Báo cáo khoa học: Analyses of co-operative transitions inPlasmodium falciparumb-ketoacyl acyl carrier protein reductase upon co-factor and acyl carrier protein binding pdf

Analyses of co-operative transitions in Plasmodium
falciparum b-ketoacyl acyl carrier protein reductase upon
co-factor and acyl carrier protein binding
Krishanpal Karmodiya and Namita Surolia
Molecular Biology and Genetics Unit, Jawaharlal Nehru Centre for Advanced Scientific Research, Jakkur, Bangalore, India
Malaria is one of the leading causes of morbidity and
mortality in the tropics, with 300–500 million clinical
cases and 1.5–2.7 million deaths per year [1,2]. Nearly
all the fatal cases are caused by Plasmodium falcipa-
rum. The acquisition of resistance by this parasite to
conventional antimalarial drugs, such as chloroquine,
is growing at an alarming rate and the increasing bur-
den of malaria caused by drug-resistant parasites has
led investigators to seek novel antimalarial drug targets
[3].
There are two distinct architectures for fatty acid
synthesis in living organisms. Our recent demonstra-
tion of the occurrence of the type II fatty acid synthase
(FAS) pathway in the malaria parasite and its inhibi-
tion by triclosan, an inhibitor of a key enzyme (enoyl-
acyl carrier protein reductase) of the type II FAS
Keywords
b-ketoacyl-ACP reductase; cofactor;
conformational change; fluorescence
quenching; Plasmodium
Correspondence
N. Surolia, Molecular Biology and Genetics
Unit, Jawaharlal Nehru Centre for Advanced
Scientific Research, Jakkur, Bangalore-
560064, India
Fax: +91 80 22082766

Tel: +91 80 22082820 ⁄ 21
E-mail:
(Received 12 April 2006, revised 15 June
2006, accepted 10 July 2006)
doi:10.1111/j.1742-4658.2006.05412.x
The type II fatty acid synthase pathway of Plasmodium falciparum is a
validated unique target for developing novel antimalarials because of its
intrinsic differences from the type I pathway operating in humans.
b-Ketoacyl-acyl carrier protein reductase is the only enzyme of this pathway
that has no isoforms and thus selective inhibitors can be developed for this
player of the pathway. We report here intensive studies on the direct inter-
actions of Plasmodium b-ketoacyl-acyl carrier protein reductase with its
cofactor, NADPH, acyl carrier protein, acetoacetyl-coenzyme A and other
ligands in solution, by monitoring the intrinsic fluorescence (k
max
334 nm)
of the protein as a result of its lone tryptophan, as well as the fluorescence
of NADPH (k
max
450 nm) upon binding to the enzyme. Binding of the
reduced cofactor makes the enzyme catalytically efficient, as it increases
the binding affinity of the substrate, acetoacetyl-coenzyme A, by 16-fold.
The binding affinity of acyl carrier protein to the enzyme also increases by
approximately threefold upon NADPH binding. Plasmodium b-ketoacyl-
acyl carrier protein reductase exhibits negative, homotropic co-operative
binding for NADPH, which is enhanced in the presence of acyl carrier pro-
tein. Acyl carrier protein increases the accessibility of NADPH to b-keto-
acyl-acyl carrier protein reductase, as evident from the increase in the
accessibility of the tryptophan of b-ketoacyl-acyl carrier protein reductase
to acrylamide, from 81 to 98%. In the presence of NADP

+
, the reaction
proceeds in the reverse direction (K
a
¼ 23.17 lm
)1
). These findings provide
impetus for exploring the influence of ligands on the structure–activity rela-
tionship of Plasmodium b-ketoacyl-acyl carrier protein reductase.
Abbreviations
ACP, acyl carrier protein; apo-PfACP, Plasmodium falciparum acyl carrier protein (apo form); holo-PfACP, Plasmodium falciparum acyl carrier
protein (holo form); FabG, b-ketoacyl-ACP reductase; FAS, fatty acid synthase, PfFabG, Plasmodium falciparum b-ketoacyl-ACP reductase;
SDR, short-chain alcohol dehydrogenase ⁄ reductase.
FEBS Journal 273 (2006) 4093–4103 ª 2006 The Authors Journal compilation ª 2006 FEBS 4093
pathway, pointed to the pivotal role of this pathway
for the survival of malaria parasites [4,5]. The type II
FAS pathway of Plasmodium has discrete enzymes for
each step of the pathway, as opposed to the type I
FAS, found in humans, which is a multifunctional
enzyme [6,7]. Also, the type II fatty acid biosynthetic
pathway in P. falciparum is one of the pathways speci-
fic to its ‘plastid’ and has been validated as a unique
target for developing new antimalarials [8–10].
During the elongation cycle of FAS II, the acyl
chain covalently attached to the acyl carrier protein
(ACP) is elongated successively by two carbon units
by the action of four enzymes acting consecutively.
First, b-ketoacyl-ACP synthase (either FabB or FabF)
elongates the acyl-ACP of the C
n

acyl chain to a C
n+2
b-ketoacyl form. The b-ketoacyl-ACP thus formed
is reduced to b-hydroxyacyl-ACP by an NADPH-
dependent b-ketoacyl-ACP reductase (FabG). The
b-hydroxyacyl group is then dehydrated to an enoyl-
ACP by a b-hydroxyacyl-ACP dehydratase (FabZ or
FabA). Reduction of the enoyl group by an enoyl-
ACP reductase (FabI, FabK or FabL) finally produces
C
n+2
acyl-ACP, which is ready to re-enter the cycle,
become hydrolyzed from ACP for the synthesis of
phospholipids or sphingolipids, or become diverted for
other modifications [11,12].
FabG is ubiquitously expressed in bacteria [13], is
highly conserved across species, and is the only known
isoform that functions as a ketoacyl reductase in the
FAS II system. The primary structure of FabG from
the parasite reveals that it belongs to the short-chain
alcohol dehydrogenase ⁄ reductase (SDR) family of
enzymes, whose members catalyze a broad range of
reduction and dehydrogenation reactions using a nuc-
leotide cofactor [14,15]. P. falciparum FabG (PfFabG)
has 48% sequence identity with its counterpart from
Brassica napus, with which it shares stronger homology
than with the Escherichia coli enzyme. Solution studies
on detailed interactions of PfFabG with its cofactor,
substrate and holo-acyl-carrier protein (ACP, unless
otherwise indicated) to have insight into its co-opera-

tivity and catalytic mechanism, are lacking. The intrin-
sic fluorescence of tryptophan in a protein is sensitive
to its surroundings, a characteristic that has made it
an invaluable and popular tool for studying protein–
ligand interactions, and FabG, with a lone tryptophan,
provides an ideal system for studying ligand-induced
conformational changes in it. Here, we report subtle
aspects of the interactions between FabG with its co-
factor, acetoacetyl-coenzyme A (acetoacetyl-CoA) and
also with ACP, with emphasis on association con-
stants, number of binding sites and the co-operativities
involved therein.
Results
Cloning, expression, purification and kinetic
analyses of FabG
FabG (acc. no.: PFI1125c) potentially resides in the
apicoplast of Plasmodium and therefore possesses a
bipartite signal and transit peptide at the N terminus
for correct targeting to the apicoplast. On the basis of
the FabG sequence in PlasmoDB, the start site of the
mature protein, from nucleotides 132 to 903, was
cloned. The deduced amino acid sequence correspon-
ded to the mature protein, with a predicted molecular
mass of 31.0 kDa [16]. Mature FabG was expressed in
E. coli BL21 (DE3) codon plus cells with a C-terminal
His-tag. The soluble protein was purified to homogen-
eity on a Ni-nitrilotriacetic acid affinity column. On
SDS ⁄ PAGE, the purified protein yielded a monomeric
M
r

of 31 000 (Fig. 1A) and on Superdex
tm
200 yielded
an M
r
of 110 000 ± 2500 (Fig. 1B), demonstrating
that it exists as a tetramer in solution (3 mm Hepes,
pH 7.5, 100 mm NaCl, 2 mm b-mercaptoethanol and
10% glycerol). The enzyme has a K
m
value for the sub-
strate acetoacetyl-CoA of 0.43 ± 0.05 mm and a K
m
value for NADPH of 42.6 ± 0.05 lm. The specific
activity of the enzyme with acetoacetyl-CoA is
59.8 UÆmg
)1
and the k
cat
is 259 ± 25 s
)1
, which are
within the range of values reported previously [16].
Co-operative binding of the cofactor to FabG
HPLC-purified, fresh NADPH (A
258
⁄ A
340
¼ 2.3) was
used for studying the conformational changes and

co-operativity in FabG. The intrinsic fluorescence of
FabG, as a result of its lone tryptophan (k
max
¼
334 nm), decreased when it was titrated with increasing
concentrations of NADPH (Fig. 2A,B), with simulta-
neous appearance of another peak with a k
max
at
456 nm as a result of NADPH. The appearance of fluor-
escence with a k
max
at 456 nm is caused by energy trans-
fer from the lone tryptophan of FabG to the bound
NADPH, as the emission spectrum of tryptophan in the
protein has a considerable overlap with the excitation
spectrum of the NADPH. Binding of NADPH to
FabG, as analyzed by quenching of its fluorescence
intensity at 334 nm, exhibited a negative, homotropic
co-operativity (with a Hill constant of 0.8) (Fig. 2C).
The NADPH-induced changes in the fluorescence of
tryptophan in the protein at 334 nm were analyzed by
nonlinear least-squares fit of the data, using the Adair
equation with 1–4, equivalent and independent, as well
as equivalent and interdependent, binding sites (n).
As shown in Fig. 2D, a model of the binding site with
Plasmodium falciparum b-ketoacyl ACP reductase K. Karmodiya and N. Surolia
4094 FEBS Journal 273 (2006) 4093–4103 ª 2006 The Authors Journal compilation ª 2006 FEBS
n ¼ 1 does not provide a satisfactory coalescence of the
fit with the data for NADPH binding. However, the fit

improves dramatically as the number of sites are
increased from two to four equivalent, interdependent-
binding sites, with n ¼ 4(K
a
¼ 40.90 lm
)1
) being clo-
sest to the experimental data (Fig. S1 and Table S1). As
mentioned above, binding of NADPH to the enzyme
leads to the appearance of fluorescence with a maximum
at 450 nm when excited at its excitation maximum
(340 nm). From the NADPH concentration dependence
of the increase in fluorescence intensity of NADPH at
450 nm, the K
a
value for its binding to FabG, with n ¼
4, was found to be 45.2 lm
)1
. Binding of other ligands
to the binary complex of NADPH.FabG also alters the
cofactor-specific fluorescence intensity (k
max
456 nm).
The K
a
values for all the ligands that were determined
[i.e. acetoacetyl-CoA, Plasmodium falciparum acyl
carrier protein (apo form) (apo-PfACP) and Plasmo-
dium falciparum acyl carrier protein (holo form)
(holo-PfACP)] using the cofactor-specific fluorescence

intensity at 456 nm (excited at 280 nm), are identical to
those obtained by measurement of the intrinsic trypto-
phan fluorescence intensity at 334 nm (Table 1).
Allosteric binding of NADPH to FabG in the
presence of ACP
The binding constant of acetoacetyl-CoA to the enzyme
is increased several fold in the presence of NADPH,
which motivated us to investigate allostery in its cata-
lytic mechanism. The affinities (K
a
) of FabG for its
cofactor, NADPH, determined by quenching of the
fluorescence of its tryptophan (k
max
334 nm) in the
absence and presence of 20 lm ACP, were found to be
40.9 lm
)1
and 48.4 lm
)1
, respectively (Fig. 3A and
Table 1). In the presence of ACP, the affinity of FabG
for NADPH increased, while the number of cofactor-
binding sites decreased, indicating a negative, hetero-
tropic co-operative effect of ACP upon binding of
NADPH (Table 1). In addition, the degree of negative
co-operativity increased in the presence of ACP (Hill
constant, n
H
¼ 0.5) (Fig. 2B). In the absence of ACP, as

stated earlier, the binding of NADPH exhibited negat-
ive, homotropic co-operativity. In the absence of ACP,
four NADPH-binding sites were present, corresponding
to the four equivalent subunits in FabG, which
decreased to two in the presence of ACP. Altogether,
the negative co-operativity and stoichiometry calcu-
lations show that binding of ACP converts the four
equivalent negative co-operative homotropic NADPH-
binding sites to two high-affinity NADPH sites
(Fig. 3B).
Interaction of FabG with ACP
Fluorescence titration of a fixed concentration of FabG
with varying concentrations of ACP gave an associ-
PfFabG (31 kDa)
12
kDa
118
66
45
35
25
18
14
A
log molecular mass
456
Ve/Vo
1
2
3

B
Elution Volume (ml)
01020
A
280 (mAU)
0
10
20
Fig. 1. Purification and determination of the molecular mass of
b-ketoacyl-acyl carrier protein reductase (FabG) by gel filtration chro-
matography. (A) SDS ⁄ PAGE of recombinant FabG. Lane 1, protein
molecular mass markers (MBI Fermentas); lane 2, purified FabG.
(B) The standard curve, Ve ⁄ V
0
versus log molecular mass (mol.
mass) was derived from the elution profiles of the standard
molecular weight markers on a Superdex 200 gel filtration column.
Ve, peak elution volume of the protein; V
0
, void volume of the col-
umn. The position of FabG elution (2 mgÆmL
)1
) is indicated by (.).
The standards used were 1, cytochrome c (12 kDa); 2, carbonic
anhydrase (29 kDa); 3, ovalbumin (45 kDa); 4, BSA (66 kDa); and 5,
aldolase (158 kDa). Inset, elution profile of FabG.
K. Karmodiya and N. Surolia Plasmodium falciparum b-ketoacyl ACP reductase
FEBS Journal 273 (2006) 4093–4103 ª 2006 The Authors Journal compilation ª 2006 FEBS 4095
ation constant of 0.40 lm
)1

with n ¼ 1. The affinity
(K
a
¼ 1.1 lm
)1
) and the number of binding sites
increased to two for ACP in the presence of NADPH.
FabG activity was monitored spectrophotometri-
cally at 340 nm in the presence of NADPH and
ACP. The maximum activity was observed when the
Fig. 2. Emission spectra for the intrinsic protein fluorescence (k
max
334 nm) of b-ketoacyl-acyl carrier protein reductase (FabG) and increase
in fluorescence of NADPH (k
max
456 nm) upon titration of the enzyme with NADPH at 20 °C. Aliquots of 3 lL of NADPH from stock solu-
tions of 5 m
M were added to 1 mL of FabG (2 lM tetramer in 3 mM Hepes, pH 7.5, 100 mM NaCl, 2 mM b-mercaptoethenol and 10% gly-
cerol) and the changes in fluorescence intensities were monitored between 300 and 500 nm. Samples were excited at 280 nm. A
fluorescence spectrum with a maximum at 334 nm is caused by the fluorescence of tryptophan in the protein. In addition, there was acquisi-
tion of the fluorescence by NADPH, with a maximum at 456 nm, upon the binding of NADPH to the enzyme, as a consequence of energy
transfer between the lone tryptophan (k
max
334 nm) in the protein and bound NADPH (k
max
456 nm). (A) Quenching of tryptophan fluores-
cence of FabG (300–400 nm range; k
max
334 nm) occurred as a function of increasing concentration of the reduced cofactor. The arrow indi-
cates the direction in which the change in tryptophan fluorescence (quenching) occurs with an increase in NADPH concentration. There is

an increase in NADPH fluorescence (400–500 nm range; k
max
456 nm) as a function of increasing concentration of NADPH. The upward
direction of the arrow indicates that the cofactor fluorescence (k
max
456 nm) increases as a function of its concentration. (B) The fractional
fluorescence changes at 334 nm (d) and 456 nm (s) are plotted versus the varying concentrations of NADPH. Inset: quenching of trypto-
phan fluorescence at 334 nm (d) and the enhancement of NADPH fluorescence at 456 nm (s) as a function of increasing concentrations of
NADPH. (C) Hill plot of the data obtained as a result of the changes in fluorescence intensity of tryptophan of the enzyme at 334 nm, as a
function of NADPH concentration, with a Hill constant (n
H
) of 0.8 (s). In the presence of acyl carrier protein (ACP), the n
H
¼ 0.5 (d). (D) Fit-
ting with the Adair equation corresponding to four sites (dotted line) for NADPH yields the best r
2
value of 0.949, with an excellent fit of the
experimental values (d). Fit with one site (thin line) diverges significantly from the experimental points (d). Error bars for the fit with n ¼ 1
are not shown in the figure in the interest of clarity, but are shown in Fig. S1. Likewise, fits with n ¼ 2andn ¼ 3, together with the associ-
ated error bars, are shown in Fig. S1.
Plasmodium falciparum b-ketoacyl ACP reductase K. Karmodiya and N. Surolia
4096 FEBS Journal 273 (2006) 4093–4103 ª 2006 The Authors Journal compilation ª 2006 FEBS
cofactor was preincubated with the enzyme before
adding acetoacetyl-CoA and ACP. The enzyme was
catalytically less efficient in the presence of ACP
(Table 2).
Binding of acetoacetyl-CoA and b-hydroxybutyryl-
CoA to FabG
The association constant for the substrate, acetoace-
tyl-CoA, is 12.3 lm

)1
with four equivalent and
independent sites. In the presence of NADPH
(Fig. S2A), the K
a
for acetoacetyl-CoA is increased
by 16-fold to 189.2 lm
)1
(Table 1). Thus, acetoace-
tyl-CoA now has a larger number of favorable inter-
actions at the active site of the enzyme in the
presence of NADPH. b-hydroxybutyryl-CoA, the
product of the reaction, has affinity (23.2 lm
)1
)
(Fig. S2B) comparable with that of acetoacetyl-CoA
(18.8 lm
)1
) in the absence of NADPH. Binding of
b-hydroxybutyryl-CoA in the presence of NADP
+
is
enhanced by 1.7-fold.
Effect of the cofactor and acetoacetyl-CoA on the
far-UV CD spectrum of FabG
The presence of NADPH has a considerable effect on
the conformation of FabG. While the helicity of the
protein increased from 30 to 35%, the b-sheet content
increased from 27 to 33%, as evident by the CD
Table 1. Binding constants (K

a
) of various ligands to b-ketoacyl-acyl
carrier protein reductase (FabG) at 20 °C, using the changes in pro-
tein and ⁄ or cofactor fluorescence intensity at 334 and 450 nm,
respectively. (Experimental details are provided in the respective
figure legends
a
). Apo-PfACP, Plasmodium falciparum acyl carrier
protein (apo form); Holo-PfACP, Plasmodium falciparum-acyl carrier
protein (holo form); n, number of binding sites for the best value of
r
2
; ND, not determined; SN, serial number.
SN Titrated with ligand
Saturated
with n
K
a
(lM
)1
)
b
K
a
(lM
)1
)
c
1 NADPH None 4 40.9 45.2
2 NADPH Holo-PfACP 2 48.4 43.6

3 NADP
+
None 4 2.2 ND
4 Apo-PfACP None 1 0.31 ND
5 Apo-PfACP NADPH 1 0.36 0.35
6 Apo-PfACP NADP
+
1 0.32 ND
7 Holo-PfACP None 1 0.40 ND
8 Holo-PfACP NADP
+
1 0.31 ND
9 Holo-PfACP NADPH 2 1.1 1.2
10 Acetoacetyl-CoA None 4 12.3 ND
11 Acetoacetyl-CoA NADPH 2 189.2 172.6
12 b-hydroxybutyryl-CoA None 4 23.2 ND
13 b-hydroxybutyryl-CoA NADP
+
4 39.4 ND
a
Table S1 provides the residuals for each value of n, for each
ligand, to support the given value of n chosen by us for interpret-
ation of our data. Also, for a given value of n, the resultant values
of association constants are listed in Table S1. A footnote provides
the rationale for the selection of a particular value of K
a
from these.
b
K
a

, association constant for the best value of r
2
, determined
using protein fluorescence (334 nm).
c
K
a
, association constant for
the best value of r
2
, determined using cofactor fluorescence
(450 nm).
Fig. 3. Negative co-operative binding of NADPH to b-ketoacyl-acyl
carrier protein reductase (FabG). (A) Binding of NADPH to FabG
(2 l
M of the tetramer) was studied in the absence (s), and pres-
ence of 20 l
M acyl carrier protein (ACP) (d) by monitoring fluores-
cence with excitation at 280 nm and emission at 334 nm, as
described in the Experimental procedures. Relative fluorescence
intensity (observed fluorescence intensity minus fluorescence inten-
sity at infinite ligand concentration) values are plotted versus
NADPH concentration. Identical results were obtained when the
reaction was monitored by following the changes in the NADPH
fluorescence intensity at 456 nm. (B) Intrinsic fluorescence quench-
ing of FabG by NADPH with a saturating concentration of ACP
(20 l
M). Relative fluorescence intensity values are plotted versus
NADPH concentration. A fit according to the Adair equation corres-
ponding to two sites (dashed line) for NADPH in the presence of

ACP gave the best value for residuals (0.965). Also, for comparison,
the fit for one site (thin line) with the original data (d) is also shown.
K. Karmodiya and N. Surolia Plasmodium falciparum b-ketoacyl ACP reductase
FEBS Journal 273 (2006) 4093–4103 ª 2006 The Authors Journal compilation ª 2006 FEBS 4097
spectrum of FabG (Fig. 4). Interestingly, the negative
gain in ellipticity brought about by NADPH decreased
with the addition of acetoacetyl-CoA.
Analyses of the accessibility of the lone
tryptophan of FabG by Stern–Volmer plots
The oxidized cofactor, NADP
+
, is 20 times weaker as
a ligand than its reduced counterpart (Fig. S3). Plots
of F0 ‚ (F0 ) F) versus 1 ‚ [Q], for calculating the
accessibility of the fluorescence of the lone tryptophan
in FabG for NADP
+
and NADPH, are shown in
Fig. 5 as representative examples. A cursory examina-
tion of the plots reveal a greater accessibility of the
tryptophan to the quencher when NADPH is bound
to enzyme compared with that in the presence of
NADP
+
. In Table 2, Stern–Volmer analyses of the
data are summarized for the interactions of various
ligands with FabG. These data for NADPH yield a
value of 1.23, indicating that 81% of the total FabG
fluorescence is accessible to it, whereas f
)1

with
NADP
+
is 2.37, showing that only 42% of the total
fluorescence of the enzyme is accessible to the oxidized
cofactor. Likewise, binding of other ligands also exert
subtle molecular effects on the exposure of the unique
tryptophan in FabG (Table 3).
Stern–Volmer analysis of the interaction of ACP
with FabG revealed an f
)1
of 1.35, indicating that 74%
of the total fluorescence of FabG is accessible when
Table 2. Catalytic efficiency of b -ketoacyl-acyl carrier protein reduc-
tase (FabG) with acetoacetyl-CoA as substrate, with varying con-
centrations of acyl carrier protein (ACP). SN, serial number. conc.,
concentration.
SN ACP conc. (l
M) k
cat
⁄ K
m
(s
)1
ÆM
)1
)
1 0 6.02 · 10
5
(100)

a
2 25.0 5.55 · 10
5
(92.5)
3 50.0 2.86 · 10
5
(79.8)
4 75.0 2.55 · 10
5
(71.4)
6 100.0 2.27 · 10
5
(63.3)
7 125.0 1.86 · 10
5
(52.1)
8 150.0 1.79 · 10
5
(49.8)
a
The percentage catalytic efficiency is given in parenthesis.
Enzyme activity was monitored spectrophotometrically at 340 nm,
as described in the Experimental procedures.
Fig. 4. The far-UV CD spectra of b-ketoacyl-acyl carrier protein
reductase (FabG). The figure shows the CD spectrum of FabG
alone (14 · 10
)6
molÆl
)1
(s), the CD spectrum in the presence of

NADPH alone (200 l
M)(.) and the CD spectrum in the presence
of NADPH (200 l
M) and a saturating concentration of acetoacetyl-
CoA (200 l
M)(d).
Fig. 5. Fraction of initial fluorescence accessible to NADPH and
NADP
+
. Accessibility was calculated by the Stern–Volmer equation.
b-Ketoacyl-acyl carrier protein reductase (FabG) (0.5 l
M,in3mM
Hepes, pH 7.5) was preincubated for 15 min with aliquots of 5 mM
NADPH (n)or5mM NADP
+
(s) in a total volume of 1 mL and was
titrated with 10 lL aliquots of 3
M acrylamide solution. The fluores-
cence intensity was monitored at 334 nm with excitation at 280 nm.
Table 3. Fluorescence quenching parameters determined from
modified Stern–Volmer plots of b-ketoacyl-acyl carrier protein reduc-
tase (FabG) with acrylamide, at room temperature.
a
ACP, acyl car-
rier protein; f, slope of the SV plot; f
)1
, fluorescence accessibility;
SN, serial number.
SN Ligands f
)1

%fAccessible
1 None 1.06 94.3
2 NADPH 1.23 81.3
3 NADPH + ACP 1.02 98.0
4 NADPH + acetoacetyl-CoA 1.01 97.8
6 ACP 1.35 74.0
7 Acetoacetyl-CoA 1.39 71.5
8 NADP 2.37 42.1
9 b-Hydroxybutyryl-CoA 1.22 81.9
10 NADP + b-hydroxybutyryl-CoA 1.10 90.9
a
Samples were excited at 280 nm and the fluorescence intensity
was monitored at 334 nm. Experiments were carried out at 20 °C.
Plasmodium falciparum b-ketoacyl ACP reductase K. Karmodiya and N. Surolia
4098 FEBS Journal 273 (2006) 4093–4103 ª 2006 The Authors Journal compilation ª 2006 FEBS
ACP is bound to it, which increases to 98% in the pres-
ence of both ACP and NADPH. NADPH therefore
increases the affinity of ACP by increasing its accessi-
bility to FabG. In the presence of ACP, the accessibil-
ity of the lone tryptophan of FabG for NADPH
binding increases from 81 to 98%, explaining, likewise,
the increase in affinity of NADPH by ACP.
Discussion
Our biophysical and biochemical data provide evidence
that the binding of the cofactor NADPH to Plasmo-
dium FabG induces major conformational change in
the enzyme. This change promotes ACP binding as
well as negative co-operativity, which forms the basis
of the mechanism for catalytic activation of FabG. We
propose a model to illustrate how PfFabG binds the

cofactor, substrate and other ligands. The model also
shows the active ⁄ inactive status of each monomer with
the number of binding sites for various ligands in
solution. FabG, an allosteric enzyme, is a catalytically
nonproductive homotetramer in the absence of
NADPH, as neither acetoacetyl-CoA, nor ACP (the
substrate mimics of the physiological substrate aceto-
acetyl-ACP) can access the active sites completely
(Scheme 1A,D). ACP has a single binding site, whereas
acetoacetyl-CoA has four independent binding sites in
the tetramer in the absence of NADPH (Table 1). The
binding of NADPH, which has four equivalent and
interdependent binding sites in FabG, results in con-
formational changes (Scheme 1B), which improves the
accessibility of ACP and acetoacetyl-CoA to the active
sites (Scheme 1C). While only one molecule of ACP
can bind to FabG at one of the two dimeric interfaces
of the enzyme in the absence of NADPH, the binding
of NADPH to FabG results into two high-affinity sites
for ACP and acetoacetyl-CoA (Scheme 1C). Thus,
NADPH binding increases the affinity, as well as the
number, of binding sites for ACP. Analyses of the data
obtained from Adair equations and Hill coefficients
for the interactions of various ligands with FabG, indi-
cate that the binding of ACP not only increases the
affinity, but also the negative co-operativity, of
NADPH to the enzyme, fine tuning its catalytic mech-
anism. Once NADPH and ACP bind to FabG, each
can access two active sites from the opposite or adja-
cent subunits (Scheme 1C). FabG holds NADPH and

ACP close to each other in an orientation which stabil-
izes the transition state that leads to the substrate
delivery across the dimer interface via the pantetheine
arm of the ACP. This provides an example of catalysis
by approximation [17]. Our studies also demonstrate
that holo-PfACP, as compared with its apo form,
binds more strongly to FabG in the presence of
NADPH, attesting the importance of the 4¢ phospho-
pantetheine moiety for the binding of holo-PfACP
(Table 1). As evident from the CD data (Fig. 4), the
FabG secondary structure increases in the presence of
NADPH and decreases in the presence of acetoacetyl-
CoA. These conformational changes appear to be
directly related to the binding and oxidation of
NADPH to the enzyme at equilibrium. Such a mech-
anism seems to be unique to the FabG members of the
SDR family and are consistent with B. napus and
E. coli counterparts, as demonstrated by crystallo-
graphic studies [18–21]. These conformational changes
point to the need for an open FabG active site to
accept the acyl-ACP substrates.
ABCDE
ACP
binding site
+NADPH
+ACP
+ACP
Active site
Active site
Inactive FabG

homo-tetramer
in the absence
of NADPH
Active
FabG
tetramer
Conformational
change in the
active sites in
presence of
NADPH
ACP binding
site
Phospho-pantetheine
arm of ACP to which
acyl moiety is attached
+NADPH
Scheme 1. Proposed model for b-ketoacyl-acyl carrier protein reductase (FabG) repositioning and allosteric regulation by the binding of
NADPH and acyl carrier protein (ACP).
K. Karmodiya and N. Surolia Plasmodium falciparum b-ketoacyl ACP reductase
FEBS Journal 273 (2006) 4093–4103 ª 2006 The Authors Journal compilation ª 2006 FEBS 4099
Our studies highlight the importance of PfFabG in
regulating the flux of the substrates during the elonga-
tion phase of FAS in the parasite. This phase will pro-
ceed when the NADPH ⁄ NADP ratio is high; on the
other hand, when the NADPH ⁄ NADP ratio is low,
b-hydroxyacyl-ACPs are converted to b-ketoacyl-ACPs.
Hence, b-ketoacyl-ACPs will accumulate and the elon-
gation phase of FAS will become regulated at this step.
FabG exhibits negative co-operativity, and the bind-

ing of NADPH to one site increases the affinity at that
site for the ACP-bound substrate and simultaneously
decreases the affinity for cofactor at the other site.
This, in turn, indicates a greater sensitivity for the low
ligand (NADPH) concentration and is probably associ-
ated with conformational changes that have occurred
in the transition from one state of co-operativity to the
other. Furthermore, the increase in negative co-opera-
tivity for NADPH in the presence of ACP might be
useful, as the concentration of NADPH may change in
the cell as a result of reactions other than FAS, where
FabG is not participating. Under such circumstances,
it may be of benefit if the enzyme does not react to
changes in the substrate [22]. In summary, the data for
the interactions of PfFabG with the reduced and oxid-
ized cofactor, substrate and product, allow us to
rationalize the importance of this enzyme in regulating
the flux of substrates in the elongation cycle of parasite
FAS. Our major focus for future research will be to
identify and compare the various acyl-ACP thioester
intermediates of Plasmodium FAS, as well as to have a
deeper understanding of the regulation of FAS by this
enzyme in P. falciparum.
Experimental procedures
Materials
Acetoacetyl-CoA, b-hydroxybutyryl-CoA, b-NADPH,
NADP
+
, imidazole, kanamycin, chloramphenicol and
SDS ⁄ PAGE reagents were obtained from Sigma Chemicals

(St Louis, MO, USA). Protein molecular weight markers
were from MBI Fermentas GmbH (St Leon-Rot, Germany).
His-binding resin and anti-His tag horseradish peroxidase
conjugates were obtained from Novagen (Darmstadt, Ger-
many). Media components were obtained from Difco
TM
(Detroit, MI, USA). Hi-Trap desalting and Superdex
TM
200
columns were from Amersham Biosciences (Uppsala, Swe-
den). All other chemicals used were of analytical grade.
Strains and plasmids
E. coli DH5a cells were used for cloning the b-ketoacyl-
ACP reductase. The pET-28a (+) vector (Novagen) and
BL21 (DE3) codon plus (Novagen) were used for the
expression of FabG.
Cloning of PfFabG
Total RNA isolated from asynchronous cultures of P. falci-
parum, treated for 45 min at 37 °C with RNase-free DNase
(Promega, Madison, WI, USA; 1 UÆ l g
)1
RNA), was phe-
nol ⁄ chloroform extracted and ethanol precipitated, then sub-
jected to RT-PCR using a one step RT-PCR kit (Qiagen,
Hilden, Germany). The primers were designed to clone the
protein (encompassing a 771 bp fragment, starting at posi-
tion 132 and ending at position 903). The primers used for
PCR were 5¢-CATG
CCATGGGAAAAGTTGCTTTA
GTAACAGGTGCAGGA-3¢ (NcoI site underlined) and

5¢-CCG
CTCGAGAGGTGATAGTCCACCGTCTATTACG
AAAACTCG-3¢ (XhoI site underlined) using PlatinumÒ Pfx
DNA polymerase (Invitrogen, Carlsbad, CA, USA). The
DNA sequence encoding the mature protein was amplified
using the above gene-specific primers and cloned in NcoI and
XhoI sites of the pET-28a (+) vector (Novagen). The PCR
conditions consisted of an initial denaturation at 95 °C for
5 min, followed by amplification for 25 cycles (95 °C for
1 min, 50 °C for 50 s and 72 °C for 1 min), followed by a
final extension at 72 °C for 5 min. The clone thus obtained
was confirmed by DNA sequencing. The protein obtained
from this clone showed higher specific activity than that from
the earlier clone [23]. The specific activity of this protein pre-
paration is comparable to that reported by Wickramasinghe
et al. [16] and was used all throughout these studies.
Expression of FabG
The plasmid construct, pET-28a (+), was transformed into
E. coli BL21 (DE3) codon plus competent cells. The bac-
teria were grown in Luria–Bertani broth, with vigorous
shaking (200 r.p.m.) at 25 °C, to an attenuance (D) of 0.6.
Cells were then induced with 0.2 mm isopropyl thio-b-d-
galactoside and further incubated at 15 °C for 9 h. Cells
were harvested at 1500 g for 15 min at 4 °C, washed twice
with LB broth and the resultant pellet was resuspended in
20 mm sodium phosphate, pH 6.8, containing 0.5 m NaCl
and supplemented with a protease inhibitor cocktail tab-
let, according to the manufacturer’s instructions (Roche,
Mannheim, Germany).
Purification of FabG

The cell suspension was sonicated (Vibra-Cells; Sonics and
Materials, Newtown, CT, USA). Cell debris was removed
by centrifugation (10 000 g, 30 min, 4 °C). The superna-
tant obtained was applied to a Ni-nitrilotriacetic acid
metal-affinity column pre-equilibrated with the lysis buffer
(the same as the buffer used to resuspend the pellet). The
Plasmodium falciparum b-ketoacyl ACP reductase K. Karmodiya and N. Surolia
4100 FEBS Journal 273 (2006) 4093–4103 ª 2006 The Authors Journal compilation ª 2006 FEBS
protein was eluted with a step gradient of 50–500 mm imi-
dazole, and fractions were tested for protein purity by
SDS ⁄ PAGE (12% gels). The purified protein fractions were
applied onto a Hi-Trap desalting column to remove imidaz-
ole, followed by concentration of the protein. Protein was
determined by the Bradford method [24].
Molecular size and oligomeric status
of P. falciparum FabG
The subunit molecular size and oligomeric status of FabG
was determined by SDS ⁄ PAGE and gel filtration, respect-
ively. Purified FabG (2 mgÆmL
)1
) was loaded onto a
Superdex
TM
200 (1 · 30 cm) AKTA
TM
column, pre-equili-
brated with 3 mm Hepes (pH 7.5), 100 mm NaCl, 2 mm
b-mercaptoethanol and 10% glycerol. The flow rate was
maintained at 0.4 mLÆ min
)1

. The column was calibrated
with a mixture of BSA (66 kDa), aldolase (158 kDa), cyto-
chrome c (12 kDa), carbonic anhydrase (29 kDa) and
chicken ovalbumin (45 kDa). The molecular weight of FabG
was determined by plotting Ve ⁄ V
0
versus log of molecular
mass of standard proteins. Ve corresponds to the elution vol-
ume of the protein and V
0
represents the void volume of the
column, determined using blue dextran (M
r
< 2 000 000).
Enzyme assay
The activity of FabG was assayed at 25 °C by monitoring the
decrease in absorbance at 340 nm, spectrophotometrically,
as a result of the oxidation of NADPH to NADP
+
(Jasco
V-530 UV-visible spectrophotometer; Tokyo, Japan). The
standard reaction mixture in a final volume of 100 lL con-
tained 50 mm sodium phosphate buffer, pH 6.8, 0.25 m
NaCl, 200 lm NADPH, 0.5 mm acetoacetyl-CoA and 0.2–
0.8 lg of FabG. The assay mixture was preincubated for
5 min at room temperature before initiating the reaction by
the addition of substrate or enzyme. The reverse reaction (i.e.
oxidation of b-hydroxybutyryl-CoA to acetoacetyl-CoA) was
also characterized by monitoring the reduction of NADP
+

to NADPH, by following the increase in absorbance at
340 nm. Reactions with appropriate blanks were also per-
formed. The kinetic parameters were determined by non-
linear regression analyses. The data were also evaluated by
double reciprocal plots. The ability of ACP to inhibit FabG
activity in the spectrophotometric assay was tested by incu-
bating varying concentrations of ACP with the protein at
room temperature for 5 min before adding acetoacetyl-CoA
to initiate the reaction.
Expression and purification of holo-PfACP and
apo-PfACP
Holo-PfACP and apo-PfACP were obtained as described
previously [25].
Purification of NADPH
In order to obtain an accurate picture of negative co-opera-
tivity, NADPH was purified (free of contaminating
amounts of NADP
+
) using a standard protocol [26].
Fluorescence titration of FabG–NADPH binding
Equilibrium binding of ligands to FabG was measured by
fluorescence titration at 20 °C using a Jobin-Yvon Horiba
spectrofluorimeter (Edison, NJ, USA) (band-pass of 3 and
5 nm), for the excitation and emission monochromator,
respectively. The fluorescence spectrum of FabG was stud-
ied by exciting the samples at 280 nm and recording the
emission spectrum in the range of 300–500 nm. In the
absence of NADPH, fluorescence, caused by its lone trypto-
phan residue, was observed in the range of 300–400 nm,
with a maximum at 334 nm. However, in the presence of

NADPH, while the fluorescence in the region 300–400 nm
declined as a result of the quenching of its tryptophan
fluorescence (k
max
334 nm), fluorescence in the 400–500 nm
range, with a maximum at 456 nm, appeared. When the
FabG.NADPH complex was excited at 340 nm (excitation
maximum of enzyme-bound NADPH), fluorescence in the
same range (400–500 nm) was observed; however, its k
max
was 450 nm. Aliquots of 3 l L of NADPH (from stock
solutions of 2, 100 and 500 lm) were added to 0.5 lm
FabG in 3 mm Hepes (pH 7.5), 100 mm NaCl, 2 mm
b-mercaptoethenol and 10% glycerol. The solution was
mixed after the addition of each aliquot, and the fluores-
cence intensity in the range of the 300–400 nm region was
recorded as the average of three readings. Samples were
excited at 280 nm. The effect of ACP and other ligands on
NADPH binding to FabG was studied by titration of
NADPH and other ligands (3 lL) into 0.5 lm FabG (3 mm
Hepes, pH 7.5, 100 mm NaCl, 2 mm b-mercaptoethenol
and 10% glycerol), from a stock solution of 5 mm, and the
corresponding decrease in the fluorescence intensity of its
lone tryptophan was monitored at 334 nm. A double-recip-
rocal plot of the fluorescence intensity and ligand concen-
tration, from the data obtained by titration of a fixed
concentration of FabG with ligand, gave the fluorescence
intensity at infinite ligand concentration (F
a
).

Correction for the inner filter effect was performed
according to the following equation:
F
C
¼ F antilog½ðA
ex
þ A
em
ÞÄ2;
where Fc and F are the corrected and measured fluores-
cence intensities, respectively [27], and A
ex
and A
em
are the
solution absorbance values at the excitation and emission
wavelengths, respectively.
The fluorescence data were fitted by the Adair equation
[28] with number of sites n ¼ 1–4, K being the association
constants: for a single site, Y ¼ KÆ[X] ⁄ (1 + KÆ[X]); for
K. Karmodiya and N. Surolia Plasmodium falciparum b-ketoacyl ACP reductase
FEBS Journal 273 (2006) 4093–4103 ª 2006 The Authors Journal compilation ª 2006 FEBS 4101
two sites equivalent and independent, Y ¼ (K1Æ[X] + 2K
1
Æ
K
2
Æ[X]
2
) ⁄ (1 + K

1
Æ[X] + K
1
ÆK
2
Æ[X]
2
); for two sites equivalent
and interdependent, Y ¼ (2K
1
ÆX+K
1
ÆK
2
Æ[X]
2
) ⁄ (1 + K
1
ÆX+
K
1
ÆK
2
Æ[X]
2
); for three sites equivalent and independent,
Y ¼ (K
1
Æ[X] + 2K
1

ÆK
2
Æ[X]
2
+3K
1
ÆK
2
ÆK
3
Æ[X]
3
) ⁄ (1 + K
1
Æ[X] +
K
1
ÆK
2
Æ[X
2
]+ K
1
ÆK
2
ÆK
3
Æ[X]
3
); for three sites equivalent and

interdependent, Y ¼ (3 K
1
Æ[X] + 2 K
1
ÆK
2
Æ[X]
2
+ K
1
ÆK
2
ÆK
3
Æ[X]
3
) ⁄
(1 + K
1
Æ[X] + K
1
ÆK
2
Æ[X]
2
+ K
1
ÆK
2
ÆK

3
Æ[X]
3
); for four sites
equivalent and independent, (K
1
Æ[X] + 2K
1
ÆK
2
Æ[X]
2
+
3K
1
ÆK
2
ÆK
3
Æ[X]
3
+4K
1
ÆK
2
ÆK
3
ÆK
4
Æ[X]

4
)⁄(1 + K
1
Æ[X] + K
1
ÆK
2
Æ[X]
2
+
K
1
ÆK
2
ÆK
3
Æ[X]
3
+ K
1
ÆK
2
ÆK
3
ÆK
4
Æ[X]
4
); and for four sites equiv-
alent and interdependent, Y ¼ (4K

1
Æ[X] + 3 K
1
ÆK
2
Æ[X]
2
+
2K
1
ÆK
2
ÆK
3
Æ[X]
3
+ K
1
ÆK
2
ÆK
3
ÆK
4
Æ[X]
4
) ⁄(1 + K
1
Æ[X] + K
1

ÆK
2
Æ[X]
2
+
K
1
ÆK
2
ÆK
3
Æ[X]
3
+ K
1
ÆK
2
ÆK
3
ÆK
4
Æ[X]
4
). All calculations were car-
ried out with sigmaplot 2000 software (Systat Software Inc.,
CA, USA).
The measure of co-operativity for cofactor binding to
FabG was calculated with the Hill equation, as follows:
logðY=1 À YÞ¼n
H

log½SÀlog K
d
;
where Y is the fraction of the enzyme with the bound
cofactor, Y ⁄ 1 ) Y is the fraction of binding sites that are
occupied for an enzyme-binding substrate, K
d
is the dissoci-
ation constant, [S] is the cofactor concentration and n
H
is
the Hill coefficient.
Fluorescence quenching
Quenching of the fluorescence of FabG by acrylamide was
monitored at 334 nm. Samples were excited at 280 nm. A
fresh 3 m acrylamide (14.2%) solution was made in 3 mm
Hepes (pH 7.5), 100 mm NaCl, 2 mm b-mercaptoethenol
and 10% glycerol. Protein (2 lm)in3mm Hepes (pH 7.5),
100 mm NaCl, 2 mm b-mercaptoethenol and 10% glycerol,
was titrated with 10 lL aliquots of acrylamide from a 3 m
stock. Corrections were made [29], especially applicable to
proteins containing a single tryptophan [30]:
Fo
Fo À F
¼
1
fK½Q
þ
1
f

Where F
0
and F are the initial fluorescence and the
observed fluorescence in the presence of the given concen-
tration of the quencher, respectively, K is the Stern–Volmer
quenching constant, [Q] is the concentration of the acryl-
amide (quencher) and f is the fraction of initial fluorescence
which is accessible to the quencher. The plot of F
0
⁄ (F
0
–F)
versus 1 ⁄ [Q] yields f
)1
as the intercept.
CD measurements
CD measurements were performed on a JASCO J-810
(Tokyo, Japan) spectropolarimeter at 20 °C using a 0.1 cm
path length quartz cuvette, with FabG (14 · 10
) 6
molÆl
) 1
), NADPH (200 lm) and acetoacetyl-CoA
(200 lm). Each spectrum was an accumulation of four to
six consecutive scans over a wavelength range of
200 ) 250 nm (2 nm band-pass). Results are expressed as
molar ellipticity (h) in deg cm
2
Ædmol
) 1

. The a-helical and
b-sheet content of FabG were calculated from the [h] value
at 208 nm and 217 nm, respectively, using the following
equation [31]:
Percentage helicity ¼ fðÀ½h
208
À 4000ÞÄð33000 À 4000Þg  100:
Acknowledgements
We thank the Department of Science and Technology,
India, for their financial support to N.S., and the
Chairman, MBU, Indian Institute of Science, for the
use of the Jobin–Yvon Horiba spectrofluorimeter for
these studies.
References
1 World Health Organization (1999) Rolling back
malaria. World Health Report 4, 49–63.
2 Moore SA, Surgey EG & Cadwgan AM (2002) Malaria
vaccines: where are we and where are we going? Lancet
Infect Dis 2, 737–743.
3 Asindi AA, Ekanem EE, Ibia EO & Nwangwa MA
(1993) Upsurge of malaria-related convulsions in a pae-
diatric emergency room in Nigeria. Consequence of
emergence of chloroquine-resistant Plasmodium falci-
parum. Trop Geogr Med 45, 110–113.
4 Surolia N & Surolia A (2001) Triclosan offers protec-
tion against blood stages of malaria by inhibiting enoyl-
ACP reductase of Plasmodium falciparum. Nat Med 7,
167–173.
5 Kapoor M, Dar MJ, Surolia A & Surolia N (2001)
Kinetic determinants of the interaction of enoyl-ACP

reductase from Plasmodium falciparum with its sub-
strates and inhibitors. Biochem Biophys Res Commun
289, 832–837.
6 Witkowski A, Ghosal A, Joshi AK, Witkowska HE,
Asturias FJ & Smith S (2004) Head-to-head arrange-
ment of the subunits of the animal fatty acid synthase.
Chem Biol 11, 1667–1676.
7 Smith S, Witkowski A & Joshi AK (2003) Structural
and functional organization of the animal fatty acid
synthase. Prog Lipid Res 42, 289–317.
8 Ramya TNC, Surolia N & Surolia A (2002) Survival
strategies of the malarial parasite Plasmodium falci-
parum. Curr Sci 83, 101–108.
9 Surolia A, Ramya TNC, Ramya V & Surolia N (2004)
‘FAS’t inhibition of malaria. Biochem J 383, 1–12.
10 Sharma S, Ramya TNC, Surolia A & Surolia N (2003)
Triclosan as a systemic antibacterial agent in a mouse
model of acute bacterial challenge. Antimicrob Agents
Chemother 47, 3859–3866.
Plasmodium falciparum b-ketoacyl ACP reductase K. Karmodiya and N. Surolia
4102 FEBS Journal 273 (2006) 4093–4103 ª 2006 The Authors Journal compilation ª 2006 FEBS
11 Rock CO & Cronan JE (1996) Escherichia coli as a
model for the regulation of dissociable (type II) fatty
acid synthesis. Biochim Biophys Acta 1302, 1–16.
12 Majerus PW (1968) Acyl carrier protein: effects of
acetylation and tryptic hydrolysis on function in fatty
acid synthesis. Science 159, 428–430.
13 Zhang Y & Cronan JE Jr (1998) Transcriptional analy-
sis of essential genes of the Escherichia coli fatty acid
biosynthesis gene cluster by functional replacement with

the analogous Salmonella typhimurium gene cluster.
J Bacteriol 180, 3295–3303.
14 Jornvall H, Persson B, Krook M, Atrian S, Gonzalez-
Duarte R, Jeffery J & Ghosh D (1995) Short-chain
dehydrogenases ⁄ reductases (SDR). Biochemistry 34,
6003–6013.
15 Oppermann U, Filling C, Hult M, Shafqat N, Wu X, Lin-
dh M, Shafqat J, Nordling E, Kallberg Y, Persson B et al.
(2003) Short-chain dehydrogenases ⁄ reductases (SDR):
the 2002 update. Chem Biol Interact 143–144, 247–253.
16 Wickramasinghe SR, Inglis KA, Urch JE, Muller S,
Van Aalten DM & Fairlamb AH (2006) Kinetic, inhibi-
tion and structural studies on 3-oxoacyl-ACP reductase
from Plasmodium falciparum, a key enzyme in fatty acid
biosynthesis. Biochem J 393, 447–457.
17 Byeon L, Shi Z & Tsai MD (1995) Mechanism of ade-
nylate kinase. The ‘essential lysine’ helps to orient the
phosphates and the active site residues to proper confor-
mations. Biochemistry 34, 3172–3182.
18 Fawcett T, Copse CL, Simon JW & Slabas AR (2000)
Kinetic mechanism of NADH-enoyl-ACP reductase
from Brassica napus. FEBS Lett 484, 65–68.
19 Fisher M, Kroon JTM, Martindale W, Stuitje AR, Sla-
bas AR & Rafferty JB (2000) The X-ray structure of
Brassica napus beta-keto acyl carrier protein reductase
and its implications for substrate binding and catalysis.
Structure 8, 339–347.
20 Price AC, Zhang YM, Rock CO & Stephen WW (2001)
Structure of beta-ketoacyl-[acyl carrier protein] reduc-
tase from Escherichia coli: negative cooperativity and its

structural basis. Biochemistry 40, 12772–12781.
21 Price AC, Zhang YM, Rock CO & Stephen WW
(2004) Cofactor-induced conformational rearrange-
ments establish a catalytically competent active site
and a proton relay conduit in FabG. Structure 12,
417–428.
22 Suzuki Y, Moriyoshi E, Tsuchiya D & Jingami H
(2004) Negative cooperativity of glutamate binding in
the dimeric metabotropic glutamate receptor subtype 1.
J Biol Chem 279, 35526–35534.
23 Pillai S, Rajagopal C, Kapoor M, Kumar G, Gupta A
& Surolia N (2003) Functional characterization of
b-ketoacyl-ACP reductase (FabG) from Plasmodium
falciparum. Biochim Biophys Res Commun 303, 387–392.
24 Bradford MM (1976) A rapid and sensitive method for
the quantitation of microgram quantities of protein util-
izing the principle of protein-dye binding. Anal Biochem
72, 248–254.
25 Sharma SK, Modak R, Sharma S, Sharma AK, Sarma
SP, Surolia A & Surolia N (2005) A novel approach for
over-expression, characterization, and isotopic enrich-
ment of a homogeneous species of acyl carrier protein
from Plasmodium falciparum. Biochim Biophys Res
Commun 330, 1019–1026.
26 Markham KA, Sikorski RS & Kohen A (2003) Purifica-
tion, analysis and preservation of reduced nicotinamide
adenine dinucleotide 2¢-phosphate. Anal Biochem 322,
26–32.
27 Sharma SK, Kapoor M, Ramya TNC, Kumar S, Kumar
G, Modak R, Sharma S, Surolia N & Surolia A (2003)

Identification, characterization, and inhibition of Plasmo-
dium falciparum b-hydroxyacyl-acyl carrier protein dehy-
dratase (FabZ). J Biol Chem 278, 45661–45671.
28 Campanacci V, Lartigue A, Hallberg BM, Jones TA,
Orticoni MTG, Tegoni M & Cambillau C (2003) Moth
chemosensory protein exhibits drastic conformational
changes and cooperativity on ligand binding. Proc Natl
Acad Sci USA 100, 5069–5074.
29 Tyson PA & Steinberg M (1987) Accessibility of trypto-
phan residues in Na,K-ATPase. J Biol Chem 262, 4644–
4648.
30 Eftink MR & Ghiron CA (1976) Exposure of tryptopha-
nyl residues in proteins. Quantitative determination by
fluorescence quenching studies. Biochemistry 15, 672–680.
31 Liu J, Tian J, He W, Xie J, Hu Z & Chen X (2004)
Spectrofluorimetric study of the binding of daphnetin to
bovine serum albumin. J Pharm Biomed Anal 35, 671–
677.
Supplementary material
The following supplementary material is available
online:
Fig. S1. Fittings with the Adair equation, corresponding
to four sites (n) for NADPH, yielded the best r
2
value
of 0.949, with an excellent fit to the experimental values.
Fig. S2. Intrinsic fluorescence quenching of b-ketoacyl-
acyl carrier protein reductase (FabG) saturated with
NADPH by acetoacetyl-CoA and the product, b-hyd-
roxybutyryl-CoA.

Fig. S3. Intrinsic fluorescence quenching of b-ketoacyl-
acyl carrier protein reductase (FabG) by NADP
+
.
Table S1. Binding constants (K
a
) of various ligands to
b-ketoacyl-acyl carrier protein reductase (FabG) at
20 °C, using the changes in protein and ⁄ or cofactor
fluorescence intensity.
This material is available as part of the online article
from
K. Karmodiya and N. Surolia Plasmodium falciparum b-ketoacyl ACP reductase
FEBS Journal 273 (2006) 4093–4103 ª 2006 The Authors Journal compilation ª 2006 FEBS 4103