Báo cáo khoa học: Transcriptional activity and Sp 1⁄3 transcription factor binding to the P1 promoter sequences of the human AbH-J-J locus docx

Transcriptional activity and Sp 1
⁄
3 transcription factor
binding to the P1 promoter sequences of the human
AbH-J-J locus
Giordana Feriotto
1
, Alessia Finotti
2
, Giulia Breveglieri
1
, Susan Treves
3
, Francesco Zorzato
4
and
Roberto Gambari
2
1 Biotechnology Center, University of Ferrara, Italy
2 Department of Biochemistry and Molecular Biology, Section of Molecular Biology, University of Ferrara, Italy
3 Departments of Anaesthesia and Research, Kantonsspital, Basel, Switzerland
4 Department of Experimental and Diagnostic Medicine, Section of General Pathology, University of Ferrara, Italy
Keywords
aspartyl (asparaginyl) b-hydroxylase;
humbug; junctate; specific transcription
factors; transcription
Correspondence
R. Gambari, Department of Biochemistry
and Molecular Biology, University of Ferrara,
Via Borsari 46, 44100 Ferrara, Italy
Fax: +39 532 202723

Tel: +39 532 424443
E-mail:
(Received 22 May 2007, revised 29 June
2007, accepted 3 July 2007)
doi:10.1111/j.1742-4658.2007.05976.x
Alternative splicing of the locus AbH-J-J generates functionally distinct
proteins: the enzyme aspartyl (asparaginyl) b-hydroxylase, humbug and
junctate (truncated homologs of aspartyl (asparaginyl) b-hydroxylase with
a role in calcium regulation), and junctin (a structural protein of the sarco-
plasmic reticulum membrane). Aspartyl (asparaginyl) b-hydroxylase and
humbug are overexpressed in a broad range of malignant neoplasms. We
have previously reported the gene structure of this locus, showing the pres-
ence of two putative promoters, P1 and P2, and characterized the P2
sequences, directing tissue-specific transcription of junctin, aspartyl (aspar-
aginyl) b-hydroxylase and junctate. In addition, aspartyl (asparaginyl)
b-hydroxylase and humbug are expressed from exon 1 by the P1 promoter.
The present study identifies and functionally characterizes the P1 promoter
activity of the AbH-J-J locus. We demonstrate that mRNAs from the P1
promoter are actively transcribed in all the human tissues and cell lines
analyzed, and define the transcription start point in HeLa and RD cells.
To investigate the transcription mechanism we cloned 1.7 kb upstream of
exon 1 from a human BAC clone, and produced progressively deleted
reporter constructs. Our results showed that: (a) the 1.7 kb fragment was a
powerful activator of the reporter gene in human hepatoblastoma (HepG2)
and human embryonic rhabdomyosarcoma (RD) cell lines; (b) 512 bp
upstream of the transcription start site were essential for maximal promoter
activity; and (c) progressive deletions from ) 512 resulted in gradually
decreased reporter expression. The region responsible for maximal tran-
scription contains at least 12 GC boxes homologous to binding sequences
of specific transcription factor 1 (Sp1); by electrophoretic mobility shift

assay and supershift analysis, we identified three GC-rich elements that
bind Sp transcription factor family nuclear factors with very high effi-
ciency. A functional role of Sp transcription factors in upregulating P1-
directed transcription was demonstrated by analysis of the effects of:
(a) in vitro mutagenesis of the Sp1 transcription factor binding sites;
(b) transfection with Sp transcription factor 1 ⁄ 3 expression vectors; and
Abbreviations
AAH, aspartyl (asparaginyl) b-hydroxylase; ChIP, chromatin immunoprecipitation; EMSA, electrophoretic mobility shift assay; MEF-2, myocyte
enhancer factor 2; Sp1, specific transcription factor 1; Sp3, specific transcription factor 3; TF, threshold fluorescence; TFD, transcription
factor decoy.
4476 FEBS Journal 274 (2007) 4476–4490 ª 2007 The Authors Journal compilation ª 2007 FEBS
We have previously characterized the human AbH-J-J
locus, a genomic sequence that generates functionally
distinct proteins [1]. In addition to the enzyme aspartyl
(asparaginyl) b-hydroxylase (AAH), this locus encodes
junctin, a structural protein of the sarcoplasmic reticu-
lum, and the truncated homologs of AAH, the Ca
2+
-
binding proteins humbug and junctate [1,2]. AAH
catalyzes post-translational hydroxylation of aspartate
and asparagine residues in certain epidermal growth
factor-like domains present in a number of proteins,
including receptors and receptor ligands, involved in
cell growth and differentiation, as well as extracellular
matrix molecules [3]. AAH, mediating cell motility and
invasiveness, is of interest because of its role in placen-
tal implantation and ‘receptivity’ of endometrium [4].
Humbug is a truncated homolog of AAH that lacks a
catalytic domain. Overexpression of humbug increases

intracellular Ca
2+
levels by promoting its release from
intracellular stores [5]. The levels of humbug immuno-
reactivity are directly associated with colon cancer
tumor grade and inversely associated with patient sur-
vival [5]. AAH and⁄ or humbug are overexpressed in
infiltrative intrahepatic cholangiocarcinomas, metasta-
sized lung, breast, and colon, hepatocellular carcino-
mas, and malignant neuroectodermal tumors [6–10].
These proteins can contribute to the malignant pheno-
type by increasing motility and enhancing prolifera-
tion, survival, and cell cycle progression. Inhibition of
AAH expression and its truncated homolog could rep-
resent an attractive approach for gene therapy of infil-
trating tumors [3,10].
Junctate is an integral Ca
2+
-binding protein of the
sarco(endo)plasmic reticulum membrane that forms a
supramolecular complex with the inositol 1,4,5-tris-
phosphate receptor and modulates Ca
2+
entry through
receptor- and store-activated channels [1,11,12].
Our group previously reported the identification of
two putative promoter sequences, present within the
human AbH-J-J locus (named P1 and P2), that are
expected to regulate the transcription of this locus
[1,13]. The generated primary transcripts are subjected

to alternative splicing and direct the synthesis of AAH,
humbug, junctin, and junctate [1,13]. We have recently
reported the characterization of the P2 promoter,
demonstrating that the myocyte enhancer factor 2
(MEF-2) transcription factor binds this promoter
sequence and drives tissue-specific expression, being
responsible for inducing transcription during muscle
differentiation [1,13].
As little is known, to date, about the role of the P1
promoter, in this work we focused our attention on
this regulating sequence. To characterize the expression
directed by the P1 promoter, we analyzed the corre-
sponding mRNAs in different human tissues and cell
lines. Furthermore, transfections of human hepatoblas-
toma (HepG2) and human embryonic rhabdomyosar-
coma (RD) cells with progressively deleted reporter
constructs of the 1.7 kb DNA sequence upstream of
exon 1 were performed, and P1 promoter sequences
were characterized by analyzing the transcriptional
activity of each fragment. As several homologies to
specific transcription factor 1 (Sp1)-binding sites were
found, by computer-assisted analysis, within the pro-
moter sequence exhibiting maximal transcriptional
activity, the interactions of these GC-rich elements
with factors belonging to the Sp1 family were studied
by electrophoretic mobility shift assay (EMSA) [14,15].
Molecular interaction studies were also performed
in vitro by supershift assays, and in intact cells by
chromatin immunoprecipitation (ChIP). Functional
assays were performed by in vitro mutagenesis of the

Sp1-binding sites, by cotransfection with Sp1 ⁄ Sp3
expression vectors, and by cell treatment with decoy
oligonucleotides targeting Sp transcription factors.
Results
Transcriptional organization of the human AbH-J-J
locus and identification of the transcription
initiation sites proximal to the P1 promoter
The structural organization of the human AbH-J-J locus
is shown in Fig. 1. The scheme presented is based both
on results previously reported in detail elsewhere
[1,13] and on newly performed studies employing
RT-PCR. The combination of data obtained by PCR
(c) treatment with decoy oligonucleotides targeting Sp transcription factors.
In addition, Sp1 and Sp3 transcription factor chromatin immunoprecipita-
tion demonstrated in vivo binding of these proteins to P1 promoter. Our
results suggest that Sp transcription factors positively regulate the core of
the P1 promoter, and the comparison of the two promoters of the AbH-J-J
locus demonstrates that they are very different with regard to transcrip-
tional efficiency and ability to direct tissue-specific transcription.
G. Feriotto et al. Sp regulation of the AbH-J-J locus P1 promoter
FEBS Journal 274 (2007) 4476–4490 ª 2007 The Authors Journal compilation ª 2007 FEBS 4477
amplification and sequencing allowed us to define the
splicing events (Fig. 1) as well as the structure of the
5¢-region of this locus [1]. The data obtained indicate
that the use of different splice donors is involved in the
generation of protein diversity by alternative splicing
(see lower part of Fig. 1) [1,2]. Furthermore, the P1
promoter sequences direct the expression of these pro-
teins in most human tissues [2,13]. The RT-PCR
approach presented in Fig. 2A shows that by using an

exon 1-specific forward primer and an exon 3-specific
reverse primer, we were able to amplify all the tran-
scripts starting from the P1 promoter (AAH, humbug).
We employed this RT-PCR approach to examine sam-
ples of total RNA from several human adult tissues, and
confirmed by DNA sequencing the fidelity of the PCR
products. The results obtained from pancreas, brain,
adrenal gland, liver, heart and skeletal muscle show that
transcription directed from the P1 promoter occurs in
all the tissues analyzed (Fig. 2B). In contrast, we have
previously shown that the expression directed by the P2
promoter is tissue specific, as a high level of transcrip-
tion is present, in particular, in skeletal muscle, cardiac
muscle, and brain [2,13]. The P1 promoter directs tran-
scription also in RD, HepG2, human breast cancer
(MCF7), human cervix epithelial carcinoma (HeLa) and
human embryonic kidney (Hek293) tumor cell lines
(Fig. 2B).
As the transcription start site (TSS) from the P1 pro-
moter has not been previously described, we also per-
formed 5¢-RACE in order to precisely map the origin
of transcription. Our experiments were performed on
5¢-capped mRNA isolated from HeLa and RD cells. As
shown in Fig. 3A, lanes a and b, a prevalent band is
evident following electrophoresis of 5¢-RACE products.
We cloned the gel-purified PCR products, and their
characterized nucleotide sequences (Fig. 3B, arrows)
allowed mapping of multiple TSSs with differential
strength. The major TSS, resulting from the stronger
band in the PCR gel, was designated + 1 (Fig. 3B,

larger arrow). The nucleotide sequences located
upstream from these TSSs were considered as potential
regulatory regions belonging to the P1 promoter.
Fig. 1. Structure of the 5¢-end of the human locus for AAH, junctin, junctate, and humbug. Arabic numbers over black boxes indicate exons.
Intervening sequences are indicated by Roman numerals. The two putative promoters P1 and P2 are indicated. A schematic representation
of AAH, junctin, junctate and humbug exon splicing is given at the bottom of the panel. The cytoplasmic, transmembrane, positively charged,
Ca
2+
-binding and catalytic domains are indicated. The locations of AUG, stop codons, and poly(A) signals are shown. The PstI (P) plasmid
subclone of BAC 1 [1] covering the first exon of the locus is also shown.
A
B
Fig. 2. RT-PCR analysis of the transcripts starting from the P1 pro-
moter in adult human tissues or cell lines. (A) The exon 1 starting
mRNAs of AAH and humbug, the PCR primers and the 134 bp
PCR product are represented; gray boxes indicate exons common
to the two transcripts. (B) Electrophoresis analysis of oligo-dT RT-
PCR products obtained with the e1F ⁄ e3R primers in the absence
of template (a) or in the presence of cDNA from human adult nor-
mal tissue (b, pancreas; c, brain; d, adrenal gland; e, liver; f, heart;
g, skeletal muscle) or cell line (h, RD; i, HepG2; j, MCF7; k, HeLa;
l, Hek293) total RNA. M, pUC Mix Marker 8 (Fermentas).
Sp regulation of the AbH-J-J locus P1 promoter G. Feriotto et al.
4478 FEBS Journal 274 (2007) 4476–4490 ª 2007 The Authors Journal compilation ª 2007 FEBS
Transcriptional activity of the AbH-J-J P1
promoter
To test whether the exon 1 5¢-flanking sequences have
promoter activity, we cloned a 3.1 kb partially digested
PstI fragment (Fig. 1) from the human chromosome 8
BAC 1 clone [1]. The PCR-generated fragment span-

ning from ) 1683 to + 81 with respect to the principal
TSS was then inserted into the firefly luciferase repor-
ter vector pGL3-basic, sequenced, and used to generate
progressively deleted constructs for transient transfec-
tion experiments [13]. The reporter constructs (A–M),
generated as described in Experimental procedures, are
shown on the left side of Fig. 4A. We then tested the
ability of these constructs to drive transcription of
luciferase in HepG2 cells and RD cells. Promoter
activity was expressed as fold induction relative to that
of cells transfected with pGL3-basic vector (right side
of Fig. 4A,B). Our results show that the largest frag-
ment () 1683 ⁄ + 81) exhibited high reporter gene
expression in the HepG2 and RD cell lines (the fold
induction is about 100 and 45, respectively). Removal
of the ) 1683 ⁄ ) 834 sequence significantly increased
promoter activity (compare A and E constructs of
Fig. 4A,B). Further removal of the ) 834 ⁄ ) 512 frag-
ment preserved transcriptional activity to comparable
levels in the analyzed cell lines (E–H constructs,
Fig. 4A,B); however, deletion to nucleotide ) 389
resulted in a significant decrease of luciferase activity
(I construct) and, when the sequence was progres-
sively removed to ) 240 and ) 160, reporter expression
A
B
C
D
E
F

G
H
I
L
M
A
Relative luciferase activity
0
+81
-1683
-1289
-1204
-1017
-834
-661
-634
-512
-389
-240
-160
50 100
Relative luciferase activity
Relative luciferase activity
0
6,2
12,5
-512/+81 P1 sequences (H)
-265/+115 P2 sequences
25
50

HepG2
RD RD
100
0 50 100
150 200 250 275
B
C
D
E
F
G
H
I
L
M
A
B
C
Fig. 4. A bH-J-J P1 promoter activity in HepG2 and RD cell lines. (A) HepG2 cells were transiently transfected with sequentially deleted
reporter constructs of the ) 1683 ⁄ + 81 P1 nucleotide sequence (represented on the left side of the figure, A–M). Transient transfection and
luciferase assays were performed in triplicate; the data (right side of the figure) were normalized to Renilla luciferase activity, and are shown
as relative activities compared to that for pGL3-basic, a reporter vector with a basal promoter. The values are the means ± SD of at least
three independent experiments. (B) The same procedure as in (A) was performed with the RD cell line. (C) AbH-J-J P1 and P2 promoter
activity in the RD cell line. Cells were transiently transfected with the reporter constructs that present the maximal transcriptional activity of
each promoter [13].
a
P1 transcription initiation sites
183 bp
b
M

AB
Fig. 3. P1 transcription initiation site mapping. (A) 5¢-RACE analysis
of AbH-J-J locus exon 1 starting transcripts. cDNAs, synthesized
from HeLa and RD cell total RNA, were amplified with the gene-
specific e3R primer. The nested PCRs were performed with the
gene-specific e1R primer, complementary to exon 1, and one-fifth
of the reactions, derived from HeLa (a) and RD (b) cells, were ana-
lyzed by gel electrophoresis. M, pUC Mix Marker 8. (B) Nucleotide
sequence of 5¢-RACE products. The most represented nested PCR
products were gel-purified, cloned and sequenced. The principal
TSSs are shown by arrows (the stronger TSS was numbered + 1).
The gene-specific reverse primer used for the last PCR is under-
lined, and the translation start site (ATG) is indicated.
G. Feriotto et al. Sp regulation of the AbH-J-J locus P1 promoter
FEBS Journal 274 (2007) 4476–4490 ª 2007 The Authors Journal compilation ª 2007 FEBS 4479
gradually decreased (L and M constructs). In conclu-
sion, our findings indicate that 512 bp upstream of the
TSS are essential for maximal promoter activity, and
deletions to ) 389, ) 240 and ) 160 resulted in progres-
sive reduction of transcription to about 75%, 40%,
and 7%, respectively.
In addition, when we compared the maximal activi-
ties of P1 and P2 promoter sequences in inducing tran-
scription of RD cells, the fold inductions were
dramatically different, the P1 promoter being 16-fold
more active (Fig. 4C). It should be underlined that the
P1 promoter sequences do not share homology regions
and signals for transcription factors with the P2 pro-
moter. For instance, no MEF-2-binding sites are pres-
ent within the P1 promoter; this finding is of interest,

when related to the different tissue specificities of these
two promoters [1,13,16].
Identification of GC boxes within the ) 512
⁄
+33
AbH-J-J P1 promoter region
Sequence analysis of the region required for maximal
expression from the P1 promoter was performed using
the tfsearch program. Looking for homology to
known signals for transcription factors and imposing
an 80% threshold, we identified within the ) 512 ⁄ +33
region at least 12 GC-rich boxes similar to the Sp1
consensus binding sequence (Fig. 5A). The location of
these putative Sp1-binding sites within the P1 pro-
moter sequence is shown in Fig. 5A,B, together with
the transcription initiation sites and the ATG signal.
As the region responsible for maximal P1 promoter
transcription contains GC-rich elements (H construct,
Fig. 4), we concentrated our attention on the activity
of binding of nuclear extract to these boxes.
Binding of nuclear factors to GC-rich boxes
of the AbH-J-J P1 promoter
In order to study protein–DNA interactions and fur-
ther characterize the transcription factors involved, we
performed competitive EMSA [13]. Table 1 and
Fig. 5A show the synthetic oligonucleotides used for
the bandshift experiments. The results obtained using
2 lg of HepG2 cell nuclear extract and the
32
P-labeled

Sp1mer double-stranded oligonucleotide, which con-
tains the consensus-binding site for Sp1 transcrip-
tion factor, are shown in Fig. 6A [17,18]. The probe
A
B
Fig. 5. DNA sequence of the AbH-J-J P1
promoter region. (A) ) 512 ⁄ + 112 P1 pro-
moter and 5¢-UTR sequences. Solid and
dashed lines indicate the oligonucleotides
used in EMSA (Table 1). The sequences
homologous to Sp1 transcription factor-bind-
ing site are boxed; the percentage homol-
ogy was obtained with
TF SEARCH version
1.3. Arrows indicate the characterized tran-
scription initiation sites. The 5¢-end nucleo-
tide positions of the progressively deleted
promoter sequence present in the reporter
constructs are shown in gray. (B) Schematic
representation of the ) 512 ⁄ + 112 region of
the P1 promoter. Elements homologous
to the Sp1-binding site are indicated by
boxes, the nucleotide deletions of reporter
constructs are shown in gray.
Sp regulation of the AbH-J-J locus P1 promoter G. Feriotto et al.
4480 FEBS Journal 274 (2007) 4476–4490 ª 2007 The Authors Journal compilation ª 2007 FEBS
interacts with nuclear proteins producing the three
retarded complex pattern typical of transcription fac-
tors belonging to the Sp family. A high-mobility band
and two overlapping low-migrating bands (Fig. 6A,

lane 1) are generated. As expected, a 100-fold excess
of unlabeled Sp1mer oligonucleotide completely abol-
ished sequence-specific interactions of the nuclear pro-
teins with the probe (Fig. 6A, lane 2). Competitive
experiments performed using unlabeled oligonucleo-
tides containing the previously identified GC-rich
boxes of the P1 promoter region (Table 1) demon-
strated that F ⁄ Gmer,H⁄ Imer and D ⁄ Emer interfere
with the formation of the three complexes (Fig. 6A,
lanes 3, 4 and 7). These results suggest that the last
three oligonucleotides contain binding elements recog-
nized by Sp family transcription factors [19]. On the
other hand, competitive bandshift demonstrated that
the three Sp bands were only slightly reduced by
Kmer and Lmer (Fig. 6A, lanes 5 and 6), whereas
Jmer did not decrease the abundance of the Sp-spe-
cific complexes (Fig. 6A, lane 8). To better character-
ize the binding efficiency of the oligonucleotides under
investigation, we performed bandshift with the same
probe and different fold molar excesses of competitors
(Fig. 6B,C). As observed for Sp1mer (Fig. 6B, lane
10), the three complexes were completely disrupted by
a six-fold molar excess of unlabeled H ⁄ Imer (Fig. 6B,
lane 15), whereas the same excess of F ⁄ Gmer
decreased the binding to about 5% of the control in
the absence of competitor (Fig. 6B, lane 12). Further-
more, the competition with 50-fold molar excess of
unlabeled D ⁄ Emer,Kmer and Lmer decreased the
interactions to 12%, 60% and 75% of the control,
respectively (Fig. 6C, lanes 20, 22 and 24), whereas

Jmer competitor was not active even if used at 100-
fold molar excess (Fig. 6C, lane 26). To further con-
firm whether the previously identified GC-rich P1
sequences are able to bind Sp family transcription fac-
tors, we performed bandshift assays using as probe
the oligonucleotides under investigation, which gener-
ated the same complex migration profile obtained
with labeled Sp1mer. Figure 6D shows an example of
the interactions of nuclear extracts with H ⁄ Imer
probe. As expected from our previous assays, the
three complexes were completely disrupted by an
excess of the competitors Sp1mer,F⁄ Gmer and
H ⁄ Imer (Fig. 6D, lanes 28–33), but not by Jmer or
the unrelated oligonucleotide MyDmer (Fig. 6D, lanes
34 and 35) [13].
Supershift with Sp1 and Sp3 transcription factor
antisera
In order to obtain the formal demonstration of an
involvement of Sp-related proteins in molecular inter-
actions at the P1 promoter, supershift experiments
Table 1. Double-stranded synthetic oligonucleotides.
Amplified region Sequences (5¢-to3¢)
a
Oligonucleotides used for EMSA
Sp1mer
b
– CCCTTGGTGGGGGCGGGGCCTAAGCTGCG
F ⁄ Gmer – CCTTCCGGGGGCGGGGCGAGGCCGGGA
F ⁄ Gmut – CCTTCC
TGGTTCGTAGCTAGTCCTGGA

H ⁄ Imer – CGGGAAGGGGCGTGGCCGTCGGGCGGCGAGCC
Kmer – GTGCTGCAGGCGGTGCTGAGGCA
Lmer – TCCAGCGGCCCGCCGCCGCCAG
D ⁄ Emer – GTGAGCAGGGGCGGGGAGCGCGGCAGGGTACCGC
D ⁄ Emut – GTGAGCA
TAGTCGTAGAGCATGGTAGAGTACCGC
Jmer – TACACGCGAGGCCGGGCGCGCGCA
MyDmer
c
– CCCCCCAACACCTGCTGCCTGA
Q-PCR primers
P1 ChIP F
P1 ChIP R
P1 promoter AbH-J-J ACGTTTGCCACGTTCCAAAGGA
ACGAACCTGTGACTCCCTCCCG
Neg ChIP F
Neg ChIP R
Negative control region TGTGTGATTTCCCGTCAACTGTC
CCAGCCTCTTCCATTGGATACAA
e1 F
e5 R
From exons 1 to 5 of AbH-J-J transcripts CAAGAGCAGCGGCAACAG
AATAAAACTTTGGCATCATCCACTCAAAATCTCC
HMBS F
HMBS R
HMBS mRNA
d
(housekeeping gene) GAACATGCCCTGGAGAAGAATGA
GGTAGCCTGCATGGTCTCTTGTAT
a

Nucleotide mutations are underlined.
b
The oligonucleotide containing the Sp1 site was purchased from Geneka (Montreal, Canada).
c
Feriotto et al. [13].
d
HMBS, hydroxymethylbilane synthase.
G. Feriotto et al. Sp regulation of the AbH-J-J locus P1 promoter
FEBS Journal 274 (2007) 4476–4490 ª 2007 The Authors Journal compilation ª 2007 FEBS 4481
were performed using the previously identified GC-rich
boxes. As shown in the representative experiment
reported in Fig. 7A, antibodies against Sp1 (lane 2)
and Sp3 (lane 3) transcription factors supershifted the
specific complexes, indicating that these proteins are
able to bind in vitro to P1 promoter sequences of the
AbH-J-J gene locus.
ChIP assay
In order to verify whether the binding of Sp1 and Sp3
proteins to the AbH-J-J P1 promoter occurs in intact
cells, ChIP was performed. HeLa cells were fixed,
chromatin was immunoprecipitated with antibodies
against Sp1 or Sp3 transcription factors, and quantita-
tive real-time PCR was performed on recovered DNA
using primers amplifying a P1 promoter region of
the AbH-J-J gene locus that contains the previously
characterized Sp1-d ⁄ e, Sp1-f ⁄ g and Sp1-h ⁄ i boxes
(Fig. 5B). As an immunoprecipitation control, nonim-
mune rabbit serum or unrelated antisera, of the same
isotype, recognizing MEF-2A and myogenin were
used. Figure 7B shows a representative example of

amplification curves (in duplicate determinations)
obtained by SYBR Green real-time PCR. The data
demonstrate that HeLa chromatin immunoprecipitated
using Sp1 or Sp3 antiserum reaches the ‘threshold fluo-
rescence’ (TF) value about six cycles before nonim-
mune serum ChIP samples. The results obtained with
ChIP performed with antibodies against MEF-2A
(Fig. 7B) and myogenin (data not shown) are similar
to those of immunoprecipitation controls obtained
using nonimmune rabbit serum. PCR was also per-
formed using control primers flanking a genomic
region about 5 kb upstream of the P1 promoter
(Table 1). Because this sequence, lacking Sp1-binding
sites, should not be bound by Sp factors, PCR with
the negative control primers was used to normalize
quantitative results from different immunoprecipita-
tions.
For data analysis, we followed the methodology
described in Experimental procedures. Normalized
results, reported in Fig. 7C, indicate mean increases in
amplification signal of 13-fold (Sp1 ChIP) and 22-fold
fold
molar
excess of competitor
fold
molar
excess of competitor
fold
molar
excess of competitor

fold
molar
excess of com
p
etitor
50 50
25 50
Sp3
Sp3
Sp1/3
Sp1/3
Competitor
Competitor
–
H/ImerProbeProbe Sp1 mer
–
27 28
Sp1mer
F/G
mer
H/Imer
H/Imer
D/Emer
Kmer
Lmer
Jmer
Jmer
MyDmer
Competitor
Competitor

–
–
Sp1mer
Sp1mer
Probe
Probe
Sp1mer
Sp1mer
F/Gmer
H/Imer
Kmer
Lmer
D/Emer
Jmer
F/Gmer
H/Imer
29 30 31 32 33 34 35
6
*
Sp3
Sp1/3
*
12612 12
25 256
9 101112 1513 16 1714
123 64785
18 19 20 21 22 23
100
24 25 26
25 50 25 50 100 100

50100 100 50 100 100
AB
CD
Fig. 6. AbH-J-J promoter P1 elements
homologous to the Sp1 box bind HepG2
nuclear factors. EMSAs were carried out on
2 lg of HepG2 nuclear extracts as described
in Experimental procedures, using Sp1mer
(A–C) or H ⁄ Imer (D) probe (Table 1). –,
probe was incubated with nuclear extracts
in the absence of competing oligonucleo-
tides. The fold molar excess of the added
competitor (Table 1) is reported at the bot-
tom of each panel. Arrows and asterisks
indicate the specific and nonspecific com-
plexes, respectively.
Sp regulation of the AbH-J-J locus P1 promoter G. Feriotto et al.
4482 FEBS Journal 274 (2007) 4476–4490 ª 2007 The Authors Journal compilation ª 2007 FEBS
(Sp3 ChIP) when PCR was performed with P1
promoter-specific primers relative to PCR products
obtained with negative control primers. These data
strongly indicate that transcription factors belonging
to the Sp1 superfamily interact with the P1 promoter
in intact HeLa cells.
Effects of mutations of Sp1-binding sites
on P1-directed transcription
In order to verify the role of Sp1-binding sites in P1-
directed transcription, we first designed D ⁄ Emut and
F ⁄ Gmut mutant oligonucleotides (Table 1) that are
unable to bind the Sp family factors. We demonstrated

that mutated D ⁄ Emut and F ⁄ Gmut failed to disrupt
D ⁄ Emer –Sp protein complexes (Fig. 8A, lanes 1 and
5). In agreement with this, no retarded bands were
generated following incubation of nuclear factors with
D ⁄ Emut and F ⁄ Gmut probes (Fig. 8B, lanes 7 and 8).
Accordingly, we produced, starting from the wild-type
reporter construct (H, ) 512 ⁄ + 81), two plasmids car-
rying the previously characterized Sp1-binding site
mutations (d ⁄ e mut and f ⁄ g mut). When the mutant
constructs were used to transfect HeLa cells, 22% and
12% decreases in luciferase activity (relative to the
wild-type H construct) were detected (Fig. 8C). As
expected, when transfection was performed with the
double mutant construct (d ⁄ e+f⁄ g mut), a further
decrease of transcription activity was consistently
found () 32%). These results demonstrate that muta-
tions of Sp1-binding sites lead to a decrease of tran-
scription activity, suggesting a functional role of Sp1
in promoting P1-directed transcription of the AbH-J-J
gene locus.
0
Sp1/3
1
–
Antibody
D/Emer
Probe
23
Ab-Sp3
Ab-Sp1

Sp3
Negative control
Fold increase over negative control PCR
Cycle number
Relative Fluorescence Units
16 18 20 22 24 26 28 30 32 34 36
Nonimmune
serum ChIP
MEF2A ChIP
Input
TF
10
1
10
2
10
3
P1 promoter Q PCR
Sp1 ChIP
Sp3 ChIP
38
Negative control
P1 promoter
Sp1
ChIP
Sp3
ChIP
P1 promoter
1 2.5 7.5 10 12.5 15 20 25
*

*
5
A
C
B
Fig. 7. Interaction of Sp1 and Sp3 transcription factors with the AbH-J-J P1 promoter. (A) A supershift assay was performed using D ⁄ Emer
probe and 2 lg of nuclear extract from HeLa cells; the probe was incubated with nuclear exctract in the presence of antibodies (Ab) against
Sp1 or Sp3 factors. –, control sample in the absence of antibody. Arrows and stars indicate the specific and supershifted complexes, respec-
tively. (B) Quantitative real-time PCR profiles for the amplification of the P1 promoter are shown for a representative ChIP assay in which
chromatin from HeLa cells was immunoprecipitated using either Sp1 and Sp3 antiserum. The data (from duplicate determinations) demon-
strate the early exponential increase in fluorescence as a result of SYBR Green I incorporation into the amplifying P1 promoter fragment.
Sp1 ChIP, Sp3 ChIP and MEF-2A ChIP indicate duplicate curves from chromatin that have been immunoprecipitated with Sp1, Sp3 or MEF-
2A antiserum, respectively; nonimmune serum indicates curves from immunoprecipitations with nonimmune rabbit serum. Input represents
curves obtained from HeLa chromatin (1%) before immunoprecipitation. The cycle at which the amplification curve reaches threshold fluo-
rescence (TF), the threshold cycle, were used to determine the relative amounts of promoter in each sample. (C) In vivo association of Sp1
and Sp3 transcription factors with the AbH-J-J P1 promoter. The results, obtained from ChIP assay quantitative real-time PCR using Sp1
(Sp1 ChIP) or Sp3 (Sp3 ChIP) antiserum, were analyzed following the methodology described in Experimental procedures. The fold increase
over negative control PCR in each case compares the values obtained by P1 promoter amplification with the corresponding amplification of
a distal genomic region lacking Sp1-binding sites. All data represent the mean of two determinations in triplicate from each of at least two
independent immunoprecipitations. The asterisk indicates that the value is significantly different (P<0.05) from the control value.
G. Feriotto et al. Sp regulation of the AbH-J-J locus P1 promoter
FEBS Journal 274 (2007) 4476–4490 ª 2007 The Authors Journal compilation ª 2007 FEBS 4483
Transcriptional effect of Sp1 and Sp3 expression
vectors on P1 promoter activity
More functional evidence for the involvement of
Sp1-related proteins in P1-directed transcription was
obtained after cotransfection of Drosophila melano-
gaster SL-2 cells with the H () 512 ⁄ + 81) reporter
construct and pPAC-Sp1 and pPAC-Sp3 expression
vectors. As control, SL-2 cells were cotransfected with

pPAC empty vector. The SL-2 cells were chosen
because they do not contain Sp proteins [20] and are,
for this reason, employed in functional studies focused
on these transcription factors. The results obtained
indicate a significant increase of P1-directed transcrip-
tion in SL-2 cells transfected with pPAC-Sp1 and
pPAC-Sp3 (Fig. 9, + 45%). These data suggest that
Sp1 and Sp3 proteins play a positive role in P1-direc-
ted transcription. In agreement with this, triple trans-
fection of SL-2 cells with the H reporter construct, and
the pPAC-Sp1 and pPAC-Sp3 expression vectors, pro-
duced higher levels of P1-directed transcription (Fig. 9,
+ 130%).
Effect of a decoy oligonucleotide targeting Sp
family transcription factors on P1 promoter-
specific mRNA levels
In order to further confirm the role of Sp1-related pro-
teins in the transcription regulation of the AbH-J-J
locus, a transcription factor decoy (TFD) approach
was employed. This approach is based on the use of
double-stranded oligonucleotides for targeting tran-
scription factors, with consequent inhibition of their
interactions with promoters. The TFD approach has
been demonstrated to be very useful in inhibiting gene
expression when targeted at key transcription factors
[21]. We employed as a TFD molecule the double-
stranded oligonucleotide Sp1mer reported in Table 1.
Briefly, we transfected HeLa cells with 2 lgÆmL
)1
of

Sp1mer double-stranded oligonucleotide, or a scram-
bled sequence of the same length as a control. Twenty-
four hours later, RNA extraction was performed and
the transcripts relative to P1 promoter activity were
analyzed by using quantitative real-time RT-PCR. The
results obtained demonstrate that in cells treated with
the Sp1 decoy, a 64% reduction of transcription direc-
ted by the P1 promoter was obtained (Fig. 10). In con-
trast, scrambled oligonucleotide exibited no effects on
transcription of the analyzed mRNA (Fig. 10).
Discussion
The aim of the present work was to investigate in detail
one of the two putative promoter sequences regulating
the transcription of the AbH-J-J locus [1,13]. We iso-
lated and identified the 5¢-flanking region of exon 1 of
this locus. The cloned nucleotide sequence allowed us to
characterize the P1 promoter region, which is involved
in the regulation of AAH and humbug expression.
We have been able to identify transcripts relative to
P1 promoter activity in all tissues and cell lines ana-
lyzed [2,13,16]. Similar to many housekeeping gene
Relative Luc Activity
Sp1/3
6
Probe
Competitor
Probe
78
12
–

D/Emer
D/Emet
D/Emer
D/Emet
D/Emut
F/Gmut
F/Gmut
F/Gmer
345
Sp3
Sp1/3
Sp3
0
H (-512/+81)
d/e mut
f/g mut
d/e + f/g mut
50 75 100
A
C
B
Fig. 8. Mutational analysis of Sp1 elements in the AbH-J-J P1 pro-
moter. (A–B) EMSAs were performed using D ⁄ Emer probe or
mutant probes (D ⁄ Emut,F⁄ Gmut) and 2 lg of nuclear extract from
HepG2 cells. Probes were incubated with nuclear extracts in the
absence or in the presence (A) of 100-fold molar excess of compet-
ing oligonucleotides (Table 1). Arrows indicate the specific
complexes. (C) HepG2 cells were transfected with wild-type H
() 512 ⁄ + 81), single mutant Sp1-d ⁄ e element (d ⁄ e mut) and
Sp1-f ⁄ g element (f ⁄ g mut) or double mutant (d ⁄ e+f⁄ g mut)

AbH-J-J P1 promoter reporter constructs. Transient transfection
and luciferase assay were performed in triplicate, and the data
were normalized to Renilla luciferase activity and reported as ratios
(means ± SD) to the wild-type reporter construct H.
Relative Luc Activity (fold increase)
0
pPac
pPac Sp1
pPac Sp3
pPac Sp1/Sp3
H (-512/+81)
reporter construct
0.5 1.5 2.512
+ 45%
+ 130%
+ 45%
Fig. 9. Cotransfection of Drosophila SL2 cells with the P1 promoter
reporter construct and the Sp1 and ⁄ or Sp3 expression vectors. Dro-
sophila SL2 cells were cotransfected with ) 512 ⁄ + 81 P1 promoter
reporter construct (H) in the presence of Sp1 (pPac Sp1) and ⁄ or
Sp3 (pPac Sp3) expression vectors. The pPAC void vector was
used as cotransfection control plasmid. Results (mean ± SD) are
presented as fold increase in luciferase activity for cotransfection
over that for the promoter construct alone (pPAC) from three
experiments, each performed in triplicate.
Sp regulation of the AbH-J-J locus P1 promoter G. Feriotto et al.
4484 FEBS Journal 274 (2007) 4476–4490 ª 2007 The Authors Journal compilation ª 2007 FEBS
promoters, the region under investigation lacks a TATA
box and an initiator element [22,23]. In contrast, this
sequence is GC-rich and presents homologies with the

Sp1 consensus binding site, in agreement with previous
studies showing that the transcription of other TATA-
less promoters frequently involves the action of proxi-
mal Sp1 sites [24,25]. The mapping of the initiation of
transcription using 5¢-RACE revealed the presence of
different TSSs located around position ) 110 relative to
the translation initiation start in HeLa and RD cells.
We found, upstream of exon 1, cis-elements with nega-
tive and positive effects on transcription. Furthermore,
the maximal promoter is located within 512 nucleo-
tides of the principal TSS. Computer analysis indicates
the presence of at least 12 sites that match the struc-
tural determinants of Sp1-binding specificity, and the
screening by EMSA demonstrated three GC-rich ele-
ments that bind, with high efficiency, transcription fac-
tors belonging to the Sp family [14,15]. The migration
profiles of the complexes produced by nuclear extracts
binding to our GC-rich elements resemble the well-
known electrophoresis pattern obtained with the con-
sensus binding site for Sp1 [17–19]. Sp1 is a ubiquitous
DNA-binding protein that activates the transcription
of many cellular and viral genes [26,27]. Other tran-
scription factors, Sp2–Sp6, have been described that
have similar structural properties and DNA-binding
specificities as Sp1 [14,15]. Sp1 and Sp3 are the major
DNA-binding constituents observed in nuclear extracts
with Sp1 consensus element in EMSA [28]. The actions
of Sp1 and Sp3 at a given promoter appear to be com-
plex, but, in many cases, expression of Sp3 is thought
to antagonize the stimulatory actions of Sp1 on gene

transcription [29,30]. Moreover, Sp3 can act as an acti-
vator or repressor of Sp1-mediated activation, depend-
ing on the sequence context and the availability of
specific coactivators, corepressors or other transcrip-
tion factors [27,28]. The involvement of Sp1 ⁄ Sp3 bind-
ing was confirmed by supershift experiments and ChIP
assays. The effect of the Sp proteins on transcription
can be influenced by multiple factors, including phos-
phorylation, redox state, and acetylation [31]. The first
conclusion of the present article is that the P1 pro-
moter of the AbH-J-J locus contains Sp1 cis-acting
motifs that are putatively involved in the extensive
transcription directed by this promoter.
The second conclusion is that these interactions are
functionally relevant for transcriptional control. The
relevance of Sp1- and Sp3-binding sites for the tran-
scription regulation of the P1 promoter of the AbH-J-J
locus has been addressed with three complementary
approaches: (a) mutagenesis of Sp1 elements; (b) trans-
fection of Sp-null SL-2 cells with Sp1 ⁄ 3 expression vec-
tors; and (c) use of a TFD approach targeting Sp
factors.
The results obtained also demonstrate that Sp1 tran-
scription factors and Sp1-binding sites are involved in
the upregulation of the P1 promoter of the human
AbH-J-J gene locus. Although our results do not con-
clusively show the involvement of other factors in the
transcription of the AbH-J-J locus, we demonstrate
that some of the Sp1-binding activities are important
for transcription directed by the P1 promoter.

When the P1 and P2 promoter sequences of the
AbH-J-J locus are compared, important differences are
clearly detectable [13,16]. The most interesting result
emerging from studies focused on the P2 promoter is
that the Ca
2+
-dependent transcriptional factor MEF-2
activates the transcription of junctin, junctate and
AAH in muscular tissues and brain [13]. No Sp1-bind-
ing sites are present in the P2 promoter. In contrast,
the P1 promoter directs the expression of AAH and
humbug in many tissues and contains several function-
ally active Sp1-binding sites [1,2,13]. The finding that
the sequences present in the upstream P1 promoter are
significantly different from those of the P2 promoter
is, in our opinion, of great interest.
In addition, our data do not exclude a concerted reg-
ulation of the two promoter sequences based on inter-
actions between different transcription factors. There is
strong evidence demonstrating that transcription fac-
tors belonging to the Sp1 family interact with other
transcription factors, including some proteins binding
to the P2 promoter [13,32,33]. For instance, physical
interactions between Sp1 and MEF-2 have been dem-
onstrated in DNA-binding complexes formed in vitro
by nuclear extracts [34]. An intriguing possibility to be
further analyzed is the generation of a looping structure
directed by physical interactions between the P1 and P2
Relative mRNA content
0

- ODN
*
Scramble ODN
Sp1 ODN
0.25 0.5 0.75 0.1 1.25 1.5
Fig. 10. Effect of decoy oligonucleotide targeting of Sp transcription
factors on P1 promoter-specific mRNA levels. HepG2 cells were
transiently transfected with Sp1mer double-stranded decoy oligonu-
cleotide (Sp1 ODN, Table 1) for 24 h or remained untreated
(– ODN). The effect of scrambled, unrelated oligonucleotide (Scram-
ble ODN) is also reported. The cDNA obtained from total RNA was
subjected to quantitative real-time PCR for P1 promoter-specific
transcripts. Results are representative of three independent experi-
ments carried out in triplicate; the DDC
t
method was used to com-
pare gene expression data, and standard error of the mean was
calculated. Statistical significance: *P<0.05.
G. Feriotto et al. Sp regulation of the AbH-J-J locus P1 promoter
FEBS Journal 274 (2007) 4476–4490 ª 2007 The Authors Journal compilation ª 2007 FEBS 4485
promoters driven by transcription factors able to form
heterodimers, such as Sp1 and MEF-2.
From the practical point of view, the impact of Sp
proteins on the transcriptional regulation of this locus
will be of future interest, considering the potential con-
tribution of AAH and humbug to the infiltrating
growth of neoplasms by increasing cell migration and
enhancing proliferation and survival [3,5–9]. Inhibition
of AAH and humbug expression could represent an
attractive approach for gene therapy of infiltrating

tumors [3,10,35,36]. Other authors demonstrated that
Sp1 is a useful molecular marker in gastric cancer, and
upregulates genes involved in tumorigenesis, including
hepatocyte growth factor receptor (MET), vascular
endothelial growth factor, and BRCA1 [35,37–39]. In
addition, another study suggested that, in human neu-
roblastoma cells, insulin-like growth factor-1 signaling
is involved in the upregulation of AAH and humbug
[40]. Interestingly, in cardiac muscle cells, the tran-
scriptional activation of cyclin D3 and Glut1 promot-
ers by insulin-like growth factor-1 requires the
induction of Sp1 protein [41]. In discussing the possi-
ble implications of targeting Sp1 transcription factor(s)
with transcription factor decoy oligonucleotides, cau-
tion is required, due to the extensive involvement of
this transcription factor in the regulation of expression
of several genes, including genes involved in develop-
ment and cell cycle progression [27,38,42]. In this
respect, we cannot exclude the possibility that an indi-
rect effect of Sp1 might also be responsible for regula-
tion of this gene locus.
In any case, the data reported here on the functional
characterization of the P1 promoter of the AbH-J-J
locus demonstrate that this belongs to the class of
Sp1-controlled promoters, and it is different from the
P2 promoter, both for transcription factor-binding sig-
nals and potency in supporting transcription [13,16].
When the results given in the present article are con-
sidered together with previously published reports by
our and other research groups, it can be concluded

that the AbH-J-J locus contains at least two function-
ally distinct promoters (P1 and P2), and multiple alter-
native splicing sites, leading to the synthesis of the
functionally distinct proteins, AAH, humbug, junctin,
and junctate [1,2,13,16].
Experimental procedures
Cell culture
HepG2, RD, MCF7, HeLa, Hek293 and SL-2 cell lines,
obtained from the ATCC (Manassas, VA, USA), were cul-
tured as described previously [13,20,43,44].
RT-PCR
Total RNA from human adult normal tissue was purchased
from BD Biosciences Clontech (Palo Alto, CA). Total RNA
was harvested from cell lines by using the TRIzol Reagent
(Invitrogen, Carlsbad, CA). cDNA was synthesized from
1 lg of total RNA using ImProm-II (Promega, Madison,
WI). PCR was performed using the GeneAmp PCR System
9600 (Applied Biosystems, Foster City, CA, USA),
2 lL ⁄ 20 lL of cDNA, the e1F forward primer (Table 1),
and the e3R reverse primer, 5¢-TTC CTG AGA GTC
CGC CTT TC-3¢ (designed to amplify a 134 bp sequence
present in all the transcripts relative to P1 promoter activity
and spanning one intron in order to rule out amplification
from genomic DNA), 2 U of Taq polymerase, and 33 lm
dNTPs. PCR reactions were performed for a total of 30
cycles (97 °C for 15 s, 64 °C for 30 s, and 72 °C for 15 s).
Starting total RNA was normalized by performing RT-PCR
of the b
2
-microglobulin housekeeping gene (data not shown).

5¢-RACE
5¢-RACE was performed by using the GeneRacer kit (Invi-
trogen) with 2 lg of total RNA, isolated from HeLa and RD
cells. cDNA was synthesized using the e5R primer
(5¢-AAT AAA ACT TTG GCA TCA TCC ACA TCA AAA
TCT CC-3¢), complementary to an exon 5 sequence of the
AbH-J-J locus (Fig. 1). After ligation to the RNA oligonu-
cleotide, the cDNA was used as template for PCR, which
was performed with the GeneRacer kit anchor primer, and
the gene-specific e3R primer (Fig. 2). A dilution of the origi-
nal PCR was reamplified using the nested e1R primer
(5¢-TTC TCG TCG CCG TTG TCG TCG TC-3¢) comple-
mentary to an exon 1 sequence. PCR products were analyzed
by electrophoresis, and amplified DNA purified from gel
slices was cloned with the pGEM-T Vector System (Pro-
mega). Recombinant plasmids were sequenced with the ABI
PRISM Big Dye terminator cycle sequencing ready reaction
kit using the ABI PRISM 377 DNA sequencer (PE Applied
Biosystems, Foster City, CA). The stronger transcription ini-
tiation site, defined by the most represented 5¢-ends, was
numbered + 1 and all the other sites are relative to it.
Cloning of the AbH-J-J P1 promoter sequences
and reporter plasmid construction
The 3.1 kb partially digested PstI fragment of the human
chromosome 8 BAC 1 clone encompassing AbH-J-J exon 1
(Fig. 1) [1] was cloned into the pUC18 vector and
sequenced. The sequence corresponding to ) 1683 ⁄ + 81,
relative to the transcription initiation site, was amplified by
using the GeneAmp High Fidelity PCR System (Applied
Biosystems, Foster City, CA), and the XF (5¢-CCG CTC

GAG TGC AGT GTG AAA ACG GAC TAA TAC AGT
G-3¢) forward and NR (5¢-CAT GCC ATG GTG GCG
Sp regulation of the AbH-J-J locus P1 promoter G. Feriotto et al.
4486 FEBS Journal 274 (2007) 4476–4490 ª 2007 The Authors Journal compilation ª 2007 FEBS
GAC CTC CTT CAG TGC-3¢) reverse primers, containing
an XhoI and an NcoI restriction site, respectively. The PCR
product was cloned into the XhoI–NcoI restriction sites of
pGL3-basic firefly luciferase reporter plasmid (Promega).
Ten serial deletion constructs were generated from this
recombinant plasmid using the ExoIII ⁄ S1 Deletion kit
(Fermentas, Vilnius, Lithuania). The sequences of all the
constructs were confirmed by DNA sequencing. The AbH-
J-J P2 promoter reporter construct with maximal promoter
activity () 265 ⁄ + 115) was obtained from the pGL3-basic
vector as previously described [13].
Transient transfection and dual luciferase assay
Cells were seeded at 50–70% confluence in 16 mm wells.
Transfection was performed after 24 h using 1.5–2 lgof
lipofectamine 2000 (Life Technologies, Gaithersburg, MD),
75 ng of pRL-TK vector (Promega), which contains the
Renilla luciferase gene as a transfection efficiency control,
and 0.75 lg of firefly luciferase reporter plasmid per well.
Lysates were prepared 24 h after transfection by adding
100 lL of passive lysis buffer (Dual Luciferase Reporter
Assay System; Promega). Luciferase activity was determined
with an analytical luminometer (model TD-20 ⁄ 20; Turner
Designs, Sunnyvale, CA); the light intensity produced by
firefly luciferase (test plasmid) was normalized to that
produced by Renilla luciferase (control plasmid). Promoter
activity was expressed as fold induction relative to that of

cells transfected with the pGL3-basic vector [13]. At least
three independent experiments were performed using each
construct. Drosophila expression vectors of human Sp1 and
Sp3 factors (pPAC Sp1 and pPAC Sp3) were kindly
provided by G Suske (Institut fu
¨
r Molekularbiologie und
Tumorforschung, Philipps University, Marburg, Germany).
Briefly, SL2 cells were seeded at 3 · 10
5
cells ⁄ well. Transfec-
tion was performed using 2.5 lg of lipofectamine 2000 (Life
Technologies), 0.6 lg of Sp1, Sp3 expression vector or pPAC
void vector and 0.6 lg of firefly luciferase reporter plasmid
per well. Lysates were prepared 72 h after transfection, and
luciferase activity was determined. The light intensity was
normalized against total protein concentration.
Nuclear extract preparation
Nuclear extracts were prepared as described by Andrews &
Faller [45]. Briefly, cells were collected, washed twice with
ice-cold NaCl ⁄ P
i
, and resuspended in 0.4 mL (10
7
cells) of
hypotonic lysis buffer (10 mm Hepes ⁄ KOH, pH 7.9, 10 mm
KCl, 1.5 mm MgCl
2
, 0.5 mm dithiothreitol, and 0.2 mm
phenylmethanesulfonyl fluoride). After incubation on ice for

10 min, the mixture was vortexed for 10 s, and nuclei were
pelleted by centrifugation at 12 000 g for 10 s (centrifuge
5411R, F45-24-11 rotor, Eppendorf, Hamburg, Germany);
nuclear proteins were then extracted by incubation of the
nuclei for 20 min on ice with intermittent gentle vortexing in
20 mm Hepes ⁄ KOH (pH 7.9), 25% glycerol, 420 mm NaCl,
1.5 mm MgCl
2
, 0.2 mm EDTA, 0.5 mm dithiothreitol,
0.2 mm phenylmethanesulfonyl fluoride, 1 lgÆmL
)1
aproti-
nin, 1 lgÆmL
)1
leupeptin, 2 mm Na
3
VO
4
, and 10 m m NaF
(Sigma-Aldrich, St Louis, MO, USA); cell debris was
removed by centrifugation at 12 000 g for 5 min at 4 °C (cen-
trifuge 5411R, F45-24-11 rotor, Eppendorf). The Bradford
method (DC Protein Assay; Bio-Rad, Hercules, CA, USA)
was used to measure the protein concentration in the extract,
which was then stored in aliquots at ) 80 °C.
EMSA
The double-stranded oligonucleotides used in the EMSA are
reported in Table 1. Three picomoles of oligonucleotide were
32
P-labeled using OptiKinase (GE Healthcare, Chalfont St

Giles, UK), annealed to an excess of complementary oligonu-
cleotide, and purified from [
32
P]ATP[cP] (Applied Biosys-
tems). Binding reactions were performed by incubating 2 lg
of nuclear extract and 16 fmol of
32
P-labeled double-stranded
oligonucleotide, with or without competitor, in a final vol-
ume of 20 lL of binding buffer [20 mm Tris ⁄ HCl, pH 7.5,
50 mm KCl, 1 mm MgCl
2
, 0.2 mm EDTA, 5% glycerol,
1mm dithiothreitol, 0.01% Triton X-100, 0.05 lgÆlL
)1
of
poly(dI-dC), 0.05 lgÆlL
)1
of a single-stranded oligonucleo-
tide] [46]. Competitor (a 6–100-fold excess of unlabeled oligo-
nucleotides) and nuclear extract mixture were incubated for
15 min, and then probe was added to the reaction. After a
further incubation for 30 min at room temperature, samples
were immediately loaded onto a 6% nondenaturing
polyacrylamide gel containing 0.25 · Tris ⁄ borate ⁄ EDTA
(22.5 mm Tris, 22.5 mm boric acid, 0.5 mm EDTA, pH 8)
buffer. Electrophoresis was carried out at 200 V. Gels were
vacuum heat-dried and subjected to autoradiography.
Supershift assays were performed as described previously [13]
by using 2 lg of commercially available antibodies specific

for Sp1 (sc-59X) and Sp3 (sc-644X) transcription factors
(Santa Cruz Biotechnology, Inc., Santa Cruz, CA).
Site-directed mutagenesis
Mutagenesis was performed by using a QuickChange site-
directed mutagenesis kit (Stratagene, La Jolla, CA, USA).
The mutant oligonucleotides F ⁄ Gmut and D ⁄ Emut (Table 1)
plus 9 ⁄ 12mer flanking nucleotide of the corresponding P1
sequence (and their complementary sequences) were used
to inactivate specific binding in the pGL3 construct con-
taining the ) 512 ⁄ + 81 promoter sequence. The nucleotide
sequences of the mutant constructs were confirmed by DNA
sequencing.
ChIP assays
ChIP assays were performed by using the Chromatin
Immunoprecipitation Assay Kit (Upstate Biotechnology,
G. Feriotto et al. Sp regulation of the AbH-J-J locus P1 promoter
FEBS Journal 274 (2007) 4476–4490 ª 2007 The Authors Journal compilation ª 2007 FEBS 4487
Inc., Lake Placid, NY). Briefly, 6 · 10
7
HeLa cells (from
five 15 cm plates) were treated, for 10 min at room temper-
ature, with 1% formaldehyde culture medium. After wash-
ing in NaCl ⁄ P
i
, glycine was added to a final concentration
of 0.125 m. The cells were then suspended in 1.5 mL of
lysis buffer (1% SDS, 10 mm EDTA, and 50 mm Tris ⁄ Cl,
pH 8.1) plus protease inhibitors (1 lgÆmL
)1
pepstatin A,

1 lgÆmL
)1
leupeptin, 1 lgÆ mL
)1
aprotinin, and 1 mm phenyl-
methanesulfonyl fluoride), and the chromatin was subjected
to sonication (using a Sonics Vibracell VC130 sonicator
with a 2 mm probe; Sonics and Materials, Newtown, CT,
USA). Fifteen 15 s sonication pulses at 30% amplitude were
required to shear chromatin to 200–1000 bp fragments.
Aliquots of 0.2 mL of chromatin were diluted to 2 mL in
ChIP dilution buffer containing protease inhibitors and then
cleared with 75 lL of salmon sperm DNA ⁄ protein A agarose
50% gel slurry (Upstate Biotechnology) for 1 h at 4 °C
before incubation on a rocking platform with either 6–10 lg
of specific antiserum [Sp3, MEF-2A and myogenin (Santa
Cruz Biotechnology); Sp1 (Upstate Biotechnology)] or nor-
mal rabbit serum (Upstate Biotechnology). Twenty
microliters of diluted chromatin was saved and stored for
later PCR analysis as 1% of the input extract. Incubations
were done overnight at 4 °C and continued for an additional
1 h after the addition of 60 lL of protein A agarose slurry.
Thereafter, the agarose pellets were washed consecutively
with low-salt, high-salt and LiCl buffers. DNA–protein com-
plexes were recovered from the pellets with elution buffer
(0.1 m NaHCO
3
with 1% SDS), and crosslinks were reversed
by incubating overnight at 65 °C with 0.2 m NaCl. The sam-
ples were treated with RNaseA and proteinase K, extracted

with phenol ⁄ chloroform, and ethanol-precipitated. The pel-
leted DNAs were washed with 70% ethanol and dissolved in
40 lL of Tris ⁄ EDTA. Two-microliter aliquots were used for
each real-time PCR reaction to quantitate immunoprecipitat-
ed promoter fragments [47].
Real-time PCR quantitation of immunoprecipitated
promoter fragments
For quantitative real-time PCR, each 25 lL reaction mix-
ture contained 2 lL of template DNA (from chromatin
immunoprecipitations), 10 pmol of primers (Table 1), and
1 · iQ SYBR Green Supermix (Bio-Rad). Real-time PCR
reactions were performed for a total of 40 cycles (97 °C for
15 s, 68 °C for 30 s, and 72 °C for 20 s) using an iCycler
IQ (Bio-Rad). The relative proportions of immunoprecipi-
tated promoter fragments were determined on the basis of
the threshold cycle (T
c
) value for each PCR reaction. Real-
time PCR data analysis followed the methodology previ-
ously described [47,48]. A DT
c
value was calculated for each
sample by subtracting the T
c
value for the input (to
account for differences in amplification efficiencies and
DNA quantities before immunoprecipitation) from the T
c
value obtained for the immunoprecipitated sample. A DDT
c

value was then calculated by subtracting the DT
c
value
for the sample immunoprecipitated with specific antiserum
from the DT
c
value for the corresponding control sample
immunoprecipitated with nonimmune rabbit serum. Fold
differences (specific antiserum ChIP relative to nonimmune
serum control ChIP) were then determined by the equation
2
DDT
c
. PCR was also performed using control primers that
amplify a 197 bp genomic region lacking Sp1-binding sites.
The DDT
c
values were then calculated as previously
described, and the negative control PCR data were used to
normalize quantitative results from different immunoprecip-
itations. Each sample was quantitated in triplicate on at
least two separate occasions and from at least two indepen-
dent immunoprecipitations. Mean ± SD values were deter-
mined for each fold difference.
TFD approach targeting Sp proteins
The effect of the Sp1-1 consensus oligonucleotide decoy
on P1-directed transcription of the AbH-J-J locus was
evaluated by adding 2 lgÆmL
)1
of Sp1mer double-stranded

oligonucleotide (Table 1), or a scrambled sequence of the
same length as a control, and 4 lgÆmL
)1
of lipofectamine
2000 to HeLa cells seeded at 50–70% confluence in
16 mm wells [21]. Twenty-four hours later, RNA extrac-
tion and reverse transcription were performed. Aliquots,
1 ⁄ 20 lL, of cDNA were used for each SYBR Green real-
time PCR reaction to quantitate the depletion of AbH-J-J
transcripts, using the e1F forward primer and the e5R
reverse primer (Table 1) designed to amplify a 297 bp
sequence present in all the mRNAs relative to P1 pro-
moter activity. Amplification of human hydroxymethyl-
bilane synthase cDNA served as an internal standard
(housekeeping gene). Real-time PCR reactions were per-
formed for a total of 40 cycles (95 °C for 10 s, 66 °C for
30 s, and 72 °C for 50 s). The DDC
t
method was used to
compare gene expression data.
Statistical analysis
All the data were normally distributed and presented as
mean ± SD. Statistical differences between groups were
compared using one-way anova software. Statistical signifi-
cance was assumed at P < 0.05.
Acknowledgements
This work was supported in part by grants from FIRB
and Ministero Universita
`
e Ricerca Scientifica e Tecno-

logica (60% and 40%), the Department of Anesthesia
Kantosspital Basel, HPRN-CT-2002-00331 from the
European Union, the Italian Space Agency and the
Swiss Muscle Foundation. R. Gambari is supported by
grants from AIRC, COFIN-2004, and FIRB.
Sp regulation of the AbH-J-J locus P1 promoter G. Feriotto et al.
4488 FEBS Journal 274 (2007) 4476–4490 ª 2007 The Authors Journal compilation ª 2007 FEBS
References
1 Treves S, Feriotto G, Moccagatta L, Gambari R &
Zorzato F (2000) Molecular cloning, expression, func-
tional characterization, chromosomal localization, and
gene structure of junctate, a novel integral calcium bind-
ing protein of sarco (endo) plasmic reticulum mem-
brane. J Biol Chem 275, 39555–39568.
2 Dinchuk JE, Henderson NL, Burn TC, Huber R, Ho
SP, Link J, O’Neil KT, Focht RJ, Scully MS, Hollis JM
et al. (2000) Aspartyl beta-hydroxylase (Asph) and an
evolutionarily conserved isoform of Asph missing the
catalytic domain share exons with junctin. J Biol Chem
275, 39543–39554.
3 Maeda T, Sepe P, Lahousse S, Tamaki S, Enjoji M,
Wands JR & de la Monte SM (2003) Antisense oligode-
oxynucleotides directed against aspartyl (asparaginyl)
beta-hydroxylase suppress migration of cholangiocarci-
noma cells. J Hepatol 386, 15–22.
4 Gundogan F, Elwood G, Greco D, Rubin LP, Pinar H,
Carlson RI, Wands JR & de la Monte SM (2007) Role
of aspartyl-(asparaginyl) beta-hydroxylase in placental
implantation: Relevance to early pregnancy loss. Hum
Pathol 38, 50–59.

5 Wang J, de la Monte SM, Sabo E, Kethu S, Tavares R,
Branda M, Simao L, Wands JR & Resnick MB (2007)
Prognostic value of humbug gene overexpression in
stage II colon cancer. Hum Pathol 38, 17–25.
6 Ince N, de la Monte SM & Wands JR (2000) Overex-
pression of human aspartyl (asparaginyl) beta-hydroxy-
lase is associated with malignant transformation. Cancer
Res 60, 1261–1266.
7 Sepe PS, Lahousse SA, Gemelli B, Chang H, Maeda T,
Wands JR & de la Monte SM (2002) Role of the aspar-
tyl-asparaginyl-beta-hydroxylase gene in neuroblastoma
cell motility. Lab Invest 82, 881–891.
8 Palumbo KS, Wands JR, Safran H, King T, Carlson RI
& de la Monte SM (2002) Human aspartyl (asparaginyl)
beta-hydroxylase monoclonal antibodies: potential
biomarkers for pancreatic carcinoma. Pancreas 25,
39–44.
9 Maeda T, Taguchi K, Aishima S, Shimada M, Hintz D,
Larusso N, Gores G, Tsuneyoshi M, Sugimachi K,
Wands JR et al. (2004) Clinicopathological correlates of
aspartyl (asparaginyl) beta-hydroxylase over-expression
in cholangiocarcinoma. Cancer Detect Prev 28, 313–318.
10 de la Monte SM, Tamaki S, Cantarini MC, Ince N,
Wiedmann M, Carter JJ, Lahousse SA, Califano S,
Maeda T, Ueno T et al. (2006) Aspartyl-(asparaginyl)-
beta-hydroxylase regulates hepatocellular carcinoma
invasiveness. J Hepatol 44, 971–983.
11 Stamboulian S, Moutin MJ, Treves S, Pochon N, Grun-
wald D, Zorzato F, De Waard M, Ronjat M & Arnoult C
(2005) Junctate, an inositol 1,4,5-triphosphate receptor

associated protein, is present in rodent sperm and binds
TRPC2 and TRPC5 but not TRPC1 channels. Dev Biol
286, 326–337.
12 Treves S, Franzini-Armstrong C, Moccagatta L,
Arnoult C, Grasso C, Schrum A, Ducreux S, Zhu MX,
Mikoshiba K, Girard T et al. (2004) Junctate is a key
element in calcium entry induced by activation of InsP3
receptors and ⁄ or calcium store depletion. J Cell Biol
166, 537–548.
13 Feriotto G, Finotti A, Volpe P, Treves S, Ferrari S,
Angelelli C, Zorzato F & Gambari R (2005) Myocyte
enhancer factor 2 activates promoter sequences of the
human AbetaH-J-J locus, encoding aspartyl-beta-
hydroxylase, junctin, and junctate. Mol Cell Biol 25,
3261–3275.
14 Suske G (1999) The Sp-family of transcription factors.
Gene 238, 291–300.
15 Suske G, Bruford E & Philipsen S (2005) Mammalian
SP ⁄ KLF transcription factors: bring in the family.
Genomics 85, 551–556.
16 Feriotto G, Finotti A, Breveglieri G, Treves S, Zorzato F
& Gambari R (2006) Multiple levels of control of the
expression of the human A beta H-J-J locus encoding
aspartyl-beta-hydroxylase, junctin, and junctate. Ann NY
Acad Sci 1091, 184–190.
17 Kiela PR, LeSueur J, Collins JF & Ghishan FK (2003)
Transcriptional regulation of the rat NHE3 gene. Func-
tional interactions between GATA-5 and Sp family
transcription factors. J Biol Chem 278, 5659–5668.
18 Jeong JH, Orvis J, Kim JW, McMurtrey CP, Renne R

& Dittmer DP (2004) Regulation and autoregulation of
the promoter for the latency-associated nuclear antigen
of Kaposi’s sarcoma-associated herpesvirus. J Biol
Chem 279, 16822–16831.
19 Li M & Kellems RE (2003) Sp1 and Sp3 are important
regulators of AP-2gamma gene transcription. Biol
Reprod 69, 1220–1230.
20 Hagen G, Muller S, Beato M & Suske G (1994) Sp1-
mediated transcriptional activation is repressed by Sp3.
EMBO J 13, 3843–3851.
21 Penolazzi L, Lambertini E, Borgatti M, Piva R,
Cozzani M, Giovannini I, Naccari R, Siciliani G &
Gambari R (2003) Decoy oligo deoxynucleotides
targeting NF-kappaB transcription factors: induction
of apoptosis in human primary osteoclasts. Biochem
Pharmacol 66, 1189–1198.
22 Jiang P, Kumar A, Parrillo JE, Dempsey LA, Platt JL,
Prinz RA & Xu X (2002) Cloning and characterization
of the human heparanase-1 (HPR1) gene promoter: role
of GA-binding protein and Sp1 in regulating HPR1
basal promoter activity. J Biol Chem 277, 8989–8998.
23 Izumi H, Ise T, Murakami T, Torigoe T, Ishiguchi H,
Uramoto H, Yoshida Y, Yoshida T, Tanabe M &
Kohno K (2003) Structural and functional characteriza-
tion of two human V-ATPase subunit gene promoters.
Biochim Biophys Acta 1628, 97–104.
G. Feriotto et al. Sp regulation of the AbH-J-J locus P1 promoter
FEBS Journal 274 (2007) 4476–4490 ª 2007 The Authors Journal compilation ª 2007 FEBS 4489
24 Wong CC & Lee WM (2002) The proximal cis-acting
elements Sp1, Sp3 and E2F regulate mouse mer gene

transcription in Sertoli cells. Eur J Biochem 269, 3789–
3800.
25 Tapias A, Monasterio P, Ciudad CJ & Noe V (2005)
Characterization of the 5¢-flanking region of the human
transcription factor Sp3 gene. Biochim Biophys Acta
1730, 126–136.
26 Hilton TL, Li Y, Dunphy EL & Wang EH (2005)
TAF1 histone acetyltransferase activity in Sp1 activa-
tion of the cyclin D1 promoter. Mol Cell Biol 25, 4321–
4332.
27 Li L, He S, Sun JM & Davie JR (2004) Gene regulation
by Sp1 and Sp3. Biochem Cell Biol 82 , 460–471.
28 He S, Sun JM, Li L & Davie JR (2005) Differential
intranuclear organization of transcription factors Sp1
and Sp3. Mol Biol Cell 16, 4073–4083.
29 Yang Y, Hwang CK, Junn E, Lee G & Mouradian
MM (2000) ZIC2 and Sp3 repress Sp1-induced activa-
tion of the human D1A dopamine receptor gene. J Biol
Chem 275, 38863–38869.
30 Yu B, Datta PK & Bagchi S (2003) Stability of the
Sp3–DNA complex is promoter-specific: Sp3 efficiently
competes with Sp1 for binding to promoters containing
multiple Sp-sites. Nucleic Acids Res 31, 5368–5376.
31 Sapetschnig A, Koch F, Rischitor G, Mennenga T &
Suske G (2004) Complexity of translationally controlled
transcription factor Sp3 isoform expression. J Biol
Chem 279, 42095–42105.
32 Fluck CE & Miller WL (2004) GATA-4 and GATA-6
modulate tissue-specific transcription of the human gene
for P450c17 by direct interaction with Sp1. Mol Endo-

crinol 18, 1144–1157.
33 Loeffler S, Fayard B, Weis J & Weissenberger J (2005)
Interleukin-6 induces transcriptional activation of vascu-
lar endothelial growth factor (VEGF) in astrocytes in
vivo and regulates VEGF promoter activity in glioblas-
toma cells via direct interaction between STAT3 and
Sp1. Int J Cancer 115, 202–213.
34 Grayson J, Bassel-Duby R & Williams RS (1998)
Collaborative interactions between MEF-2 and Sp1 in
muscle-specific gene regulation. J Cell Biochem 70, 366–
375.
35 Liang H, O’Reilly S, Liu Y, Abounader R, Laterra J,
Maher VM & McCormick JJ (2004) Sp1 regulates
expression of MET, and ribozyme-induced down-regula-
tion of MET in fibrosarcoma-derived human cells
reduces or eliminates their tumorigenicity. Int J Oncol
24, 1057–1067.
36 Lou Z, O’Reilly S, Liang H, Maher VM, Sleight SD &
McCormick JJ (2005) Down-regulation of overexpressed
sp1 protein in human fibrosarcoma cell lines inhibits
tumor formation. Cancer Res 65, 1007–1017.
37 Yao JC, Wang L, Wei D, Gong W, Hassan M, Wu TT,
Mansfield P, Ajani J & Xie K (2004) Association
between expression of transcription factor Sp1 and
increased vascular endothelial growth factor expression,
advanced stage, and poor survival in patients with
resected gastric cancer. Clin Cancer Res 10, 4109–
4117.
38 Safe S & Abdelrahim M (2005) Sp transcription factor
family and its role in cancer. Eur J Cancer 41, 2438–

2448.
39 Maor S, Papa MZ, Yarden RI, Friedman E, Lerenthal Y,
Lee SW, Mayer D & Werner H (2007) Insulin-like growth
factor-I controls BRCA1 gene expression through activa-
tion of transcription factor Sp1. Horm Metab Res 39,
179–185.
40 Lahousse SA, Carter JJ, Xu XJ, Wands JR & de la
Monte SM (2006) Differential growth factor regulation
of aspartyl-(asparaginyl)-beta-hydroxylase family genes
in SH-Sy5y human neuroblastoma cells. BMC Cell Biol
7
, 41–62.
41 Li T, Chen YH, Liu TJ, Jia J, Hampson S, Shan YX,
Kibler D & Wang PH (2003) Using DNA microarray to
identify Sp1 as a transcriptional regulatory element of
insulin-like growth factor 1 in cardiac muscle cells. Circ
Res 93, 1202–1209.
42 Zhao C & Meng A (2005) Sp1-like transcription factors
are regulators of embryonic development in vertebrates.
Dev Growth Differ 47, 201–211.
43 Endres K, Postina R, Schroeder A, Mueller U &
Fahrenholz F (2005) Shedding of the amyloid precursor
protein-like protein APLP2 by disintegrin-metallopro-
teinases. FEBS J 272 , 5808–5820.
44 Zampieri L, Bianchi P, Ruff P & Arbuthnot P (2002)
Differential modulation by estradiol of P-glycoprotein
drug resistance protein expression in cultured MCF7
and T47D breast cancer cells. Anticancer Res 22, 2253–
2259.
45 Andrews NC & Faller DV (1991) A rapid microprepa-

ration technique for extraction of DNA-binding pro-
teins from limiting numbers of mammalian cells. Nucleic
Acids Res 19, 2499.
46 Mischiati C, Feriotto G, Borgatti M, Giacomini P &
Gambari R (2000) Characterization of a major histo-
compatibility complex class II, X-box-binding protein
enhancing tat-induced transcription directed by the
human immunodeficiency virus type 1 long terminal
repeat. J Virol 74, 8989–9001.
47 Chakrabarti SK, James JC & Mirmira RG (2002)
Quantitative assessment of gene targeting in vitro and
in vivo by the pancreatic transcription factor, Pdx1.
Importance of chromatin structure in directing pro-
moter binding. J Biol Chem 277, 13286–13293.
48 Christenson LK, Stouffer RL, Strauss JF III (2001)
Quantitative analysis of the hormone-induced hyperacet-
ylation of histone H3 associated with the steroidogenic
acute regulatory protein gene promoter. J Biol Chem
276, 27392–27399.
Sp regulation of the AbH-J-J locus P1 promoter G. Feriotto et al.
4490 FEBS Journal 274 (2007) 4476–4490 ª 2007 The Authors Journal compilation ª 2007 FEBS