
subunits
Antisense inhibition of each telomerase subunit was carried
out in vitro. In this experiment, 5–200 n
M
of each antisense
or nonspecific oligonucleotide was added to the TRAP
reaction buffer containing the protein extract from HL-60
cells. After brief incubation (5 min) on ice, the reaction
mixtures were subjected to telomerase activity assay as
described in Materials and methods. Telomerase activity
was inhibited by antisense oligonucleotides in a dose-
dependent manner (Fig. 4). For each gene treated with
antisense oligonucleotides at 200 n
M
, telomerase activity
was completely inhibited (< 5% of untreated control).
Treatment with 50 n
M
antisense oligonucleotides led to a
dramatic reduction of telomerase activity, to < 20% of the
untreated control, except for anti-dyskerin, which reduced
telomerase activity to only  60%. Treatment with 50 n
M

nonspecific oligonucleotides did not inhibit telomerase
activity, except for slight inhibition with non-TEP1 (to
80% of control values). A low dose (5 n
M
)ofantisense
oligonucleotides, resulting in lower levels of subunit inhibi-
tion, led to variable but significant effects on telomerase
activity for hTR, TEP1 and p23, whereas inhibition of
dyskerin had the least effect. From these antisense studies, it
appears that all of the telomerase subunits contribute to the
full activity of the holoenzyme, although dyskerin plays a
lesser role.
Transfection of HL-60 cells with anti-TEP1 led to a
specific inhibition of TEP1 (Fig. 5A). There was no obvious
effect on the expression of hTR after transfection of HL-60
cells with anti-hTR, as this antisense oligonucleotide was
designed to be complementary to the template region
sequence (Fig. 5A). Telomerase activity was gradually
decreased in cells transfected with specific antisense oligo-
nucleotides, to  60% after 2 days and to almost undetect-
able levels after 3 days (Fig. 5B). However, transfection
with nonspecific oligonucleotides had no effect on telom-
erase activity (Fig. 5B). For the effects of hTR and TEP1 on
the activation of telomerase, the model of stimulating
PBMC was applied. As shown in the Fig. 5C, the addition
of anti-hTR or anit-TEP1 to PHA-stimulated PBMC
resulted in significantly reduced activation of telomerase
after 48 h.
For the other cell lines studied (OECM1, KB, OC2, and
HeLa), inhibition of the various telomerase subunits (hTR,

TEP1, hsp90, p23 and dyskerin) with antisense oligonucleo-
tides resulted in a reduction of specific mRNA expression
(Fig. 6A) and inhibition of telomerase activity in a dose-
and time-dependent manner (partial results shown in
Fig. 6B). The exact effect of each antisense oligonucleotide
on telomerase activity varied according to the cell line. This
may have resulted from differing endogenous cellular
regulatory responses or differing transfection efficiency in
the various cell types. For example, OECM1 cells generally
showed more significant inhibition than other cells
(Fig. 6B). Nevertheless, inhibition of each telomerase sub-
unit caused a reduction of telomerase activity, suggesting
Fig. 1. Changes in cell morphology after
induction of differentiation of HL-60 cells by
dimethylsulfoxide and TPA. (A) HL-60 cells
cultured in RPMI for 3 days (control for B),
followed by cytospin analysis and staining
(·1000). (B) HL-60 cells treated with 1.4%
dimethylsulfoxide, followed by cytospin
analysis and staining (·1000). (C) HL-60 cells
in suspension after culture in RPMI for 3 days
(control for B) (·400). (D) HL-60 cells after
treatment with 100 ngÆmL
)1
TPA for 3 days,
attached to flask (·400) suspension and
photographed the attached cells.
Ó FEBS 2002 Telomerase activity and the six subunits (Eur. J. Biochem. 269) 3445
that each component plays a distinct role in the full enzyme
function.

Telomerase activity and the expression of each subunit
in normal and malignant tissues
In four pairs of normal and malignant tissue from oral
cancer patients, telomerase activity, as expected, was found
in all the malignant tissue samples but was absent in the
normal counterparts. Results of analysis of the expression of
each telomerase subunit are shown in Fig. 7. hTERT
expression correlated with telomerase activity, that is, it was
expressed in all telomerase-positive malignant tissue but was
undetectable in all telomerase-negative normal tissue. Other
telomerase subunits, however, were found to be more
constantly expressed in both normal and malignant tissue.
DISCUSSION
Telomerase activation is stringently repressed in normal
human somatic tissues but reactivated in immortal cells,
suggesting that up-regulation of telomerase participates
in cellular aging and oncogenesis. Therefore, understand-
ing telomerase regulatory mechanisms is valuable in
understanding tumour biology as well as in defining
molecular targets for clinical application. Thus far, six
major components of telomerase have been identified;
Fig. 2. Changes in telomerase subunits and telomerase activity in
response to induction of differentiation in HL-60 cells with dimethyl-
sulfoxide. HL-60 cells were treated with 1.4% dimethylsulfoxide for
4 days. Cells were harvested, and RNA and protein fractions were
extracted for subunit expressions and telomerase activity analysis.
(A) Relative telomerase activity on each day. (B) RNA expression of
telomerase subunits analysed by RT-PCR and resolved in 1.5%
agarose gel. Genes are listed on the left. Actin expression was analysed
as a control. See Materials and methods for experimental details.

Fig. 3. Activation of telomerase activity by stimulating PBMC with
PHA. (A) Relative telomerase activity on each day. (B) RNA
expression of telomerase subunits, analysed by RT-PCR and resolved
in 1.5% agarose gel. Genes are listed on the left. Actin expression was
analysed as a control. N, sample was not determined. See Materials
and methods for experimental details.
Fig. 4. In vitro analysis of changes in telomerase activity after intro-
duction of antisense or nonspecific oligonucleotides. Results are presented
as the means of duplicate experiments. Antisense oligonucleotides were
used at either 200, 50 or 5 n
M
, while nonspecific oligonucleotides were
used at 50 n
M
as indicated at the top of the figure. Relative telomerase
activity was obtained after comparing the control sample without
treatment with oligonucleotides. Telomerase activity was measured by
TRAP/EIA.
3446 J. Tung-Chieh Chang et al. (Eur. J. Biochem. 269) Ó FEBS 2002
except for hTR and hTERT, however, the roles of the
other subunits in enzyme function are still unclear. TEP1
protein is thought to be associated with hTR, as the N-
terminal region of TEP1 is homologous to the gene of
Tetrahymena telomerase component p80, which interacts
with telomerase RNA [9,10]. The WD40 repeats are found
in proteins involved in a wide variety of cellular processes
ranging from signal transduction to RNA processing [28].
Proteins containing WD repeats are often physically
associated with other proteins and are believed in many
cases to act as scaffolds upon which multimeric complexes

are built [29]. Recently, a novel protein containing WD40
repeats was cloned and found to be overexpressed in
breast cancer [30]. Moreover, a cytoplasmic ribonucleo-
protein complex Vaults also shares a common subunit of
TEP1 [31,32]. Therefore, TEP1 protein in telomerase may
play a role in ribonucleoprotein structure, assembly, or
may also be involved in cancer progression.
The essential roles of hTR and TEP1 in telomere length
maintenance and telomerase activity have been investigated
in vivo, using mouse embryonic stem cells lacking mouse
telomerase RNA or the mouse TEP1 (mTEP1) gene.
Functional analysis of mouse embryonic stem cells with-
out mouse telomerase RNA shows a lack of detectable
Fig. 6. Telomerase activity after introduction of antisense oligonucleo-
tides into various cells. Resultsarepresentedasthemeansoftwo
independent experiments. Antisense oligonucleotides at 0.2 l
M
(anti-
TEP1 or anti-hTR) or 0.5 l
M
(anti-hsp90, anti-p23 or anti-dyskerin)
were transfected into various cells and telomerase activity was meas-
ured after 2 days by TRAP/EIA. (A) OECM1 cells were transfected
with each antisense oligonucleotide and the expression of each
telomerase subunit gene was measured. Actin expression for each
treatment was determined as an mRNA control. C, Control sample,
with lipofectin transfection only; A, antisense transfected sample.
(B) Cells included OECM1, HeLa, KB, and HL-60, and OC2 as
indicated each at the top of the figure. Relative telomerase activity
was obtained by comparison with the untreated control sample.

Fig. 5. Telomerase activity after introduction of antisense oligonucleo-
tides. (A) Antisense oligonucleotides against either TEP1 (anti-TP1) or
hTR (anti-hTR) were transfected into HL-60 cells and TEP1 and hTR
expression was measured after 3 days by TRAP/EIA. Actin expression
for each treatment was determined as mRNA control. TEP1 expres-
sion was inhibited significantly by anti-TP1 treatment. The expression
of hTR has not much affected by anti-hTR, because this antisense
oligonucleotide was designed to be complementary to the template
region sequence. (B) Antisense oligonucleotides against either TEP1
(anti-TP1) or hTR (anti-hTR), or nonspecific oligonucleotides (non-
TP1 and non-hTR) were transfected into HL-60 cells and telomerase
activity was measured by TRAP/EIA cells 3 days later. (C) Telomerase
activity after introduction of antisense oligonucleotides into PHA-
stimulated lymphocytes. Ficoll-Hypaque isolated lymphocytes were
treated with PHA with or without anti-TP1 or anti-hRT and cultured
forupto48h.
Ó FEBS 2002 Telomerase activity and the six subunits (Eur. J. Biochem. 269) 3447
telomerase activity but maintenance of telomere length [33].
These results demonstrate the necessity for hTR in telom-
erase and suggest a telomerase-independent pathway in
maintaining telomere length. Our results of antisense
manipulation of the hTR subunit are in agreement with
this finding. Embryonic stem cells without mTEP1 reveal no
alteration in telomerase activity compared to wide-type
cells, suggesting a redundant role for mTEP1 [34]. When we
inhibited TEP1, however, there was complete inhibition of
telomerase activity in vitro and significant inhibition in cells,
indicating that this protein is required for full activity of the
telomerase. Several possibilities may explain this finding. In
the in vivo mouse model, mTEP1 may be associated with

only a fraction of the total telomerase activity, or other
telomerase-associated proteins may share a redundant role
with mTEP1, so that its disruption might have no overt
phenotypic consequence [34]. In our in vitro experiment,
because of the shortage of cellular salvage pathways and the
complete inhibition of TEP1 function by high concentra-
tions of antisense oligonucleotides, telomerase activity was
dramatically diminished. Alternatively, hTR and hTERT
may play a minimal catalytic activity in telomerase, while
the assembly of other telomerase subunits may amplify the
enzyme function. In this scenario, deletion of mTEP1 in
embryonic stem cells would have no effect on telomerase
activity, and the level may be sufficient for mouse develop-
ment. In our experiments, the relatively high levels of
telomerase present in cancer cell lines were significantly
decreased upon inhibition of TEP1 by antisense oligonu-
cleotides. A similar example can be found in transcription
factor TFIID. TFIID contains a core TFIID-binding
protein (TBP) plus several TBP-associated factors (TAFs).
TBP alone stimulates minimal transcriptional activity in the
TATA box region of the promoter, but when it is associated
with complete TAFs, it strongly facilitates transcriptional
activity [35]. Recently, an in vitro reconstitution study has
been reported to support this hypothesis. A reconstituted
complex of hTERT and hTR was detected by EMSA, and
its activity was stimulated more than 30-fold by the addition
of cell extract, indicating the presence of a cellular factor
contributing to the stimulatory effect of telomerase activity
[36].
Hsp90 and molecular chaperon p23 have been demon-

stratedtobindtohTERTandareconsideredtobe
telomerase subunits [13]. P23 was first identified as a
component of progesterone and glucocorticoid receptor
complexes [37]. Subsequently, it was found that p23 is
associated with hsp90 in these complexes and that the
presence of both molecules is required to maintain these
receptors in a ligand binding state [37]. These observations
led to the concept of a molecular chaperon machine or
foldosome that mediates assembly of a biologically active
protein complex. Similarly, hsp90 and p23 in the telom-
erase complex may also serve this foldosome function to
assemble the active holoenzyme. Geldanamycin, an hsp90
inhibitor, has been found to reduce the activity of
reconstituted telomerase in cell extracts, demonstrating
the role of hsp90 in the holoenzyme complex [36]. In our
in vitro and cellular study of antisense oligonucleotide
inhibition, blockage of hsp90 or p23 significantly decreased
telomerase activity, further supporting the inference that
these molecules play a role in the assembly of active
telomerase. Whether these molecules, like TEP1, have an
additional stimulatory effect on telomerase requires further
investigation. Antisense inhibition of dyskerin, although
showing comparable inhibition of telomerase function in
cells, exhibited a weaker inhibition of telomerase activity
in the in vitro assay. As dyskerin is believed to be involved
in hTR processing or assembly into the telomerase complex
[14], the weaker inhibition leads us to suspect that this
processing occurs at an earlier step of telomerase holoen-
zyme assembly.
The correlation of telomerase activity with the expression

of telomerase subunits hTERT, hTR and TEP1 has been
reported. Expression of hTERT, and less so of hTR or
TEP1, has been found to correlate with telomerase activity
in many cancer cells [17,18]. We further studied telomerase
activity in relation to the expression of hsp90, p23 and
dyskerin in human tissue samples and found no correlation.
These results indicate that hTERT is strongly associated
with telomerase activity while other components are more
constantly expressed in cells.
As described above, the experiments with ectopic expres-
sion of hTERT suggests that the level of hTERT in cells is a
rate-limiting component for the regulation of enzyme
activity. Nevertheless, these results still cannot rule out the
Fig. 7. Expressions of telomerase activity and the subunits in human
tissues. Four pairs of normal (N) and tumour (T) tissues from oral
cancer patients were examined. (A) Relative telomerase activity of each
sample compared to the OC2 cancer cell line. Telomerase activities are
determined by PCR/EIA. Each sample indicated as Ôpatient : tissueÕ
below each bar represents the specific patient and tissue. (B) The
expression of six telomerase subunits in the samples determined by
RT-PCR. Each sample is indicated at the top of the figure. Lane C
indicates the control experiment which contained all of the RT-PCR
reagents except tissue RNA. Six telomerase subunits were examined
by RT-PCR and are indicated at the left of the figure. See Materials
and methods for experimental details.
3448 J. Tung-Chieh Chang et al. (Eur. J. Biochem. 269) Ó FEBS 2002
necessity of other telomerase components for full activity of
the enzyme. In the present study, we demonstrated that
hTERT is a regulatable component and responsible for the
activation of telomerase, as it responded to environmental

stimulation in both up- and down-regulation models. The
other telomerase components retained expression at relat-
ively constant levels in both human tissue samples and cell
lines, and showed a lesser response to environmental
changes. In addition, our antisense experiments showed
that inhibition of any component could result in the
reduction of telomerase activity, suggesting that each
telomerase subunit is necessary for full enzyme activity.
We conclude that hTERT is a regulatable subunit, while the
other components are more constantly expressed. We
hypothesize that once hTERT is expressed, all of the other
telomerase subunits can be assembled to form a highly
active holoenzyme.
ACKNOWLEDGEMENTS
This work was supported by National Science Council Research Grant
NSC89-2314-B-182-068 of Taiwan and Chang Gung Medical Research
Grant CMRP869. We thank M. J. Buttrey for critical reading and
correction of the manuscript.
REFERENCES
1. Blackburn, E.H. (1991) Structure and function of telomeres.
Nature 350, 569–573.
2. Blackburn, E.H. (1992) Telomerase. Annu. Rev. Biochem. 61,
113–129.
3.Cheng,A.J.,Tang,R.,Wang,J.I.,See,L.C.&Wang,T.C.V.
(1998) Possible role of telomerase activation in the cancer predis-
position of patients with hereditary nonpolyposis colorectal can-
cers. J. Natl Cancer. Inst 90, 316–321.
4. Bacchetti, S. (1996) Telomere dynamics and telomerase activity in
cell senescence and cancer. Semin. Cell. Dev. Biol. 7, 31–39.
5. Cheng, A.J., Lin, J.D., Chang, T. & Wang, T.C.V. (1998) Telom-

erase activity in benign and malignant human thyroid tissues. Br.
J. Cancer 77, 2177–2180.
6. Tang, R., Cheng, A.J., Wang, J.Y. & Wang, T.C.V. (1998) Close
correlation between telomerase expression and adenomatous
polyp progression in multistep colorectal carcinogenesis. Cancer
Res. 58, 4052–4054.
7. Shay, J.W. & Bacchetti, S. (1997) A survey of telomerase activity
in human cancer. Eur. J. Cancer 33, 787–791.
8. Feng, J., Funk, W.D., Wang, S.S., Weinrich, S.L., Avilion, A.A.,
Chiu, C.P., Adams, R.R., Chang, E., Allsopp, R.C., Yu, J. et al.
(1995) The RNA component of human telomerase. Science 269,
1236–1241.
9. Collins, K., Kobayashi, R. & Greider, C.W. (1995) Purification of
Tetrahymena telomerase and cloning of genes encoding the two
protein components of the enzyme. Cell 81, 677–686.
10.Nakayama,J.,Saito,M.,Nakamura,H.,Matsuura,A.&
Ishikawa, F. (1997) TEP1: a gene encoding a protein component
of mammalian telomerase is a novel member of WD repeats
family. Cell 88, 875–884.
11. Meyerson, M., Counter, C.M., Eaton, E.N., Ellisen, L.W., Steiner,
P.,Caddle,S.D.,Ziaugra,L.,Beijersbergen,R.L.,Davidoff,
M.J., Liu, Q., Bacchetti, S., Haber, D.A. & Weinberg, R.A. (1997)
hEST2, the putative human telomerase catalytic subunit gene, is
up-regulated in tumor cells and during immortalization. Cell 90,
785–795.
12. Linger, J., Hughes, T.R., Shevchenko, A., Mann, M., Lundblad,
V. & Cheh, T.R. (1997) Reverse transcriptase motifs in the cata-
lytic subunit of telomerase. Science 276, 561–567.
13. Holt, S.E., Aisner, D.L., Baur, J., Tesmer, V.M., Dy, M.,
Ouellette, M., Trager, J.B., Morin, G.B., Toft, D.O., Shay, J.W.,

Wright, W.E. & White, M.A. (1999) Functional requirement of
p23 and hsp90 in telomerase complexes. Genes Dev. 13, 817–826.
14. Mitchell, J.R., Cheng, J. & Collins, K. (1999) A box H/ACA small
nuclear RNA-like domain at the human telomerase RNA 3¢ end.
Mol. Cell. Biol. 19, 567–576.
15. Mitchell, J.R., Wood, E. & Collins, K. (1999) A telomerase
component is defective in the human disease dyskeratosis con-
genita. Nature 402, 551–555.
16. Shay, J.W. & Wright, W.E. (1999) Mutant dyskerin ends
relationship with telomerase. Science 286, 2284–2285.
17. Nakayama, J., Tahara, H., Tahara, E., Saito, M., Ito, K.,
Nakamura, H., Nakanishi, T., Tahara, E., Ide, T. & Ishikawa, F.
(1998) Telomerase activation by hTRT in human normal fibro-
blasts and hepatocellular carcinomas. Nature Genet. 18, 65–68.
18. Dome, J.S., Chung, S., Bergemann, T., Umbricht, C.B., Saji, M.,
Carey, L.A., Grundy, P.E., Perlman, E.J., Breslow, N.E. &
Sukumar, S. (1999) High telomerase reverse transcriptase
(hTERT) messenger RNA level correlates with tumor recurrence
in patients with favorable histology Wilm’s tumor. Cancer Res. 59,
4301–4307.
19. Beattie, T., Shou, W., Robinson, M.O. & Harrington, L. (1998)
Reconstitution of human telomerase activity in vitro. Curr. Biol. 8,
177–180.
20. Bodnar, A.G., Ouellette, M., Frolkis, M., Holt, S.E., Chiu, C.P.,
Morin,G.B.,Harley,C.B.,Shay,J.W.,Lichtsteiner,S.&Wright,
W.E. (1998) Extension of life-span by introduction of telomerase
into normal human cells. Science 279, 349–352.
21. Counter, C.M., Meyerson, M., Eaton, E.N., Ellisen, L.W.,
Caddle, S.D., Haber, D.A. & Weinberg, R.A. (1998) Telomerase
activity is restore in human cells by ectopic expression of hTERE

(hEST2), the catalytic subunit of telomerase. Oncogene 16, 1217–
1222.
22. Hahn, W.C., Stewart, S.A., Brooks, M.W., York, S.G., Eaton, E.,
Kurachi, A., Beijersbergen, R.L., Knoll, J.H.M., Meyerson, M. &
Weinberg, R.A. (1999) Inhibition of telomerase limits the growth
of human cancer cells. Nature Med. 5, 1164–1170.
23. Zhang, X., Mar., V., Zhou, W., Harrington, L. & Robinson, M.O.
(1999) Telomere shortening and apoptosis in telomerase-inhibited
human tumor cells. Genes Dev. 13, 2388–2399.
24. Cheng, A.J., Liao, S.K., Chow, S.E., Chen, J.K. & Wang, T.C.V.
(1997) Differential inhibition of telomerase activity during induc-
tion of differentiation in hematopoietic, melanoma, and glioma
cells in culture. Biochem. Biophys. Res. Commun. 237, 438–444.
25. Sharma, H.W., Sokoloski, J.A., Perez, J.R., Maltese, J.Y.,
Sartorelli, A.C., Stein, C.A., Nichols, G., Khaled, Z., Telang, N.T.
& Narayanan, R. (1995) Differentiation of immortal cells inhibits
telomerase activity. Proc. Natl Acad. Sci. U.S.A. 92, 12343–12346.
26. Wong, D.Y.K., Chang, K.W., Chen, C.F. & Chang, R.C.S. (1990)
Characterization of two new cell lines derived from oral cavity
human squamous cell carcinomas-OC1 and OC2. J. Oral Max-
illofac. Surg. 48, 385–390.
27. Cheng, A.J., Tang, R., Wang, J.Y., Chang, J.T. & Wang, T.C.
(1999) Polymerase chain reaction-based enzyme immunoassay
for quantitation of telomerase activity: application to colorectal
cancers. Jpn J. Cancer Res. 90, 280–285.
28. Vander, V.L. & Ploegh, H.L. (1992) The WD-40 repeat. FEBS
Lett. 307, 131–134.
29. Neer, E.J., Schmidt, C.J., Nambudripad, R. & Smith, T.F. (1994)
The ancient regulatory protein family of WD-repeat proteins.
Nature 371, 297–300.

30. Matsuda, S., Katsumata, R., Okuda, T., Yamamoto, T.,
Miyazaki, K., Senga, T. et al. (2000) Molecular cloning and
characterization of human MAWD, a novel protein containing
WE-40 repeats frequently overexpressed in breast cancer. Cancer
Res. 60, 13–17.
Ó FEBS 2002 Telomerase activity and the six subunits (Eur. J. Biochem. 269) 3449
31. Kickhoefer, V.A., Stephen, A.G., Harrington, L., Robinson,
M.O. & Rome, L.H. (1999) Vaults and telomerase share a com-
mon subunit, TEP1. J. Biol. Chem. 274, 32712–32717.
32. Kickhoefer, V.A., Liu, Y., Kong, L.B., Snow, B.E., Stewart, P.L.,
Harrignton, L. & Rome, L.H. (2001) The telomerase/vault-asso-
ciated protein TEP1 is required for vault RNA stability and its
association with the vault particle. J. Cell. Biol. 152, 157–164.
33. Niida,H.,Shinkai,Y.,Hande,M.P.,Matsumoto,T.,Takehara,
S., Tachibana, M., Oshimura, M., Lansdorp, P.M. & Furuichi, Y.
(2000) Telomere maintenance in telomerase-deficient mouse
embryonic stem cells: characterizaiton of an amplified telomeric
DNA. Mol. Cell. Biol. 20, 4115–4127.
34. Liu, Y., Snow, B., Hande, M.P., Baerlocher, G., Kicihoefer, V.A.,
Yeung, D., Wakeham, A., Itie, A., Siderovski, D.P., Lansdorp,
P.M., Robinson, M.O. & Harrington, L. (2000) Telomerase-
associated protein TEP1 is not essential for telomerase activity or
telomere length maintenance in vivo. Mol. Cell. Biol. 20, 8178–
8184.
35. Burey, S.K. & Roeder, R.G. (1996) Biochemistry and structural
biology of transcription factor IID (TFIID). Ann. Rev. Biochem.
65, 769–799.
36. Masutomi, K., Kaneko, S., Hayashi, N., Yamashita, T., Shirota,
Y., Kobayashi, K. & Murakami, S. (2000) Telomerase activity
reconstituted in vitro with purified human telomerase reverse

transcriptase and human telomerase RNA component. J. Biol.
Chem. 275, 22568–22573.
37. Hutchison, K.A., Stancato, L.F., Owens-Grillo, J.K., Johnson,
J.L., Krishna, P., Toft, D.O. & Pratt, W.B. (1995) The 23-kDa
acidic protein in reticulocyte lysate is the weakly bound compo-
nent of the hsp foldosome that is required for assembly of the
glucocorticoid receptor into a functional heterocomplex with
hsp90. J. Biol. Chem. 270, 18841–18847.
3450 J. Tung-Chieh Chang et al. (Eur. J. Biochem. 269) Ó FEBS 2002