Báo cáo khoa học: CmtR, a cadmium-sensing ArsR–SmtB repressor, cooperatively interacts with multiple operator sites to autorepress its transcription in Mycobacterium tuberculosis pptx

CmtR, a cadmium-sensing ArsR–SmtB repressor,
cooperatively interacts with multiple operator
sites to autorepress its transcription in
Mycobacterium tuberculosis
Santosh Chauhan, Anil Kumar, Amit Singhal, Jaya Sivaswami Tyagi and H. Krishna Prasad
Department of Biotechnology, All India Institute of Medical Sciences, Ansari Nagar, New Delhi, India
All organisms require metal ions as cofactors for
several enzymatic reactions. The physiological concen-
trations of metal ions are maintained by the coordi-
nated action of a family of intracellular metal-sensing
and transporter proteins [1,2]. One such family of
metal-sensor proteins (SmtB ⁄ ArsR) functions exclu-
sively as transcriptional repressors by regulating intra-
cellular metal ion concentrations under conditions of
surplus metal ions [2]. These repressors sense di- and
multivalent heavy metal ions and regulate the expres-
sion of gene(s) encoding protein(s) that specifically
expel or chelate metal ion(s) [2]. These metalloregula-
tory repressors bind the operator ⁄ promoter DNA
regions in operons regulated by stress-inducing concen-
trations of heavy metal ions. Protein binding to the
operator ⁄ promoter DNA is strongly inhibited by metal
binding to the sensing apoprotein. A number of these
metal-responsive transcriptional regulatory proteins
have been described in a variety of microbes, namely
SmtB, a Zn
2+
-responsive transcriptional repressor in
Keywords
ArsR–SmtB repressor; autoregulation;
CmtR; metalloregulatory repressors;

Rv1994c
Correspondence
H. K. Prasad, TB Immunology Laboratory,
Department of Biotechnology, All India
Institute of Medical Sciences, New Delhi
110029, India
Fax: +91 11 26589286
Tel: +91 11 26594994
E-mail:
J. S. Tyagi, TB Molecular Biology
Laboratory, Department of Biotechnology,
All India Institute of Medical Sciences,
New Delhi 110029, India
Fax: +91 11 26588663
Tel: +91 11 26588491
E-mail:
(Received 27 January 2009, revised 4 April
2009, accepted 20 April 2009)
doi:10.1111/j.1742-4658.2009.07066.x
CmtR is a repressor of the ArsR–SmtB family from Mycobacterium tuber-
culosis that has been shown to sense Cd(II) and Pb(II) in Mycobacte-
rium smegmatis. We establish here that CmtR binds cooperatively to
multiple sites in M. tuberculosis DNA and protects an unusually long
90 bp AT-rich sequence from )80 bp to +10 with respect to its own
initiation codon. CmtR interacts with four hyphenated imperfect inverted
repeats matching the consensus sequence TA ⁄ GTAA-N
4–5
-TT ⁄ GATA in
the protected region. SDS–PAGE and formaldehyde crosslinking experi-
ments showed that CmtR forms higher-order oligomers (up to an octamer).

The oligomerization of CmtR is in agreement with the cooperative binding
of CmtR to multiple sites on DNA. Two promoters transcribe cmtR, and
the major promoter physically overlaps with CmtR binding sites.
Autorepression of CmtR is mediated by cooperative interaction of CmtR
with multiple sites on DNA that occlude the major operon promoter. The
combined results of a GFP reporter assay, an electromobility shift assay
and a DNase I footprinting experiment establish that Cd(II), not Pb(II),
disrupts the interaction of CmtR with DNA to de-repress transcription of
the cmtR–Rv1993c–cmtA operon in M. tuberculosis.
Abbreviations
EMSA, electromobility shift assay; TSP, transcription start point.
3428 FEBS Journal 276 (2009) 3428–3439 ª 2009 The Authors Journal compilation ª 2009 FEBS
Synechococcus species [3], ArsR in Escherichia coli [4],
ZiaR in Synechocystis species [5], MerR in Streptomy-
ces lividans [6] and CadC in Staphylococcus aureus [7].
Mycobacterium tuberculosis, a versatile pathogen, sur-
vives in a variety of harsh environmental conditions
including the phagosome of the mammalian host cell.
Inside the phagosome, M. tuberculosis must adapt to
metal fluxes and modulate the expression of genes
involved in metal detoxification and efflux. Ten putative
SmtB ⁄ ArsR metal sensors have been identified in the
M. tuberculosis genome [8], of which three – namely
NmtR [9], CmtR [10–12] and KmtR [13] – have been
partially characterized. CmtR from M. tuberculosis is a
winged helical DNA-binding repressor that was shown
to sense cadmium and lead in the surrogate host Myco-
bacterium smegmatis and is proposed to bind a single
25 bp site in the cmtR operator ⁄ promoter region in the
apo-form [10]. The cadmium–CmtR complex and apo-

CmtR were both shown to exist as a homodimer [12].
CmtR was also shown to be upregulated (approximately
threefold) upon entry into macrophages [14].
Cadmium is present as an air pollutant and in ciga-
rette smoke [15]. Cadmium is known to accumulate in
human aleovolar macrophages [15]. M. tuberculosis
may be exposed to toxic concentrations of cadmium in
macrophages. As CmtR senses cadmium, it may mod-
ulate the expression of genes involved in detoxification
and efflux of this toxic metal from the mycobacterium.
Here we demonstrate through electromobility shift
assay (EMSA) and DNase I footprinting that CmtR
cooperatively interacts with multiple binding sites and
protects a 90 bp sequence in the CmtR operator ⁄ pro-
moter region. Consistent with these data, we show here
that CmtR exists as multimers under non-reducing
conditions. The combined results from EMSA, DNase
I footprinting, transcription start point (TSP) mapping
and a GFP reporter assay showed that CmtR represses
its transcription by promoter occlusion, and that
Cd(II) dislodges CmtR from the operator ⁄ promoter to
de-repress transcription of the cmtR–Rv1993c–cmtA
operon.
Results
Co-transcription of cmtR, Rv1993c and cmtA in
M. tuberculosis
cmtR is located in the proximity of Rv1993c and
Rv1992c ⁄ cmtA ⁄ ctpG in the M. tuberculosis genome
(Fig. 1A). cmtR was previously shown to be co-tran-
scribed with Rv1993c and cmtA in M. bovis [10]. To

establish that cmtR, Rv1993c and cmtA are co-tran-
scribed and constitute an operon in M. tuberculosis,
RT-PCR was performed with logarithmic-phase RNA
using primers 94RTf and 94RTr (Fig. 1A). The antici-
pated PCR product of 330 bp was detected (Fig. 1B,
lane 2).
Purification of recombinant CmtR protein
M. tuberculosis CmtR protein with an N-terminal
hexahistidine tag (His-CmtR) was overexpressed in
cmtR
Rv1995
156 bp
Rv1993cRv1992c/cmtA/ctpG
94RTf 94RTr
123
330 bp
16
12.5
12
anti-CmtR
Dimer
Dimer
12
anti-His
16
Dimer
Trimer
A
B
C

D
Fig. 1. (A) Schematic representation of the cmtR–1993c–cmtA gene locus in M. tuberculosis. (B) Co-transcription of cmtR–1993c–cmtA
genes in M. tuberculosis. RT-PCR products of RNA from cultures of M. tuberculosis H37Rv were amplified using primers 94RTf and 94RTr.
Lane 1, negative control (without reverse transcriptase); lane 2, cDNA; lane 3, genomic DNA (amplification control). (C) Immunoblot analysis
of purified CmtR. Nitrocellulose blots were probed using anti-CmtR (C) and anti-His (D) serum. Lane 1, His-CmtR; lane 2, CmtR. Dimer and
trimer species are indicated by arrowheads. The molecular mass of bands (in kDa) as predicted based on the use of a protein molecular
mass marker is indicated.
S. Chauhan et al. Autoregulation by CmtR
FEBS Journal 276 (2009) 3428–3439 ª 2009 The Authors Journal compilation ª 2009 FEBS 3429
E. coli. The fusion protein was purified by Ni-chelate
affinity chromatography, and was determined to be
approximately 16 kDa in western blots developed
with anti-CmtR serum or anti-His monoclonal IgG
(Fig. 1C,D, lane 1). The histidine tag of His-CmtR
was removed using recombinant Tobacco etch virus
(rTEV) protease to give a protein of approxi-
mately 12.5 kDa, CmtR (Fig. 1C, lane 2). Further-
more, proteins corresponding to dimers (32 and
25 kDa) and a trimer (48 kDa) were also detectable
(Fig. 1C,D).
Mapping of in vivo transcription initiation sites
Two TSPs were identified upstream of cmtR by
primer extension analysis (Fig. 2A). The major primer
extension product (T1
cmtR
) was identified, starting
with the ‘G’ nucleotide located 34 bp upstream of the
CmtR translational start site (Fig. 2A,B). Another
primer extension product (T2
cmtR

), which was rela-
tively weak, was also identified, starting with the ‘G’
nucleotide located 111 bp upstream of CmtR transla-
tional start site (Fig. 2A,B). The putative )10
promoter elements identified upstream of T1
cmtR
(con-
served at five of the six positions) and T2
cmtR
(conserved at three of the six positions) showed a
resemblance to the SigA )10 element (Fig. 2B), but
)35 elements of both the promoters were modestly
conserved (two of the six positions, SigA consensus
sequence TTGACW-N
17
-TATAMT where W = A ⁄ T,
M=A⁄ C [16]).
CmtR interacts with a 90 bp sequence spanning
the translational start site
To map the CmtR binding site precisely, DNase I
footprinting was performed using purified CmtR and
315 bp of DNA that includes the sequence from
)191 bp to +124 bp with respect to the translational
start site of CmtR. An unusually long 90 bp protected
region was observed, which spans )80 bp to +10 bp
with respect to translational start site of CmtR (Figs 3
and 4A). This result suggests that CmtR binds to mul-
tiple sites and may interact as a functional multimer in
the operator ⁄ promoter region. Two strong hypersensi-
tive sites were observed at intervals of 18 bp from the

3¢ end of the footprint (Fig. 3), suggesting that this
region of DNA is bent or distorted upon CmtR
binding. The T1
cmtR
TSP exactly overlaps the CmtR
binding site, and T2
cmtR
is present upstream of the
CmtR binding site (Fig. 4A), which indicates that
CmtR represses the cmtR–Rv1993c–cmtA operon by
obstructing contact between the RNA polymerase and
the promoter sequence.
CmtR cooperatively interacts with multiple sites
in the cmtR promoter region
A close examination of the CmtR protected sequence
revealed four hyphenated inverted repeats matching con-
sensus sequence TA ⁄ GTAA-N
4-5
-TT ⁄ GATA (Fig. 4A,B),
which could be the binding site of CmtR. EMSA
assays were performed with various size fragments of
CmtR
Rv1995
–10
T2
cmtR (+1)
–10 –35 –35
A
T1
cmtR

T2
cmtR
T1
cmtR (+1)
GC T 1
A
B
Fig. 2. TSP mapping. (A) Primer extension
of M. tuberculosis RNA isolated from an
aerobic culture (lane 1). Two TSPs were
mapped. The experiment was repeated with
the same results using two different sam-
ples of RNA. The results of dideoxy
sequencing reactions using the same primer
are shown on the left. (B) Sequence encom-
passing both TSPs and the putative )10 and
)35 promoter sequences.
Autoregulation by CmtR S. Chauhan et al.
3430 FEBS Journal 276 (2009) 3428–3439 ª 2009 The Authors Journal compilation ª 2009 FEBS
the operator ⁄ promoter region to assess CmtR binding
to these sites (Fig. 5A). Four differently migrating
DNA–protein complexes were observed (C1, C2, C3
and C4) when the EMSA was performed with the larg-
est F-1 fragment ()191 to +124 bp with respect to
translational start site of CmtR, Fig. 5B), which may
represent binding of CmtR to four different sites
(labeled as sites 1, 2, 3 and 4, Fig. 4A). Interestingly,
at least three of these complexes appeared at the low-
est CmtR concentration (Fig. 5B), indicating that
CmtR has high affinity for these sites. This was consis-

tent with the nearly complete protection observed even
at the lowest protein concentration in DNase I foot-
printing. Cooperativity in binding can be assessed from
the breadth of transition on a log plot. For non-coop-
erative interactions, an increase of 1.81 log units in
protein concentration is required to increase the bound
fraction from 10% to 90% [17]. Positive cooperativity
reduces this span; an increase of 0.5 log units of CmtR
protein concentration (480 nm to 2.4 lm, Fig. 5B)
increased the total bound fraction from 10% to 90%
(Fig. 5C), which shows a cooperative interaction of
CmtR with the cmtR operator ⁄ promoter region. The
DNA–protein complexes were specific as they dissoci-
ated in the presence of an excess of cold probe and
were conserved in the presence of an excess of non-
specific DNA [poly(dI-dC), Fig. 5F].
To map CmtR binding sites within the 90 bp pro-
tected region, EMSA was performed with a smaller
fragment F-2 ()67 to +124 bp relative to the CmtR
translational start site) that lacks 13 bp from the 5¢
end of the 90 bp CmtR protected sequence and also
the first half of site 1 (Figs 4A and 5A). Only three
DNA–protein complexes (C2, C3 and C4) were
observed (Fig. 5D), suggesting that deletion had indeed
disrupted one of the binding sites. EMSA with the F-3
fragment ()33 to +124 bp), which include sites 3 and
4, showed only two retarded complexes (C3 and C4)
(Fig. 5E). Previously, it was shown that CmtR binds
to a single site in the region that spans )33 to )9bp
[10], which includes site 3 and part of site 4 (Fig. 4A).

Taken together, the results show that CmtR interacts
with four binding sites in the 90 bp protected region,
which corresponds fairly well to four predicted binding
sites in this region. To establish that the predicted sites
are genuine CmtR binding sites, we performed EMSA
with oligonucleotides of approximately 20 bp carrying
the predicted binding sites 1–4 (Fig. 5G). The EMSA
results clearly show that CmtR protein interacts with
each of these binding sites, but with low affinity. No
interaction was observed with non-specific oligonucleo-
tide (Fig. 5G). The decreased affinity of CmtR to
DNA (carrying individual sites) could be attributed to
a loss of cooperativity.
CmtR forms dimer and higher-order oligomers
Several repressors, e.g EthR [18] and RstR [19] that
bind at tandem sites, interact as multimers. CmtR
interacts with multiple binding sites in the opera-
tor ⁄ promoter region. Two experiments were performed
to examine the oligomeric status of CmtR. First,
SDS–PAGE analysis of soluble His-CmtR under non-
reducing condition shows that it forms dimers (approx-
imately 32 kDa) and higher-order oligomers
(Fig. 6A,B). Bands corresponding to positions up to
an octamer (approximately 48, 64, 80, 96, 112 and
128 kDa) were detected in western blots probed with
anti-His (lane 2, Fig. 6A) and anti-CmtR serum (data
not shown). Similar results were obtained when CmtR
from which the His tag had been removed was used
(not shown). Under reducing conditions, only mono-
mers and dimers of CmtR were observed. Interestingly,

CmtR is partially dimeric even in the presence of
*
TA G C
CmtR
2.4
0
4.8
12
7.2
9.6
T2
cmtR
T1
cmtR
ATG
(µM)
Fig. 3. CmtR interacts with a 90 bp sequence in the cmtR–Rv1995
intergenic region. DNase I footprinting was performed using cmtR–
Rv1995 intergenic DNA (a 315 bp fragment amplified using primers
P6 and 1994intR; the cmtR non-coding strand was labeled) and
increasing concentrations of CmtR protein. Arrowheads (right side)
indicate the hypersensitive sites and the protected region is indi-
cated by a black box. The results of dideoxy sequencing reactions
using the same primer and DNA template are also shown. Asterisk
indicates the strand which is labelled.
S. Chauhan et al. Autoregulation by CmtR
FEBS Journal 276 (2009) 3428–3439 ª 2009 The Authors Journal compilation ª 2009 FEBS 3431
20 mm dithiothreitol (Fig. 6B) or 7.5% b-mercapto-
ethanol (Fig. 6A). Second, a formaldehyde crosslinking
experiment was performed to confirm the oligomeriza-

tion of CmtR. Although not all oligomeric states were
observed, bands corresponding to the position of a
dimer (approximately 32 kDa) and an octamer
(approximately 128 kDa, Fig. 6C) were apparent,
showing that CmtR has an inherent ability to form
oligomers.
CmtR is a Cd sensing repressor in M. tuberculosis
It has previously been shown that M. tuberculosis
CmtR is a cadmium- and lead-sensing repressor in the
surrogate host M. smegmatis [10]. In order to establish
which metal ion(s) the cmtR promoter is responsive to,
a 212 bp DNA fragment (P6–P3 region, Fig. 4) with
156 bp of the cmtR–Rv1995 intergenic region was
fused to a promoterless GFP gene in plasmid pFPV27
to give pCmtR, and electroporated into M. tuberculosis
H37Rv. The culture was grown to mid-logarithmic
phase (attenuance at 595 nm of approximately 0.3),
and subsequently diluted to an attenuance at 595 nm
of 0.1. Metal ions CdCl
2
, NiCl
2
, CoCl
2
and Pb(NO
3
)
2
were added to the culture at maximum permissive con-
centrations as used previously [10]. No inhibition of

growth was observed in the presence of any of the
metal ions used (Fig. 7A, inset). Increased GFP flores-
cence (approximately 2.5-fold) was observed on addi-
tion of Cd(II) but not with any other metal ion tested
(Fig. 7A). This shows that CmtR senses only Cd(II)
but not Pb(II) in M. tuberculosis.
CmtR
(+1)
Rv1995
P6
P4
1994 intR
P3
(–43)
–10 –35
–10
T2
cmtR
T1
cmtR
P8
Site 1 Site 2
Site 3 Site 4
–35
–10
–35
–10
–35
cmtR
Rv1995

T1 (+1)
T2 (+1)
(–43)
1234
(+47)
(+47)
(+1)
A
B
C
Fig. 4. (A) Nucleotide sequence and salient
features of the cmtR–Rv1995 intergenic
region. The TSPs (T1
cmtR
and T2
cmtR
) are
indicated by angled arrows. The putative
)10 and )35 promoter elements are indi-
cated by dashed boxes. The CmtR DNase I-
protected sequence ()43 to +47 bp) is
boxed. Full arrows indicate the CmtR recog-
nition sites 1, 2, 3 and 4. The positions of
primers are indicated by half-headed arrows.
The arrowheads indicate hypersensitive
sites. (B) The sequences of four putative
CmtR binding sites and the consensus
sequence with which CmtR may interact.
(C) Detailed map of the intergenic region.
The four CmtR binding sites (1, 2, 3 and 4)

are indicated by white boxes within the
90 bp CmtR recognition sequence (gray
box). The TSPs mapped in this study are
shown by angled arrows. The putative )10
and )35 promoter elements are indicated by
small black boxes. Primers P3 and P6 were
used to amplify the cmtR promoter DNA
cloned in GFP reporter vector. DNase I foot-
printing was performed using P6 and the
1994intR amplicon. Primers P6, P4, P8 and
1994intR were used for EMSA.
Autoregulation by CmtR S. Chauhan et al.
3432 FEBS Journal 276 (2009) 3428–3439 ª 2009 The Authors Journal compilation ª 2009 FEBS
Cadmium disrupts the CmtR–DNA
sequence-specific interaction
The effect of metal ions on in vitro binding of CmtR
to the operator ⁄ promoter region was determined using
DNase I footprinting and a gel shift assay. Ni(II),
Co(II) and Pb(II) were not able to dissociate the com-
plex even at high concentrations of 500, 200 and
50 lm, respectively (Fig. 7B), whereas Cd(II) disrupted
the interaction of CmtR with DNA (Fig. 7B,C).
% DNA bound
[CmtR] µM
0.01 0.1 1 10
0
10
20
30
40

50
60
70
80
90
100
C1
C2
C3
F
0.12
0
0.24
0.36
0.48
0.60
0.72
0.84
0.96
1.08
1.2
1.8
2.4
3.0
3.6
4.8
5.4
6.0
(µM)
CmtR

C4
12345678 9101112131415161718
F-1
CmtR
123456 78910
C2
C3
F
C4
0.1
0
0.2
0.3
0.4
0.6
0.7
0.8
1.0
1.2
F-2
C3
C4
F
0.12
0
0.24
0.48
0.84
1.2
2.4

3.6
4.8
5.4
6.0
CmtR
1 2 34567891011
F-3
F-1 (315 bp, –191 to +124)
F-2 (191 bp, –67 to +124)
F-3 (157 bp, –33 to +124)
CmtR
12 34
234
34
P8
1994intR
P4
P6
T1
12345
Site 2
Site 1 Site 3 Site 4
123 123 123 123 123
Control
A
BC
D
GF
E
(µM)

(µ
M)
Fig. 5. CmtR binds cooperatively to multiple sites in the cmtR promoter region. (A) Various fragments used in EMSA. Angled arrows indi-
cate the CmtR TSP and the ATG site. Primers used to amplify fragments are indicated by half-headed arrows. The putative CmtR binding
sites (1, 2, 3, and 4) are indicated. (B)
32
P-labeled cmtR promoter DNA F-1 was incubated in the absence (lane 1) or presence (lanes 2–18)
of increasing concentrations of CmtR protein. The arrowhead indicates the position of free DNA, and the arrows indicate the DNA–protein
complexes. The arrow within the gel indicates the position of DNA–protein complex 2. (C) The fraction of bound F-1 DNA (estimated by
subtracting free DNA from input DNA, Fig. 1A) versus CmtR concentration was plotted using
SIGMAPLOT 2001 (www.sigmaplot.com). (D, E)
32
P-labeled F-2 (D) and F-3 (E) fragments were incubated in the absence (lane 1) or presence (lanes 2–10 ⁄ 11) of increasing concentrations of
CmtR protein (l
M). (F) A competition assay was performed with the F-1 fragment and 3 lM of CmtR with no competitor (lane 2), with 50 ·
non-specific competitor [poly(dI-dC), lane 3], or with 10· (lane 4) and 50· (lane 5) self-competitor; lane 1 contains labeled DNA only. (G)
EMSA was performed with approximately 20 bp double-stranded DNA carrying or not carrying (control) a CmtR binding site (1, 2, 3 and 4) in
the absence (lane 1) and presence of 1 l
M (lane 2) or 2 lM (lane 3) of CmtR protein. Control, 38 bp double-stranded DNA known to bind to
the DevR protein of M. tuberculosis (unpublished result).
S. Chauhan et al. Autoregulation by CmtR
FEBS Journal 276 (2009) 3428–3439 ª 2009 The Authors Journal compilation ª 2009 FEBS 3433
DNase I footprinting in the presence of metal ions
confirmed that the site-specific interaction of CmtR
was only dislodged by Cd(II). Together, the in vitro
interaction studies and in vivo reporter assay shows
that Cd(II) dissociates bound CmtR from DNA to
de-repress transcription from the cmtR promoter.
Discussion
Intracellular concentrations of metals can be toxic to

bacteria; therefore their uptake is tightly regulated by
metal-dependent transcription regulators. CmtR is a
Cd(II)-sensing repressor that may regulate genes
involved in reducing the intracellular level of Cd(II).
We demonstrate here by DNase I footprinting and
EMSA that CmtR interacts cooperatively with multiple
binding sites that span 90 bp of sequence up- and
downstream of its own translational start site ()80 to
+10 bp). Our results show that CmtR interacts with
four imperfect hyphenated inverted repeats matching
the consensus sequence TA ⁄ GTAA-N
4-5
-TT ⁄ GATA.
Previously, on the basis of EMSA results, Cavet et al.
(2003) proposed that CmtR may interact with a single
degenerate 10-5-10 hyphenated inverted repeat [10];
however, no such instance of this predicted site was
observed within the 90 bp CmtR protected sequence as
shown in Fig. 4. However, this binding site does not
resemble the sites described in the current study. In
the EMSA assays performed by Cavet et al., the
DNA–protein complexes were visualized by ethidium
bromide staining [10], which is less sensitive compared
to the radiolabeling and imaging techniques used in the
present study. Hence they may not have visualized the
multiple DNA–protein complexes observed in the pres-
ent study. In addition, DNase I footprinting experi-
ments show that CmtR binds to an extended 90 bp
DNA sequence compared to the 25 bp sequence
proposed by Cavet et al. (2003). To our knowledge,

this is the first report of an ArsR–SmtB family repres-
sor producing an exceptionally long footprint on DNA
and interacting with multiple sites. Most of the
SmtB ⁄ ArsR repressors have been proposed to recog-
nize one or two degenerate AT-rich inverted repeats in
their operator ⁄ promoter region [20–22]. ZntR, a
SmtB ⁄ ArsR family repressor, has been proposed to
interact with a hyphenated 9-2-9 inverted repeat (ATA
TGAACA-AA-TATTCATAT) within the 49 bp of
protected DNA [20]. SmtB has been proposed to inter-
act with two hyphenated imperfect inverted repeats
(6-2-6, TGAACA-GT-TATTCA and 7-2-7, CTGAA
TC-AA-GATTCAG) in the smtB operator ⁄ promoter
region [22].
Primer extension analysis identified two TSPs for
cmtR. The major TSP (T1
cmtR
) and the putative )10
and )35 promoter elements completely overlap the
CmtR binding sites, and the other TSP (T2
cmtR
)is
present upstream of the CmtR binding sites. This
architecture of the promoter suggests that the interac-
tion of the RNA polymerase is hindered by the
14
29
100
M
50

60
70
200
Monomer
Dimer
Trimer
Tetramer
Pentamer
Hexamer
12
Heptamer
Octamer
14
29
97
Monomer
Dimer
Higher oligomer
(~octamer)
123M
Monomer
Dimer
Higher
oligomer
Trimer
Tetramer
12345
A
B
C

Fig. 6. CmtR forms oligomers. Western blot analysis of His-CmtR
probed with anti-His serum. CmtR was boiled in sample buffer in
(A) the absence (lane 2) or presence of 7.5% b-mercaptoethanol
(lane 1), or (B) the absence (lane 1) or presence of increasing con-
centrations of dithiothreitol (1, 5, 10 and 20 m
M, lanes 2–5, respec-
tively) and resolved on 12% SDS–PAGE. (C) A crosslinking
experiment with CmtR was performed in the absence (lane 1) or
presence (lanes 2 and 3) of 0.1% formaldehyde. Lanes 1 and 3
contain 30 lg of CmtR, and lane 2 contains 20 lg of CmtR. ‘M’
represents molecular mass markers in kDa.
Autoregulation by CmtR S. Chauhan et al.
3434 FEBS Journal 276 (2009) 3428–3439 ª 2009 The Authors Journal compilation ª 2009 FEBS
binding of CmtR, resulting in repression of the
cmtR–Rv1993c–cmtA operon.
The CmtR binds cooperatively to multiple sites in a
stepwise manner (in the EMSA). CmtR oligomers up
to an octamer were observed. Hence, it may be possi-
ble that CmtR oligomerizes in a stepwise manner on
DNA as has been reported for other repressors [18,19].
All repressors of the SmtB ⁄ ArsR family, e.g. CadC,
SmtB and ArsR [23–25], have been shown to exist as
homodimers. The formation of higher oligomers has
not been observed previously among SmtB ⁄ ArsR fam-
ily repressors, but is not uncommon for repressors gen-
erally. This property may allow the repressors to
efficiently mask the promoter from RNA polymerase.
CmtR was previously shown to exist as a dimer, but
as dithiothreitol was used (1-5 mm) during protein
purification and anaerobic conditions were used during

further experimentation [11,12], it is possible that
reducing conditions may have disrupted the higher-
order oligomers to produce the dimers observed here
(Fig. 6B). CmtR has six cysteine residues, Cys4,
Cys24, Cys35, Cys57, Cys61 and Cys102, of which
Cys57, Cys61 and Cys102 bind cadmium ions [11,12]
and were shown to be important for cadmium-depen-
dent activation [10]. Mutation of Cys24 of CmtR made
the repressor non-functional, indicating that this resi-
due may be involved in oligomerization of CmtR.
Our in vivo GFP reporter assay suggests that CmtR
binds to Cd(II) and induces cmtR expression in
M. tuberculosis by derepression. This is in partial
agreement with a previous report that Cd(II) and
Pb(II) can both act as an inducer of cmtR in
M. smegmatis [10]. Our in vitro experiments (EMSA
and DNase I footprinting) also support the in vivo
results, where the sequence-specific interaction was
abolished by Cd(II) at physiological concentration
(5 lm), but not by Pb(II) even at higher concentra-
tions (50 lm). The dissociation of the DNA–protein
100
200
300
400
500
600
700
24 48 72 120 144 168
Time (h)

RFU/Attenuance
595
Control
A
B C
Cd Pb Ni Co
0.1
0.5
0.9
0 48 96 144
Time (h)
Attenuance
595
CmtR
– + + + + +
Metal ion
– –
Ni Cd Co Pb
CmtR
– +
Metal ion
– –
Cd Pb
+ + + + + + + +
F
1 2 3 4 5 6 7 8 9 10
Fig. 7. (A) CmtR is a Cd-sensing repressor
in M. tuberculosis. CmtR-directed GFP fluo-
rescence in aerobic shaken M. tuberculosis
cultures in the absence (control) or presence

of metal ions (Ni, Cd, Co and Pb) at
maximum permissive concentrations. GFP
fluorescence is expressed as relative
fluorescence unit (RFU) ⁄ attenuance after
background subtraction. The mean values
for two independent experiments are plot-
ted. Growth curves for all the strains are
shown in the inset. The metal ions were
added to the culture when the attenuance
at 595 nm was 0.1, and GFP fluorescence
was measured at 24 h intervals. (B) DNase I
footprinting was performed using fragment
F-1 and 2.4 l
M CmtR protein in the absence
and presence of metal ions as indicated.
Ni(II), Cd(II), Co(II) and Pb(II) were added at
concentrations of 500, 5, 200 and 50 l
M,
respectively. (C) EMSA with fragment F-2
and CmtR protein (3 l
M) in the absence
(lane 2) or presence of increasing concentra-
tions of Cd(II) (1, 2.5, 5 and 10 l
M, lanes
3–6, respectively) and Pb(II) (5, 10, 20 and
40 l
M, lanes 7–10, respectively).
S. Chauhan et al. Autoregulation by CmtR
FEBS Journal 276 (2009) 3428–3439 ª 2009 The Authors Journal compilation ª 2009 FEBS 3435
complex at physiological concentrations shows that

Cd(II) has very high affinity for CmtR. The disruption
of a repressor–promoter complex at physiological con-
centration is rare, but was also observed in case of
ZntR [20]. The difference between our results and the
previous results [10] could be because of the different
hosts used (M. tuberculosis versus M. smegmatis),
which may differ in the regulation of genes [26–28].
M. smegmatis, which is a non-pathogenic saprophytic
bacteria, may encounter varied metal toxicity com-
pared to pathogenic M. tuberculosis, which may
result in a different response to ions. Moreover, the
homolog of M. tuberculosis CmtR in M. smegmatis
(MSMEG_5603) has only 67% similarity with
M. tuberculosis CmtR (data not shown).
The cmtR, Rv1993c and cmtA genes constitute an
operon. The role of Rv1993c and cmtA is not known,
but the cmtA gene product has sequence similarity to
the well-characterized metal transporting P
1
-ATPase
pump, which pumps out metal ions that may otherwise
be toxic to the bacterium. Our results show that CmtR
binds to multiple sites to repress the operon when the
Cd(II) ion is not present (Fig. 8). These sites, which
overlap the major promoter (T1) and are located
downstream of the T2 promoter, do not allow interac-
tion of RNA polymerase with promoter DNA in the
presence of bound CmtR. When present, the Cd(II)
ion binds to CmtR and decreases its affinity for DNA,
resulting in its release from DNA and hence transcrip-

tion of the operon (Fig. 8). The increased concentra-
tion of CmtA may actively pump the Cd(II) out. In
the absence of Cd(II), the cmtR–Rv1993c–cmtA operon
is repressed again by CmtR (Fig. 8).
Experimental procedures
Plasmids, bacterial strains and culture conditions
M. tuberculosis H37Rv was cultured in Dubos medium con-
taining 0.05% Tween-80 plus 0.5% albumin ⁄ 0.75% dex-
trose ⁄ 0.085% NaCl at 37 °C under aerobic shaking
conditions (220 r.p.m.). E. coli DH5a was grown in Luria–
Bertani medium usually and in 2· YT medium [29] for pro-
tein overexpression. Antibiotics, when required, were used
at the concentrations indicated: ampicillin at 100 lgÆmL
)1
and kanamycin at 25 lgÆmL
)1
. All cloning steps were per-
formed as described [29]. The plasmids and primers used in
this study are listed in Tables 1 and 2, respectively.
Cloning and purification of CmtR
The cmtR coding sequence was amplified from M. tubercu-
losis H37Rv DNA using primers P1 and P2 (Table 2) engi-
neered to contain restriction sites for BamHI and HindIII,
respectively. The amplified product was digested with the
indicated restriction enzymes, and cloned into pPROEx-
HTb (Invitrogen, Carlsbad, CA, USA) generating pPRO-
CmtR. The construct was verified by DNA sequencing.
Recombinant His-CmtR (an N-terminally histidine-
tagged fusion protein of approximately 16.0 kDa) was over-
expressed by growing recombinant E. coli DH5a at 37 ° C

to an attenuance at 595 nm of 0.4–0.5, followed by induc-
tion with 1 mm isopropyl thio-b-d-galactoside for 4 h at
37 °C. The induced cells were harvested, resuspended in
buffer A (20 mm Tris pH 8.0, 500 mm NaCl, 20 mm imid-
azole, 10% glycerol and 1 mm phenylmethanesulfonyl fluo-
ride) and sonicated (Branson Ultrasonics, Danbury, CT,
USA) on ice (duty cycle 60, four pulses of 2 min each). The
–10 –35
cmtR Rv1995
T1
T2
Rv1993ccmtA
Cd
2+
Cd
2+
- CmtR
–10 –35
cmtR Rv1995
T1
T2
Rv1993ccmtA
–10 –35
Fig. 8. Transcriptional regulation of the cmtR–1993c–cmtA operon
by CmtR. CmtR (oval) represses transcription of the cmtR–1993c–
cmtA operon by binding to multiple sites overlapping and down-
stream of the T1
cmtR
and T2
cmtR

promoters, respectively. Cd(II)
(black circles) acts as an inducer, binding to CmtR and releasing it
from the DNA, resulting in the de-repression of operon trans
cription.
Table 1. Plasmids used in this study. Km
R
, kanamycin resistance.
Plasmid Description
Source or
reference
pPROEX-HTb E. coli expression vector
(N-terminal histidine tag)
Invitrogen
pGEMT-Easy E. coli cloning vector Promega
pFPV27 E. coli–mycobacteria
shuttle plasmid containing
a promoterless GFP gene, Km
R
[32]
pPRO-CmtR cmtR coding region in
pPROEX-HTb to overexpress
CmtR with a N-terminal
histidine tag
This study
pCmtR pFPV27 containing the
156 bp Rv1994c–Rv1995
intergenic region promoter
(P6–P3 fragment) upstream
of GFP
This study

Autoregulation by CmtR S. Chauhan et al.
3436 FEBS Journal 276 (2009) 3428–3439 ª 2009 The Authors Journal compilation ª 2009 FEBS
sonicate was centrifuged at 12 000 g for 30 min and the
supernatant was applied to a nickel-nitrilotriacetic acid
column. Recombinant His-CmtR protein (approximately
16.0 kDa) was eluted in buffer A containing 250 mm imid-
azole. The histidine tag was removed using rTEV protease
(Invitrogen) according to the manufacturer’s protocol to
yield a protein of approximately 12.5 kDa, referred to as
CmtR. The purified His-CmtR and CmtR proteins were
dialyzed against 50 mm Tris (pH 8.0), 50 mm NaCl and
50% glycerol, and stored at )20 °C.
SDS–PAGE, western blotting and formaldehyde
crosslinking
Purified His-CmtR or CmtR was boiled for 5 min at
100 °C in SDS sample buffer (300 mm Tris ⁄ HCl pH 6.8,
12% SDS, 60% glycerol, 0.6% bromophenol blue) in the
absence and presence of 7.5% b-mercaptoethanol or
various concentrations of dithiothreitol. The samples were
resolved by 12% SDS–PAGE. The bands were transferred
to nitrocellulose membrane at 0.8 mAÆcm
2
)1
for 2 h using a
semidry blotting apparatus (Bio-Rad, Hercules, CA, USA).
The membrane was probed with horseradish peroxidase-
conjugated anti-His serum (Qiagen, Valencia, CA, USA) or
polyclonal antibody against purified recombinant M. tuber-
culosis CmtR protein raised in rabbit and processed accord-
ing to the manufacturer’s protocol (Qiagen) or as described

previously [30]. A crosslinking experiment with purified
His-CmtR was performed in the presence of 0.1% formal-
dehyde in standard phosphate-buffered saline [29] for
30 min at 25 °C. Crosslinking was terminated by the addi-
tion of SDS sample buffer (with 7.5% b-mercaptoethanol),
and the products were resolved by 10% SDS–PAGE before
transfer to nitrocellulose membrane as described above.
The membrane was probed with horseradish peroxidase-
conjugated anti-His serum (Qiagen) and developed using
3’,3’-diaminobenzidine.
Electromobility shift assay and DNase I
footprinting
EMSA and DNase I footprinting were performed with
purified CmtR (His tag removed). For EMSA, radiolabeled
DNA fragments were generated by PCR using appropriate
primers (Table 2 and Fig. 5A), one of which was end-
labeled using c-
32
P ATP (approximately 3000 CiÆmmol
)1
,
Board of Radiation and Isotope Technology, Hyderabad,
India). Binding of CmtR was performed in a 20 lL reac-
tion where the protein was first incubated with metal ions
for 10 min at room temperature (when required) and then
with
32
P-labeled DNA (approximately 2 ng, approximately
15 000 cpm) or with double-stranded oligonucleotides for
30 min on ice in binding buffer [25 m m Tris ⁄ HCl pH 8.0,

6mm MgCl
2
, 5% glycerol, 0.02 mm dithiothreitol and 1 lg
of poly(dI-dC)]. The reaction was electrophoresed on a 5%
non-denaturing gel at 120 V (constant) in 0.5· Tris ⁄ borate
buffer at 4 °C after pre-running the gel for 30 min under
similar conditions. The gel was dried and analyzed by
phosphor imaging using Quantity One software (Bio-Rad).
To make double-stranded oligonucleotides, single-stranded
oligonucleotides (Table 2) were annealed by incubating at
95 °C for 3 min in buffer containing 10 mm Tris ⁄ HCl and
100 mm NaCl, and allowed to cool slowly to 4 °C. The
DNA was visualized by ethidium bromide staining.
The DNase I footprinting assay was performed as
described previously [26]. The binding and running buffers
used were the same as in EMSA. DNA–protein interac-
tion was performed as described above with approximately
150 000 cpm of labeled DNA, in a reaction volume of
50 lL. DNase I treatment with 0.2 units was performed
for 3 min at 22 °C in the presence of 50 lL cofactor solu-
tion (2.5 MgCl
2
and 5 mm CaCl
2
), and the reaction was
stopped by the addition of 90 lL stop solution (200 mm
NaCl, 30 mm EDTA, 1% SDS and 66 lgÆ mL
)1
yeast
tRNA). The reaction products were phenol ⁄ chloroform-

extracted, ethanol-precipitated, washed with 70% ethanol
Table 2. List of primers ⁄ oligonucleotides used in the study.
Primers Sequence (5¢-to3¢) Experiment
P1 GTACTATTGGATCCATGCTGACG CmtR protein
expression
P2 GTCCTGTAAGCTTAAGTCGTGTC CmtR protein
expression
P3 TTCCCGCATCTCACACGTCA Reporter assay
P4 CATATCTGCTATGGATGTAC EMSA
P6 GTCACACCTTTCGTCGCAGC Reporter assay,
EMSA, DNase
I footprinting
P8 TGTTATACCAGTATATGGTGTACTA EMSA
94RTf CTCGGCCTCAACTACAGTCGT Reverse transcription
94RTr ACAGGTAGCTGAGCAGCAGAC Reverse transcription
1994intR CAGCTAGCTGGCCGGGATAGC EMSA, DNase I
footprinting, TSP
mapping
P1F GCCGATCATATCTGCTATGG EMSA,
oligonucleotides
for site 1
P1R CCATAGCAGATATGATCGGC
P2F ATGTACAATTCAGCTCTTGCT EMSA,
oligonucleotides
for site 2
P2R AGCAAGAGCTGAATTGTACAT
P3F GCTGTTATACCAGTATATGG EMSA,
oligonucleotides
for site 3
P3R CCATAT ACTGGTATAACAGC

P4F TGGTGTACTAATTTGATCTATG EMSA,
oligonucleotides
for site 4
P4R CATAGATCAAATAGTACACCA
H1 CGAGTCGACCGGAGGACCTTT
GGCCCTGCGTCGACCGA
EMSA,
oligonucleotides
used in control
experiment
H2 TCGGTCGACGCAGGGCCAAAG
GTCCTCCGGTCGACTCG
S. Chauhan et al. Autoregulation by CmtR
FEBS Journal 276 (2009) 3428–3439 ª 2009 The Authors Journal compilation ª 2009 FEBS 3437
and air-dried. DNA was dissolved in formamide ⁄ urea
loading dye, loaded on a 6% denaturing polyacrylamide
gel alongside a DNA sequencing ladder generated using
the primer used in the DNase I footprinting reaction, and
run at 70 W. The gel was dried and visualized by phos-
phor imaging (Bio-Rad).
RNA isolation, RT-PCR and primer extension
RNA was isolated from M. tuberculosis H37Rv log-phase
cultures grown in Dubos medium under aerobic conditions
as described previously [31].
For RT-PCR, 0.5 lg M. tuberculosis RNA was used as a
template for synthesis of cDNA using a RevertAid first-
strand cDNA synthesis kit and random primers (MBI
Fermentas, St Leon-Rot, Germany) according to the manu-
facturer’s instructions. The cDNA was used to amplify a
product encompassing the entire Rv1993c gene and some

parts of the Rv1992c ⁄ cmtA and cmtR genes using primers
94RTf and 94RTr (Fig. 1 and Table 2).
TSPs were mapped using a primer extension method as
described previously [31] using
32
P-labeled primer 1994intR
(Table 2) and 60 lg RNA from aerobic cultures (two sepa-
rate lots). Annealing of the primer was performed at
55 °C. The reactions were run alongside a sequence ladder
generated using the same primer and M. tuberculosis
DNA. The gel was dried and visualized by phosphor
imaging.
Reporter plasmid construction and measurement
of GFP fluorescence
The GFP reporter plasmid was constructed as described
previously [26]. Briefly, the 212 bp cmtR promoter region,
which was amplified with Pfu DNA polymerase using
M. tuberculosis H37Rv DNA as template and specific prim-
ers (P3–P6, Table 2), was first cloned into pGEMT-Easy
(Promega, Madison, WI, USA) and then into the reporter
plasmid pFPV27 [32] at the EcoRI site. The identity of the
cloned fragment was verified by DNA sequencing. For
reporter assays, stock cultures of M. tuberculosis carrying
the cmtR promoter reporter construct (pCmtR) or vector
alone (pFPV27) were subcultured twice to mid-logarithmic
phase (attenuance at 595 nm of approximately 0.3), and
then diluted to an attenuance at 595 nm of 0.1 in 50 mL
tubes (5 mL culture). The cells were either supplemented
with no metal or with the maximum permissive concentra-
tions [10] of metal ions: CdCl

2
(2.5 lm), NiCl
2
(500 lm),
CoCl
2
(200 lm) and Pb(NO
3
)
2
(5 lm). Culture aliquots of
200 lL were sampled at 24 h intervals, and GFP fluores-
cence and the attenuance at 595 nm were measured. GFP
fluorescence was assessed using a spectrofluorimeter
(Molecular Devices, Sunnyvale, CA, USA) with an excita-
tion wavelength of 483 nm and an emission wavelength of
515 nm.
Acknowledgements
This work was supported by a grant to H. K. P. from
the Indian Council of Medical Research. S. C. received
a Senior Research Fellowship from the Council of
Scientific and Industrial Research, India. A. S. received
a Senior Research Fellowship from the University
Grants Commission, India. A. K. was supported by
grants from the Department of Biotechnology (DBT),
under the Ministry of Science and Technology, India.
We thank Dr L. Ramakrishnan (Department of
Microbiology, University of Washington, Seattle, WA,
USA) for the generous gift of plasmid pFPV27.
M. tuberculosis H37Rv DNA was obtained from the

TB Research Materials and Vaccine Testing program
of the US National Institute of Allergy and Infectious
Diseases (Grant A1-75320). The technical assistance of
Mr Shailendra Kumar is acknowledged.
References
1 Brown NL, Stoyanov JV, Kidd SP & Hobman JL
(2003) The MerR family of transcriptional regulators.
FEMS Microbiol Rev 27, 145–163.
2 Busenlehner LS, Pennella MA & Giedroc DP (2003)
The SmtB ⁄ ArsR family of metalloregulatory
transcriptional repressors: structural insights into
prokaryotic metal resistance. FEMS Microbiol Rev 27,
131–143.
3 Morby AP, Turner JS, Huckle JW & Robinson NJ
(1993) SmtB is a metal-dependent repressor of the
cyanobacterial metallothionein gene smtA: identification
of a Zn-inhibited DNA–protein complex. Nucleic Acids
Res 21, 921–925.
4 Wu J & Rosen BP (1991) The ArsR protein is a
trans-acting regulatory protein. Mol Microbiol 5, 1331–
1336.
5 Thelwell C, Robinson NJ & Turner-Cavet JS (1998) An
SmtB-like repressor from Synechocystis PCC 6803 regu-
lates a zinc exporter. Proc Natl Acad Sci USA 95,
10728–10733.
6 Rother D, Mattes R & Altenbuchner J (1999) Purifica-
tion and characterization of MerR, the regulator of the
broad-spectrum mercury resistance genes in Streptomy-
ces lividans 1326. Mol Gen Genet 262, 154–162.
7 Busenlehner LS, Apuy JL & Giedroc DP (2002) Char-

acterization of a metalloregulatory bismuth(III) site in
Staphylococcus aureus pI258 CadC repressor. J Biol
Inorg Chem 7, 551–559.
8 Cole ST, Brosch R, Parkhill J, Garnier T, Churcher C,
Harris D, Gordon SV, Eiglmeier K, Gas S, Barry CE
III et al. (1998) Deciphering the biology of
Mycobacterium tuberculosis from the complete genome
sequence. Nature 393, 537–544.
Autoregulation by CmtR S. Chauhan et al.
3438 FEBS Journal 276 (2009) 3428–3439 ª 2009 The Authors Journal compilation ª 2009 FEBS
9 Cavet JS, Meng W, Pennella MA, Appelhoff RJ, Gied-
roc DP & Robinson NJ (2002) A nickel–cobalt-sensing
ArsR–SmtB family repressor. Contributions of cytosol
and effector binding sites to metal selectivity. J Biol
Chem 277, 38441–38448.
10 Cavet JS, Graham AI, Meng W & Robinson NJ (2003)
A cadmium–lead-sensing ArsR–SmtB repressor with
novel sensory sites. Complementary metal discrimina-
tion by NmtR and CmtR in a common cytosol. J Biol
Chem 278, 44560–44566.
11 Wang Y, Hemmingsen L & Giedroc DP (2005) Struc-
tural and functional characterization of Mycobacte-
rium tuberculosis CmtR, a PbII ⁄ CdII-sensing
SmtB ⁄ ArsR metalloregulatory repressor. Biochemistry
44, 8976–8988.
12 Banci L, Bertini I, Cantini F, Ciofi-Baffoni S, Cavet JS,
Dennison C, Graham AI, Harvie DR & Robinson NJ
(2007) NMR structural analysis of cadmium sensing by
winged helix repressor CmtR. J Biol Chem 282, 30181–
30188.

13 Campbell DR, Chapman KE, Waldron KJ, Tottey S,
Kendall S, Cavallaro G, Andreini C, Hinds J, Stoker
NG, Robinson NJ et al. (2007) Mycobacterial cells have
dual nickel–cobalt sensors: sequence relationships and
metal sites of metal-responsive repressors are not con-
gruent. J Biol Chem 282, 32298–32310.
14 Schnappinger D, Ehrt S, Voskuil MI, Liu Y, Mangan
JA, Monahan IM, Dolganov G, Efron B, Butcher PD,
Nathan C et al. (2003) Transcriptional adaptation of
Mycobacterium tuberculosis within macrophages:
insights into the phagosomal environment. J Exp Med
198, 693–704.
15 Grasseschi RM, Ramaswamy RB, Levine DJ, Klaassen
CD & Wesselius LJ (2003) Cadmium accumulation and
detoxification by alveolar macrophages of cigarette
smokers. Chest 124, 1924–1928.
16 Unniraman S, Chatterji M & Nagaraja V (2002) DNA
gyrase genes in Mycobacterium tuberculosis: a single
operon driven by multiple promoters. J Bacteriol 184,
5449–5456.
17 Carey J (1992) Gel retardation. Methods Enzymol 208,
103–117.
18 Engohang-Ndong J, Baillat D, Aumercier M, Bellefon-
taine F, Besra GS, Locht C & Baulard AR (2004) EthR, a
repressor of the TetR ⁄ CamR family implicated in
ethionamide resistance in mycobacteria, octamerizes
cooperatively on its operator. Mol Microbiol 51, 175–188.
19 Kimsey HH & Waldor MK (2004) The CTXphi repres-
sor RstR binds DNA cooperatively to form tetrameric
repressor–operator complexes. J Biol Chem 279, 2640–

2647.
20 Singh VK, Xiong A, Usgaard TR, Chakrabarti S,
Deora R, Misra TK & Jayaswal RK (1999) ZntR is an
autoregulatory protein and negatively regulates the
chromosomal zinc resistance operon znt of Staphylococ-
cus aureus. Mol Microbiol 33, 200–207.
21 Endo G & Silver S (1995) CadC, the transcriptional
regulatory protein of the cadmium resistance system of
Staphylococcus aureus plasmid pI258. J Bacteriol 177,
4437–4441.
22 Erbe JL, Taylor KB & Hall LM (1995) Metalloregula-
tion of the cyanobacterial smt locus: identification of
SmtB binding sites and direct interaction with metals.
Nucleic Acids Res 23, 2472–2478.
23 Sun Y, Wong MD & Rosen BP (2001) Role of cysteinyl
residues in sensing Pb(II), Cd(II), and Zn(II) by the
plasmid pI258 CadC repressor. J Biol Chem 276,
14955–14960.
24 Kar SR, Adams AC, Lebowitz J, Taylor KB & Hall
LM (1997) The cyanobacterial repressor SmtB is pre-
dominantly a dimer and binds two Zn
2+
ions per sub-
unit. Biochemistry 36, 15343–15348.
25 Xu C & Rosen BP (1997) Dimerization is essential for
DNA binding and repression by the ArsR metalloregu-
latory protein of Escherichia coli. J Biol Chem 272,
15734–15738.
26 Chauhan S & Tyagi JS (2008) Cooperative binding of
phosphorylated DevR to upstream sites is necessary

and sufficient for activation of the Rv3134c–devRS
operon in Mycobacterium tuberculosis: implication in
the induction of DevR target genes. J Bacteriol 190,
4301–4312.
27 Michele TM, Ko C & Bishai WR (1999) Exposure to
antibiotics induces expression of the Mycobacte-
rium tuberculosis sigF gene: implications for chemother-
apy against mycobacterial persistors. Antimicrob Agents
Chemother 43, 218–225.
28 Manganelli R, Provvedi R, Rodrigue S, Beaucher J,
Gaudreau L & Smith I (2004) Sigma factors and global
gene regulation in Mycobacterium tuberculosis. J Bacte-
riol 186, 895–902.
29 Sambrook J & Russell DW (2001) Molecular Cloning:
A Laboratory Manual, 3rd edn. Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY.
30 Saini DK, Malhotra V, Dey D, Pant N, Das TK &
Tyagi JS (2004) DevR–DevS is a bona fide two-
component system of Mycobacterium tuberculosis that is
hypoxia-responsive in the absence of the DNA-binding
domain of DevR. Microbiology 150, 865–875.
31 Bagchi G, Chauhan S, Sharma D & Tyagi JS (2005)
Transcription and autoregulation of the Rv3134c–
devR–devS operon of Mycobacterium tuberculosis .
Microbiology 151, 4045–4053.
32 Valdivia RH, Hromockyj AE, Monack D, Ramakrish-
nan L & Falkow S (1996) Applications for green fluo-
rescent protein (GFP) in the study of host–pathogen
interactions. Gene 173, 47–52.
S. Chauhan et al. Autoregulation by CmtR

FEBS Journal 276 (2009) 3428–3439 ª 2009 The Authors Journal compilation ª 2009 FEBS 3439