Báo cáo khoa học: Effects of juvenile hormone on 20-hydroxyecdysone-inducible EcR, HR3, E75 gene expression in imaginal wing cells of Plodia interpunctella lepidoptera ppt

Effects of juvenile hormone on 20-hydroxyecdysone-inducible
EcR
,
HR3
,
E75
gene expression in imaginal wing cells of
Plodia
interpunctella
lepidoptera
David Siaussat, Franc¸oise Bozzolan, Isabelle Queguiner, Patrick Porcheron and Ste
´
phane Debernard
Laboratoire de Physiologie Cellulaire des Inverte
´
bre
´
s, Universite
´
Pierre et Marie Curie, Paris, France
The IAL-PID2 cells derived from i maginal wing discs of the
last larval instar of Plodia interpunctella were responsive to
20-hydroxyecdysone (20E). These imaginal cells respond to
20E by proliferative arrest followed by a morphological
differentiation. These 20E-induced late responses were
inhibited in presence o f j uvenile hormone (JH II). F rom
these imaginal wing cells, we have cloned a cDNA s equence
encoding a P. interpunctella ecdysone receptor-B1 isoform
(PIEcR-B1). The amino a cid s equence o f P IEcR-B1 s howed
a high d egree o f identity with EcR-B1 i soforms o f Bo mb yx
mori, Ma nduca sexta and Choristoneura fumiferana.The

pattern of PIEcR-B1 mRNA induction by 20E was char-
acterized by a biphasic response with peaks at 2 h and 18 h.
The p resence of the protein s ynthesis inhibitor anisomycin
induced a slight reduction in level of PIEcR-B1 mRNA and
prevented the subsequent declines observed in 20E-treated
cells. T herefore , PIEcR-B1 mRNA was directly induced by
20E a nd its downregulation d epended on protein synthesi s.
An exposure of i maginal wing cells to 20E in the presence of
JH II caused an increased expression of Plodia E75-B and
HR3 t ranscription factors but inhibited the second increase
of PIEcR-B1 mRNA. These findings showed that in vitro
JH II was able to prevent the 20E-induced differen tiation of
imaginal wing cells. This effect could result from a JH II
action on the 20E-indu ced genetic cascade through a
modulation o f EcR-B1, E75-B and HR3 expression.
Keywords: d ifferentiation; 20-hydroxyecdysone; i maginal
wing cells; juvenile hormone; steroid hormone receptor
superfamily.
Postembryonic d evelopment of in sects is characterized by a
growth phase which is punctuated by a series of larval molts.
When the larva has attained its characteristic size, the
metamorphic molt(s) is initiated to produce an adult. The
larva carries sets of diploid i maginal cells which a re tucked
away in its body and contribute little or nothing to the
functioning of the larva [1]. The imaginal cells typically
proliferate during the larval life and at metamorphosis
differentiate into new adult o rgan to replace their larval
counterpart. This strategy of early sequestration and
formation of i maginal discs is typical for most imaginal
structures of higher Diptera and for the wing discs of

Lepidoptera [2]. This type of development depends on
changes in hemolymphatic levels both of the steroid
hormone 20-hydroxyecdysone (20E) and the sesquiterpe-
noid juvenile hormone (JH II).
The c ontemporary advances in insect endocrinology
and tissue culture have led to widespread, even routine
use, of organ cultures and cell lines for the investigation of
hormonal action [3,4]. N evertheless, most in vitro studies
over the ensuing three decades have focused on ecdyster-
oids [5,6] while few experiments have been performed for
JH II. The first effects of 20E have been reported on
lepidopteran and dipteran imaginal discs cultured in vitro
[7–9]. The mesothoraric wing discs of last larval instar of
Plodia interpunctella respond to 20E by an evagination
followed by a morphological differentiation and the
synthesis of tanned cuticle [8] as described for cultured
Drosophila melanogaster discs [9]. These diverse 20E-
induced responses were inhibited in presence of JH II
[10,11]. Therefore, these results suggested that in vitro
JH II could counteract the 20E-induced differentiation of
imaginals discs but the molecular basis of this action
remained largely unknown.
Most 20E-induced responses are mediated by a nuclear
heterodimeric complex ec dysone receptor (EcR)/ultraspira-
cle [12,13] w hich, when a ctivated by 20E, evokes t he
sequential transcription of genes encoding proteins that
ultimately direct the molt [14–16]. These genes were first
characterized in D. melanogaster and identified as tran-
scription factors such a s E75 [17], E74 [18], HR3 [19] and
BRC [20]. In Manduca sexta, some studies have shown

that JH II prevented the metamorphic switching of larval
tissues such as the epidermis through a modulation of
20E-induced genetic cascade [21,22].
Correspondence to D. Siaussat, Laboratoire de Physiologie Cellulaire
des Inverte
´
bre
´
s, Universite
´
Pierre et Marie Curie, 12 rue Cuvier, 75005
Paris,France.Fax:+330144276593,Tel.:+330144276509,
E-mail: address:
Abbreviations: 20E, 20-hydroxyecdysone; ANS, anisomycin; DIG,
digoxigenin; EcRE, ecdysone response element; JH II, juvenile
hormone; PHR3, Plodia interpunctella hormone receptor 3;
PIE75-B, Plodia interpunctella transcription factor E75-B isoform;
PIEcR-B1, Plodia interpunctella ecdysone receptor-B1 isoform;
UTR, untranslated region.
Database: The nucleotide and a mi no acid sequence of PIEcR-B1,
PIE75-B, PHR3 are deposited in G enBa nk under the accession
numbers AY48 9269, AY566195, AY573570, respectively.
(Received 1 April 2004, revised 13 May 2004, accepted 27 May 2004)
Eur. J. Biochem. 271, 3017–3027 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04233.x
Recently, the P. interpunctella HR3 and E75 transcrip-
tion factors (PHR3, PIE75) were characte rized in the IAL-
PID2 cell line established from mesothoracic wing discs
[23,24]. PHR3 a nd PI E75 w ere identified as components of
a 20E-induced genetic cascade associated w ith proliferative
arrest, chitin precursor synthesis and long-term m orpholo-

gical transformation o f IAL-PID2 cells. These c ellular
events could be referred to as differentiative changes of
imaginal wing cells.
This 20E-responsive cell line seemed to be a n appropriate
system in which to identify the molecular mechanisms by
which JH I I could influence the 20E-induced differentiation
of imaginal wing cells. We first tested the sensitivity of
IAL-PID2 cells to JH II examining the effects of this
hormone on 20E-induced late responses such as pro lifera-
tive arrest and morphological differentiation. Using a 5¢/3 ¢
RACE/PCR-based strategy, we isolated a cDNA fragment
encoding a putative P. interpunctella ecdysone receptor B 1-
isoform (PIEcR-B1). Next, we s tudied the effects of JH II
on 20E-induced genetic cascade reporting the indu ction
patterns of PIE75-B isoform, PHR3 , PIEcR-B1 mRNAs by
20E in the presence of JH II. Our results brought evidence
that in v itro JH II prevented the 20E-induced differentiation
of imaginal wing cells. This effect could result from a JH II
action on the 20E-ind uced genetic cascade through a
modulation of PIE75-B, PIEcR-B1 and PHR3 expression.
Materials and methods
Cell culture
The IAL-PID2 cell line was established from imaginal wing
discs of final larval instar of P. interpunc tella Hu
¨
bner, the
Indian meal-moth [25]. The cell line kept its sensitivity to
20E. Cells grow as a loosely attached monolayer. We
maintained them at 26 °Cin75-cm
2

tissue culture fl asks
with 12 mL antibiotic-free Grace’s medium (Gibco BRL)
supplemented with 10% heat-inactivated foetal bovine
serum (Boerhinger Mannheim) and 1% BSA ( Calbiochem).
Cells were subcultured weekly to a near confluent mono-
layer. Cells were rinsed off the bottom of t he flask in a gentle
stream of culture medium and resuspended. Cell density
was e stimated by counting the cells in an aliquot of the
suspension in a Mallassez haemocytometer under the
microscope. A ll the cultures were initiated by seeding flasks
with 1.5 · 10
6
cells. JH I I and anisomycin (ANS) were from
Scitech (Czech Republic) and Sigma, respectively; 20E was a
gift from R. Lafont (UPMC, Paris, France). Stock solutions
of JH II were prepared in dimethyl sulfoxide ( DMSO) and
were stored at )20 °Cinglassvialscoatedwith1%
polyethylene glycol 20 000 to decrease possible adsorptive
loss [26]. All media containing JH II were just prepared
before culture, then they were sonicated and thoroughly
vortexed briefly. For use in culture, 20E and ANS dissolved
in ethanol and JH II in dimethyl sulfoxide were diluted in
appropriate volumes o f s terile Grace’s medium supplemen-
ted w ith foetal bovine serum and BSA. Then, these solutions
were added directly to cell cultures by using glass capillary
pipettes. Final ethanol and dimethly sulfoxide concentra-
tions in all t reatments and control cultures were maintained
at less than 0.1% to prevent any t oxic effect of the solvent.
JH II becomes insoluble in aqueous solution above
2 · 10

)5
M
[27], t herefore the highest concentration used
was 10
)6
M
.
Isolation of RNA and cDNA synthesis
Total RNAs from cells w ere extracted with TRIzol reagent
(Gibco, BRL) and quantified by spectrophotometry at
260 n m. The quality of RNA was checked by electrophor-
esis on a formaldehyde/agarose gel (1%). U sing the first
strand synthesis kit (Roche), 1 lg total RNA was reverse
transcribed into single-stranded cDNA with AMV reverse
transcriptase and Oligo-p(T)
15
as primer. For 5¢-and
3¢-RACE, cDNA was synthesized from 1 lgtotalRNA
at 42 °C for 1.5 h using the SMART RACE cDNA
Amplification kit (Clontech) with 200 U of Superscript II
(GibcoBRL), 5¢-or3¢- CDS-primer and SMART II
oligonucleotide, according to the instructions in the k it.
PCR amplification and cloning
Two degenerate DNA primers (ED1, ER1) were de signed
on the basis of conserved amino acid sequences
(KCQECRL and VEFAKGL) from the DNA and ligand
binding regions of D . melanogaster, Bombyx mori, Tenebrio
molitor, Choristoneura f umiferana and M. sexta ecdysone
receptors (EcRs). PCR was carried out in 100 lL final
volume including 10 m

M
KCl, 6 m
M
ammonium sulfate,
20 m
M
Tris/HCl, pH 8, 2.5 m
M
MgCl
2
with 2.5 U High
Expand Fidelity DNA polymerase (Boerhinger Mannheim)
and 25% of the cDNA pro duced by reverse transcription o f
the total RNAs. The degenerate primers ED1 5¢-forward
primer (5¢-AARTGYCARGARTGYMGNYT-3¢), ER1
5¢-reverse primer (5¢-CARNCCYTTNGCRAAYTCNAC-3¢)
at 1 l
M
and each dNTP at 0.8 m
M
were then added.
Following an initial 5 min denaturation at 94 °C, the
thermal amplification procedure included 5 cycles of
denaturation 1 m in at 94 °C, annealing at 55 °Cfor
1minandanelongationat72°C for 1 min. The reaction
was repeated for 30 cycles with an annealing t emperature of
45 °C.
The blunt-ended PCR product was purified by agarose
gel electrophoresis and cloned with Stratagene’s
pCR-Script

TM
SK(+) cloning kit following the manufac-
turer’s instructions. After colony isolatio n, DNA m inipreps
were prepared and correct insertion was determined by
restriction e nzyme a nalysis. The DNA clone containing the
proper insert was se quenced by the dideoxy chain termin-
ation method [28] (Genome Express, Grenoble, France).
One 477-bp RT/PCR product w as isolated and s equenced.
Rapid amplification of cDNA 5¢/3¢-terminal ends
(5¢/3¢-RACE)
The 5¢-and3¢-regions of the corresponding cDNA were
obtained by 5¢-and3¢-RACE(SMARTRACEcDNA
amplification kit) following the manufacturer’s instructions.
For 5¢-RACE, we used 2 lLof5¢-RACE-ready cDNA with
a s pecific reverse primer 5¢-Race PIX (5¢-CCTGGC G
GCCTCTGGTGGTGGCGG-3¢) and Universal primer
Mix (UPM, Clontech) as the forward anchor primer.
The 3¢-RACE amplification was carried out with UPM
as the reverse primer and a specific forward primer
3018 D. Siaussat et al. (Eur. J. Biochem. 271) Ó FEBS 2004
3¢-Race PIY (5-¢GCGGGGCTCGTGTGGTACCAG
GACG-3¢). Touchdown PCR was performed using hot
start as follows: after 1 min at 94 °C, five cycles of 30 s
at 94 °C and 5 min at 72 °C, then five cycles of 30 s at
94 °C, 30 s at 70 °Cand3minat72°C, then 25 cycles
of 30 s at 94 °C, 30 s at 68 °C and 5 min at 72 °C, then
7 m in at 72 °C. The PCR products were purified and
cloned as described above. By merging the overlapping
sequences obtained from the 5¢-and3¢-RACE, a 6081-bp
cDNA fragment was generated and n amed PIEcR.

Generation of DIG -labelled probe
PIEcR cDNA was digoxigenin (DIG)-labelled by PCR
using the PCR DIG probe synthesis kit (Roche) w ith a
pair of specific primers CED 5¢-forward primer
(5¢-CGCTGGTCCAACAACGGAGGG-3¢), CER 5 ¢-reverse
primer (5¢-TGCCGGTGACAACTCCTCACG-3¢). The
DIG-labelled probe was used at a concentration of
25 ngÆmL
)1
in hybridization solution.
Northern blotting
Northern blot hybridization analysis was performed
according t o the manufacturer’s instructions. RNA sam-
ples (15 lg) were denatured with formamide (50%) a nd
formaldehyde (2.2
M
), separated on 1% denaturating
agarose gel and transferred to a Boerhinger Mannheim
positively charged nylon membrane. Blotted RNA was
hybridized overnight at 55 °C with the PIEcR-B1 probe,
at 42 °CwithPHR3probeandat45°C w ith PIE75-B
specific probe located in the N-terminal region of A/B
domain. A DIG-labelled fragment o f the cDNA encoding
the RpL8 ribosomal protein of P. interpunctella was used
as control probe. An immunological signal detection by
cheluminescence was performed as described in Roche’s
DIG system User’s Guide for filter hybridization. A
molecular RNA ma rker ladder DIG-labelled (Roche) was
runinparalleltodeterminethemolecularmassof
bybridizing RNAs.

Results
Effects of JH II on 20E-induced late responses
in IAL-PID2 cells
We first tested the sensitivity of cells to JH II by studying the
effects of this hormone on the 20E-induced late responses
such as proliferative arrest and m orphological differenti-
ation of IAL-P ID2 cells.
Proliferative arrest. The I AL-PID2 cells were seeded at
1.5 · 10
6
per flask and cultured under normal growth
conditions for 36 h, in our model this period of time
corresponded to t he population doubling t ime [29,30]. Cells
were then treated with only 20E at 10
)7
M
or in combination
with JH II at various concentrations for 36 h. At the end of
treatment, the c ell density w as evaluated . Fig. 1 indicates
that 20E alone induced a striking decrease of cell p rolifer-
ation. By contrast, in combination with JH II at 10
)6
or
10
)7
M
, cells grew at almost the normal rate. Intermediate
levels of cell proliferation were attained at 5 · 10
)8
,10

)8
and 10
)9
M
JH II. We checked that 0.1% ethanol or
dimethly sulfoxide or JH II at 10
)6
M
alone had no effect on
cell growth (Fig. 1).
Morphological changes. After 48 h of 20E treatment at
10
)7
M
, the tr eated cultures (Fig. 2C) appeared t o b e m uch
less dense than control cultures (Fig. 2A). The cells were
elongated and aggregated, often producing long processes
which formed connections between different aggregates
(Fig. 2 C). I n c ombination with JH II at 5 · 10
)8
,10
)8
and
10
)9
M
, the cultures were always composed of pseudo-
epithelial aggregate structures (Fig. 2F, G and H). How-
ever, we noted an increase in the size of aggregate s that w as
related to an increase in cell density as compared to cultures

treated by 20E alone (Fig. 2 C). At the highest concentra-
tions of JH II (10
)6
,10
)7
M
), the cultures did not show any
cell aggregation, or cell cytoplasmic extensions and the cell
density was slightly lower than in the control cultures
(Fig. 2 D and E). In the presence of JH II alone at 10
)6
M
,
the shape and the distribution of the cells in culture were
similar to t hose of control cultures (Fig. 2B). T hese results
showed that JH II was able to inhibit efficien tly the effects
of 20E both on cell proliferation and morphological changes
of IAL-PID2 cells.
Isolation and characterization of
P. interpunctella
EcR-B1
mRNA
Cloning of a PIEcR cDNA frament. We wondered
whether the inhibitory effect of JH II could imply an action
of this hormone on molecular events which occur very early
in the cellular re sponse t o 20E. Therefore, we examined the
effects o f JH II o n the 20E-induced genetic cascade and
decided to clone a P. interpunc tella ecdysone receptor.
Usinga5¢/3¢-RACE/PCR-based strategy, a 6081-bp cDNA
fragment was gener ated and named PIEcR (Fig. 3). The

3¢-untranslated region (3¢UTR) is long (4074 bp) and two
putative polyadenylation signals are present (Fig. 3). The
Fig. 1. Effect of 20E and JH II on the proliferation of IAL-PID2 cells.
The IAL-PID2 cells were seeded at 1.5 · 10
6
per flask and cultured
under normal gro wth conditions f or 36 h. Cells were th en grown f or
36 h in Grace’s medium containing no ho rmone or only 20E at 10
)7
M
or in combinat ion with JH II at various concentrations. At the end of
treatment, the c ell density was e valuated.
Ó FEBS 2004 Effects of JH II on 20E-inducible EcR, HR3, E75 genes (Eur. J. Biochem. 271) 3019
ORF which starts from AUG consistent with the transla-
tion start consensus sequences among general eukaryotes
[31] and D. melanogaster [32] encodes 541 amino acids,
predicting a 62-kDa protein. This ORF includes five
domains (A/B, C, D , E, F ) that a re characteristic members
of the steroid hormone nuclear receptor superfamily
(Fig. 3 ).
Sequence comparison. Ahighdegreeofaminoacid
identity with C. fumiferana EcR (CfEcR) [33], M. sexta
EcR (MsEcR) [34,35], B. mori EcR (BmEcR) [36,37],
T. molitor EcR (TmEcR) [38] and D. melanogaster EcR
(DmEcR) [12,39] was observed in both the DNA binding
region (C region) and t he ligand b inding domain (E region)
of PIEcR (Table 1 ). Therefore, PIEcR was a member of the
Fig. 2. Effect of 20E and J H I I on t he morphology of IAL-PID2 c ells. IAL-PID2 c ells were grown for 48 h in Grace’s m edium containing 0.1%
ethanol (A) o r 10
)6

M
JH II (B) o r 10
)7
M
20E (C) or 10
)7
M
20E in combination with J H I I at v arious concentrations 1 0
)6
M
(D), 10
)7
M
(E),
5 · 10
)8
M
(F), 10
)8
M
(G) and 10
)9
M
(H). Each panel shows the representative area of three replicates. The bar in A represents 40 lminA,B,C,
D, E, F, G and H.
3020 D. Siaussat et al. (Eur. J. Biochem. 271) Ó FEBS 2004
steroid hormone nuclear receptor superfamily and was
clearly assigned to the EcR subfamily.
EcR exists in different isoforms ) Ec R-A, EcR-B1 an d
EcR-B2 [39]. All three share common DNA- and ligand-

binding domains, but each has its own isoform-specific
segment in the N-terminal region of A/B domain which
contains a transactivating domain [40]. The predicted
sequence of A/B domain of PIEcR exhibited significant
amino acid identities w ith the corresponding r egion of B1
isoform of other insect EcRs, d espite differences in the
domain length (Fig. 4). Overall in the A/B region, there was
91, 87, 82, 52, and 42% amino acid identity based on t he
Plodia sequence with CfEcR-B1, BmEcR-B1, M sEcR-B1,
DmEcR-B1, and TmEcR-B1, respectively (Fig. 4). The
strongest s imilarities were confined to the two ends of the B1
isoform s pecific segment in the N-terminal region (Fig. 4).
There was no similarity to the N-terminal specific regions of
either the A or the B2 isoform (data not shown). All of these
results indicate that PIEcR is a B1 type isoform.
Effect of 20E and anisomycin on induction of PIEcR-B1
mRNA. Using a PIEcR-B1 specific probe located in the
N-terminal region of A/B domain, the Northern blot
hybridization on total RNAs revealed a 6-kb transcript
whose expression level was higher i n presence of 20E. T he
size of this transcript is in agreement with the le ngth of the
corresponding cDNA. This 20E-induced transcript could
thus encode a putative P. interpunctella ecdysone receptor-
B1 isoform (PIEcR-B1). To analyse how the expression of
PIEcR-B1 is regulated by 20E, IAL-PID2 cells were
cultured in Grace’s medium containing 20E at 10
)7
M
for
different c ontinuous time exposures. I n the absence of 20E,

Fig. 3. Nucleotide and deduced amino acid
sequences o f PIEcR. Nucleotide numbers are
givenontheleftandtheaminoacidnumbers
on the r ight. Letters in the r ight margin des-
ignate d omains. The DNA binding domain
(C region) is underlined and the ligand binding
domain (E region) is u nderlined with dashes.
The helix–turn–zipper motif is do uble-un der-
lined a nd two p olyadenylation signals in the
3¢UTR a re designed in bold type. D egen erate
primers(ED1)and(ER1)(showninboldtype)
were used to generate a cDNA fragment of
477 b p by RT/PCR. The PIX and PIY pri-
mers used for t h e 5¢/3¢)RACE are s hown in
italic and b old type. The PIEcR-B1 specific
probe was ge nerate d by PCR wit h the two
primers, CED and CER, shown in italic type.
Ó FEBS 2004 Effects of JH II on 20E-inducible EcR, HR3, E75 genes (Eur. J. Biochem. 271) 3021
PIEcR-B1 was c onstitutively expressed a t low level over
time (data n ot shown). B y contrast, the pattern of PIEcR-
B1 mRNA induction by 20E was characterized by a
biphasic r esponse w ith p eaks at 2 h and 1 8 h (Fig. 5A). To
define the minimal concentration of 20E required for an
induction of PIEcR-B1 mRNA, IAL-PID2 cells were
exposed to various concentrations of 20E for 18 h. As
shown in F ig. 5B, a significant indu ction of PIEcR-B1
mRNA was first observed at 10
)7
M
20E with an increase up

to 10
)5
M
.
To determine whether 20E directly initiated the tran-
scription of PIEcR-B1, we stud ied t he effects of protein
synthesis inhibitor, ANS on the induction of PIEcR-B1
mRNA. The IAL-PID2 cells were cultured in Grace’s
medium containing 20E (10
)7
M
)withANS(5lgÆmL
)1
)for
different c ontinuous time exposures. Under these culture
conditions, the presence of ANS caused 9 4% inhibition of
protein synthesis (n ¼ 4) and the cells remained viable even
24 h after A NS removal (data not shown). The Fig. 6 shows
that ANS caused a slight reduction in the level of PIEcR-B1
mRNA within the first 2 h but neither completely prevented
the initial increase induced by 20E. This observation
suggested that the majority of the induction of PIEcR-B1
mRNA by 20E w as independent from protein synthesis and
thus p robably due to direct action of 20E on the PIEcR-B1
gene. The most su rprising result was that the o bserved
declines in the level of PIEcR-B1 mRNA did not occur in
the presence of ANS, suggesting that a 20E-induced
protein(s) synthesis was involved in these decreases.
Regulation of 20E-induced
PIEcR-B1

,
PIE75-B
,
PHR3
transcripts by JH II
The Plodia HR3 and E75 transcription factors have been
identified recently as putative ÔactorsÕ of a 20E-induced
genetic cascade leading t o the inhibition of cell proliferation
and long-term morphological changes of I AL-PID2 cells
[23,24,41]. To examine the effects of J H II on this genetic
cascade, IAL-PID2 cells were cultured in Grace’s medium
containing bo th 20E at 10
)7
M
and JH II at 1 0
)7
M
for
different continuous time exposures. The induction patterns
of PIE75-B, PHR3, PIEcR-B1 mRNAs were determined
under these experimental conditions.
We remarked that in presence of JH II alone at 10
)7
M
or
in absence of hormone, PIE75-B and PIEcR-B1 were
constitutively expressed at a low level over time (Fig. 7A
and C) whereas PHR3 mRNA was never detectable
(Fig. 7 B). In the presence of 20E alone, PHR3 mRNA
was d etectable at 2 h, reached a maximum by 8 h a nd then

declined (Fig. 7B) whereas PIE75-B mRNA was already
highly induced after 1 h, rapidly disappeared by 2 h , then
peaked again at 8 h and was maintained at a high level
(Fig. 7 C). In c ombination with JH II, PHR3 and PIE75-B
transcripts showed temporal patterns similar to those
obtained in response to 20E alone. Furthermore, the
presence of JH II induced an increase in induction level of
these two transcripts (Fig. 7B and C). We also noticed that
the overexpression of PIE75-B occurred only within t he first
4hwhereasthatofPHR3 was maintained during the 32-h
culture period. As concerns PIEcR-B1, JH II had no effe ct
Table 1. Comparison of amino acid sequences of C and E regions
between PIEcR and homologs. D. melanogaster EcR (Dm EcR [12]),
B. mori EcR (BmEcR [37]), M. sexta EcR (MsEcR [35]), C. fumiferana
EcR (CfEcR- [33]), and T. molitor EcR (TmEcR [38]). Indicated are the
lengths of C and E regions of the EcR nuclear rec eptors (number o f
amino acids) and the identity vs. PIEcR expressed as percentage of the
PIEcR sequence.
C region E region
Identity
(%)
Length
(amino acids)
Identity
(%)
Length
(amino acids)
PiECR 100 66 100 222
BmEcR 98 66 87 218
CfEcR 98 66 88 222

MsEcR 98 66 91 222
TmEcR 88 66 66 218
DmEcR 94 66 71 220
Fig. 4. Alignment of the amino a cid sequence of A/B region of PIEcR with D. melanogaster EcR-B1 (DmEcR-B1 [12]), B. mori EcR-B1 (BmEcR-B1
[37]), M. sexta EcR-B1 (MsEcR-B1 [35]), C. fumiferana EcR-B1 (CfEcR-B1 [33]), and T. molitor EcR-B1 (TmEcR-B1 [38]). Gaps are in troduced to
optimize alignm ent. Aste risks indicate identical residu es and dots indicate co nservative su bstitutions. Multiple sequence a lignment was performed
using
CLUSTAL
[58].
3022 D. Siaussat et al. (Eur. J. Biochem. 271) Ó FEBS 2004
on the i nitial 20E-induced increase of PIEcR-B1 mRNA
whereas it prevented the second increase (Fig. 7A).
To determine the effectiveness of JH II, we cultured
IAL-PID2 cells with 10
)7
M
20E alone and in combination
with JH II at various concentrations. Based on the times
required for the maximum inductio n of mRNAs, the l evel of
PIE75-B, PHR3 and PIEcR-B1 mRNAs was assessed after
1, 8 and 18 h exposure, respectively. Fig. 8B and C show
that after 1 h a nd 8 h exposure to 20E, the amount of
accumulated PIE75-B and PHR3 mRNAs increased in
parallel with concentration of JH II up to 10
)6
M
. Thus, the
suppressive effect of JH II on the second 20E-induced
increase in PIEcR-B1 mRNA was also concentration-
dependent when assayed after 18 h exposure to 20E

(Fig. 8 A). These results indicated that the effects of JH II
on PHR3, PIEcR-B1, PIE75-B mRNAs induction by 20E
were both dependent on the amount o f J H II present and
significant from 10
)8
M
JH II.
Finally, all of th ese results demonstrated that JH II acts
on the 20E-induced genetic cascade by differential modu-
lating of the expression of PIEcR-B1, PIE75-B and PHR 3.
Discussion
Our main objective w as to identify some specific molecular
mechanisms through which in vitro JH II was able to
Fig. 6. Effect of anisomycin o n PIEc R-B1 mRNA ind uction. Fifteen
micrograms of total RNAs from I AL-PID2 cells cultured in Grace’s
medium with 20E at 10
)7
M
or with 10
)7
M
20E a nd 5 lgÆmL
)1
aniso-
mycin for various t imes of exposure were analysed by Northern blots
andhybridizedwithPIEcR-B1probe.mRNAlevelsofPIEcR-B1 are
shown a s percentage of its mRNA level in IAL-PID2 cells cultured with
10
)7
M

20E for 18 h. Points are means ± SD (n ¼ 5–11).
Fig. 7. Effect of 20E an d J H II on induct ion of PIE 75-B, PHR3 and
PIEcR-B1 mRNA. Fifteen micrograms of total RNAs from IAL-PID2
cells cultured in Grace’s medium with 20E at 10
)7
M
alone or in
combina tio n with 10
)7
M
JH II for various times were analysed by
Northern blots hybridized with PIEcR-B1 (A), PHR3 (B) or PIE75- B
(C) probes. Levels of the m RNAs of PIE 75-B, PHR3 and PIEcR-B1
are shown as percentages of their respective mRNA levels in IAL-
PID2 cells cultured with 10
)7
M
20E for 1 h, 8 h and 18 h. Points are
means ± SD (n ¼ 5–14).
Fig. 5. Induction of PIEcR-B1 mRNA by 20E. Fifteen micrograms of
total R NAs from IAL-PID2 c ells cultured in Grace’s medium with
20E at 10
)7
M
for various times of exposure (A) or with 20E for 18 h at
different c oncentrations (B) were separated on agarose (1%) formal-
dehyde gel, transferred to nylon membrane and hybridized with
PIEcR-B1 probe. A f ragment of the cDNA encoding the RpL8 ribo-
somal protein of P. int erpuntella was used as c on trol probe.
Ó FEBS 2004 Effects of JH II on 20E-inducible EcR, HR3, E75 genes (Eur. J. Biochem. 271) 3023

counteract 20E-induced differentiation of imaginal discs. To
accomplish t his w ork, we used a 20E responsive IAL-PID2
cell line established from mesothoracic imaginal wing discs
isolated at the last larval instar of P. interpunctella lepidop-
tera [25]. These imaginal cells respond to 20E at 10
)7
M
by
an arrest of cell proliferation and long-term m orphological
changes marked b y the formation of pseudoepithelial
aggregates structures. These 20E-induced late responses of
IAL-PID2 cells resemble, in general terms, the metamorphic
transformation of many different imaginal cell types in
D. melanogaster and other holometabolous insects [42,43].
A10
)7
M
concentration of 20E was both close to physio-
logical levels of 20E (in the order of 10
)7
to 10
)6
M
[44] or
2 · 10
)8
to 6 · 10
)6
M
[45]) a nd sufficient t o induce in vitro

eversion and differentiation of imaginal discs [9,46]. First,
we tested the sensitivity of IAL-PID2 cel ls to JH II a nd
showed that in combination with 20E, JH II inhibited
significantly the 20E-induced late responses from 10
)8
M
as
already reported in D. melanogaster Kc cells [44]. This
concentration of JH II was close to physiological levels
which were estimated at 4 · 10
)9
to 2 · 10
)7
M
[45].
To examine the effects of JH II on the 20E-induced
genetic cascade, we first cloned a 6081-bp cDNA encoding a
putative P. interpunctella ecdysone receptor named PIEcR.
The deduced amino acid sequence of PIEcR was most
highly similar to those of EcR proteins from other
lepidopterans, M. sexta [34,35], C. fumiferana [33] and
B. mori [36,37]. The highest identity was located in the C
and E domains. The C domain was identical i n length (66
aminoacids)toDmEcR,CfEcR,MsEcR,TmEcR,BmEcR
and has two C ys2–Cys2 type zinc finger motifs that serve as
interfaces in both DNA–protein and p rotein–protein inter-
actions [47]. The E domain is known to be involved i n ligand
binding, transcriptional activation (or repression), nuclear
translocation a nd dimerization [48]. It h as been demonstra-
ted that EcR needs to form a heterodimer with the

ultraspiracle p rotein for binding to the EcRE sequence
and transactivation [13]. The helix–turn–zipper motif which
seems to be essential for receptor dimerization [49] is present
in PIEcR (Fig. 3).
PiEcR had significant amino acid identities (especially
with the B1 i soform) o f other insect EcRs and a strong
degree of identity was confined to the two ends of
N-terminal region of the A/B domain. Using a B1
isoform-specific probe from the A/B region of PIEcR, we
detected by Northern hybridization one transcript of 6 kb,
closeinsizetothoseofDmEcR-B1 (6 .8 kb), MsEcR-B1
(6 kb), CfEcR-B1 (6 kb), BmEcR-B1 (6.2 kb) and TmEcR-
B1 (6.5 kb) mRNAs. This result revealed the expression of
ecdysone receptor B1 isoform in imaginal wing cells of
P. inte rpunctella at the last larval instar.
In the fifth larval instar of M. sexta, i t has been reported
in vitro that 20E i nduced a c oexpression of MsEcR-B1 and
MsEcR-A during t he metamorphic s witching of abdominal
epidermis. The two isoforms were directly upregulated by
20E but differed in their responsiveness to 20E and to
protein synthesis inhibitor s [34]. The pattern of PIEcR-B1
mRNA induction by 20E showed a biphasic response which
was similar t o that o f MsEcR-B1 mRNA. Inhibition of
protein synthesis slowed the rapid accumulation of PIEcR-B1
mRNA and prevented its subsequent decline. This result
agrees with the effects of anisomycin on the induction of
MsEcR-B1 mRNA by 20E. Therefore, during the differen-
tiation of imaginal wing cells, the expression of PIEcR-B1
was regulated both by 20E and 20E-induced protein(s),
presumably transcription factors in the same manner as

MsEcR-B1 at the time of metamorphic switching of
abdominal epidermis.
Some developmental studies have shown that EcR
isoforms are expressed in a tissue- and stage-specific
manner, thus contributing to the spatial and temporal
diversity of the response t o 20E [33,34,37–39,50,51]. Our
study revealed that EcR-B1 seemed to be the single form
associated with 20E-induced morphological changes of
imaginal wing cells of Plodia. Using a probe common to all
EcR isoforms, we succeeded to detect a second 20E-
inducible transcript whose e xpression level was much lower
Fig. 8. Concentration–respons e curves for the effectiveness of JH II.
IAL-PID2 cells cultured in Grace’s medium with 10
)7
M
20E alo ne or
in combination with J H II a t various concentrations and the levels of
expression of PIE75-B, PHR3 and PIEcR-B1 were a ssessed b y N or-
thern blotting after 1, 8 and 18 h exposure, respectively. mRNA levels
of PIE75-B, PHR3 an d PIEcR-B1 are shown as percentages of the ir
respective mRNA levels in IAL-PID2 cells c ultured with 10
)7
M
20E
for 1 , 8 and 18 h. Points a re means ± SD (n ¼ 7–13).
3024 D. Siaussat et al. (Eur. J. Biochem. 271) Ó FEBS 2004
than that of PIEcR-B1 mRNA (data not shown). If this
transcript is the Plodia EcR-A isoform, then Plodia imaginal
discs would be similar t o t hose o f Manduca during the pupal
predifferentiative phase necessary for eversion and cuticle

synthesis [34].
In several holometabolous insects, at t he end of last instar
larvae, i maginal discs are characterized by a high proportion
of cells blocked in the G
2
phase in response to the rising
ecdysteroid titre prior to pupation [52,53]. In IAL-PID2
imaginal cells, recent works have shown that the G
2
arrest is
associated with high induction of PHR3 mRNA and a
decrease in the expression level of A and B cyclins which
occurred after 8 h of 20E continuous treatment [41]. We
noticed that the induction of PIEcR-B1, PIE75-B, PHR3
mRNAsby20Ewasenhancedasearlyas2hof20E
exposure an d thus prior to the inhibition of A and B cyclin
expression. According to all these d ata, we suggest that 2 0E
could i nitiate a genetic cascade involving EcR-B1, HR3,
E75-B to regulate the expression of cyclins and ultimately
the G
2
/M transition. Some RNA interference experiments
are in progress to identify the sequence of the molecular
events linking the 20E action with proliferative arrest. It has
been reported that in combination with 20E, JH II was able
to increase the induction level o f PHR3 mRNA, restore the
expression of A and B cyclins a nd consequently prevent G
2
arrest [41]. Our study confirmed the effect of JH II on the
20E inducibility of P HR3 and re vealed that this hormone

also modulated the induction level of PIEcR-B1 and PIE75-
B mR NAs. This action of JH II provided an argument
for the existence of a strong correlation between the
20E-induced genetic cascade, c yclins and proliferative arrest.
JH II had no e ffect on th e initial 20E-induced increase in
PIEcR-B1 mRNA whereas it p revented the second increase.
This result was agreement with that obtained on EcR
homologous gene in the M. se xta epidermis. In this tissue,
JH II prevented the 20E-induced metamorphic switching b y
regulating the induction of EcR by 20E [21,22]. On the other
hand, our study demonstrated that JH II increased the level
of PIE75-B without modifying its induction pattern by 20E.
This JH II effect was similar to that reported on the 20E
inducibility of the E75-A isoform in the cultured silk gland
of Galleria mellonella and in M. sexta epidermis [21,22,54].
The JH II effects on 20E-induced PHR3, PIE75-B, PIEcR-
B1 mRNAs were concentration dependent and significant
at 10
)8
M
. This JH II concentration was identical to that
found in the hemolymph at the onset of the fi fth larval molt
of M. sexta [55].
Molecular data f rom Manduca wing discs have demon-
strated that B R-C transcription factor plays a key role for
their differentiation and that its expression is clearly
controlled by JH II [56]. Therefore, in order to complete
our work, some experiments are in progress to characterize
a Plodia BR-C and then t o examine the effects of JH II
on its induction pattern by 20E in our IAL-PID2 imaginal

wing cells.
The i ncreased amounts of both PIE75-B and PHR3
mRNAs by JH II were most probably due to an increased
transcription rate. One possible action of JH II is to stabilize
the open chromatin structure of the PIE75-B and PHR3
promoters around the ecdysone respon se element (EcRE) so
that 20E can readily access t he binding site of EcR and thus
induce an increase in transcription level. Our studies,
however, have not ruled out a possible additional e ffect of
JH II on increasing the stability of HR3 and E75-B
mRNAs.
We noticed that JH II had no early effect on the response
of PIEcR-B1 while it regulated quantitative ly t he level of
PIE75-B and PHR3 mRNAs induced by 20E. These results
suggested that the later effect of JH II on the expression
pattern of PIEcR-B1 could be due to differences in
induction level of PIE75-B and PHR3 mRNAs by 20E in
the presence of JH II or to some other factors not yet
identified. It has been suggested that HR 3 genes are
candidates for the feedback repression of EcR [57]. In
M. sexta and D. melanogaster, some studies have shown
that DmEcR and MsEcR were rep ressed when DmHR3 and
MsHR3 beguntobehighlyexpressed[33,51].Sucha
correlation was fo und in our IAL-PID2 cells for the
expression of PIEcR-B1 and PHR3.Therefore,inthe
presence of JH II, the increased accumulation of PH R3
mRNA could inhibit the second increase in PIEcR-B1
mRNA and block the 20E-induced molecular cascade
leading to proliferative a rrest and morphological differen-
tiation of IAL-PID2 cells. This second rise in EcR-B1

mRNA seen in response to 10
)7
M
20E in vitro is
probably required for the differentiative cellular c hanges
of lepidopteran wing discs.
Finally, we demonstrated that in vitro JH II was a ble to
prevent the 20E-induced differentiation o f imaginal wing
cells. In addition, for the fi rst time, our study revealed that
JH II also modulates differently the 20E inducibility o f
EcR-B1 and E75-B isoforms in imaginal cells. This JH II
effect on 20E-induced genetic cascade could be associated
with its action in prevention of differentiative program of
imaginal wing discs at the onset of metamorphosis.
References
1. Cohen, S. (1993) Imaginal Discs Development. Cold Spring Harbor
Press, Cold Spring Harbor, N Y. 9, 74 7–841.
2. Oberlander, H. (1985) The imaginal discs. Comp. I nse ct P hys iol.
Biochem. Phar macol. 2, 151–182.
3. Oberlander, H. & Ferkovich, S.M. (1994) Physiological and
developmental capacities of insect cell lines. In Insect Cell
Biotechnology (Maramorosch,K.&McIntosh,A.H.,eds),pp.
129–140. CRC Press, Boca Raton.
4. Lynn,D.E.,Oberlander,H.&Porcheron, P. (19 88) Tissues and
cells in culture. In Microsocopy Anatomy of Invertebrates (Locke, M.,
ed.), 11C, 1 1 19–1141. Wiley-Liss Inc, New Yor k.
5. Oberlander, H. (1983) Imaginal disks. In Endocrinology of Insects.
(Downs, R.G.H and Laufer, H., e ds), pp. 503–507. A lan R. Liss,
New York.
6. Dinan, L., Spindler-Barth, M. & Spindler, K D. (1990) Insect cell

lines a s tools for studying ecdysteroid action. I nverte brate Reprod.
Dev. 18 , 43–53.
7. Oberlander, H. & Fulco, L. (1967) Growth and partial meta-
morphosis of imaginal disks of the Greater Wax Mo th Galleria
mellonella in v itro. Nature 216, 1 140–1141.
8. Silhacek, D.L., Oberlander, H. & Porcheron, P. (1990) Action of
RH 5849, a non-steroidal ecdysteroid mimic, on Plodia inter-
punctella (H u
¨
bner) in vivo and in vit ro. Arch. Insect Biochem.
Physiol. 15 , 201–212.
9. Milner, M.J. & Sang, J.H. (1974) Relative activities of a-ecdysone
and b-ecdysone for the differentiation in vitro of Drosophila
melanogaster imaginal discs. Cell 3, 141 –143.
Ó FEBS 2004 Effects of JH II on 20E-inducible EcR, HR3, E75 genes (Eur. J. Biochem. 271) 3025
10. Oberlander, H. & Tomblin, C. (1972) Cuticule deposition in
imaginal d isks: effects of juvenile hormone and fat body in vitro.
Science 177, 441–442.
11. Chihara, C.J., Petri, W.H., Fristrom , J.W. & King, D.S. (1972)
The assay of ecdysones and juvenile hormones on Drosophila
imaginal d iscs in vitro . J. Insect Phys iol. 18, 1115–1123.
12. Koelle, M.R., Talbot, W.S., Segraves, W.A., Bender, M.T.,
Cherbas, P. & Hogness, D.S. (1991) The Drosophila EcR gen e
encodes a n ecdysone recep tor, a new member of the s tero id
receptor superfamily. Cell 67, 5 9–77.
13. Yao, T.P., Segraves, W.A., Oro, A.E., McKeown, M. & E vans,
R.M. (1992) Drosophila ultrasp iracle modulates ecdysone receptor
function via heterodimer formation. Cell 71 , 63–72.
14. Andres, A.J. & T hummel, C.S. (1992) Hormones, puffs and flies:
The molecular control of metamorphosis by ecdysone. Trends

Genet. 8, 132–138.
15. Thummel, C.S. (1995) From embryogenesis to metamorphosis:
The re gulation and function of Drosophila nuclear receptor
superfamily members. Cell. 83, 871–877.
16. Cherbas, P. & Cherbas, L. (1996) Molecular aspects of ecdysteroid
hormone action. In Metamorphosis: Postembryonic Reprogramming
of Gene Exp ression in Amphibian and Insect Cells (Gilbert, L.I.,
Tata, J.R. & Atkinson, B.G ., eds), pp. 175 –221. Aca demy Press,
San Diego.
17. Segraves, W.A. & H ogness, D.S. (1990) The E75 ecdysone -
inducible gene responsible for the 75B early puff in Drosophila
encodes tw o new m embers of the steroid receptor su perf amily.
Genes Dev. 4, 2 04–219.
18. Thummel, C.S., Burtis, K.C. & Hogne ss, D.S. (1990) Sp acial and
temporal patterns of E 74 transcription during Drosophila devel-
opment. Cell 61, 101–111.
19. Koelle, M.R., Se graves, W.A. & Hogness, D.S. (1992 ) D HR3: a
Drosophila ste roid receptor h omolog. Proc. Natl Acad. Sci. USA
89, 6167–6171.
20. Dibello, P.R. , Withers, D. A., Bayer, C.A ., Fristom, J. W. & Guild, G. M.
(1991) The Drosophila Broad-Com plex encodes a f amily of related
proteins containing, zinc fi ng er. Genetics 129 , 385–397.
21. Hiruma,K.,Shinoda,T.,Malone,F.&Riddiforf,L.M.(1999)
Juvenile hormone modulates 20-hydroxyecdysone-inducib le
ecdysone receptor and ultraspiracle gene expression in the tobacco
hornworm, Manduca s exta. Dev. Genes E vol. 209, 1 8–30.
22. Zhou, B., Hiruma, K., J indra, M., Shinoda, T., S e graves, W.A.,
Malone, F. & Riddiford, L.M. (1998) Regulation of the tran-
scription factor E75 by 20-hydroxyecdysone and juvenile hormone
in the e pidermis of the tobacco hornworm, Manduca sexta,during

larval molting a nd metamorphosis. Dev. Bio l. 193, 1 27–138.
23. Debernard, S., Boz zolan, F., Du portets, L. & Porche ron, P. (2001)
Periodic expression o f an ecdysteroid-induced n uclear receptor in
a lepidopteran cell line (IAL-PID2). Insect Biochem. Mol. Biol. 31,
1057–1064.
24. Siaussat, D., Mottier, V ., Bozzolan, F., Porcheron, P . &
Debernard, S. (2004) Synchronization of Plodia interpunctella
lepidopteran cells a nd effects of 20-hydroxyecdysone. Insect Mol.
Biol. 13, 179– 187.
25. Lynn, D.E. & Oberlander, H. (1983) The establishment of cell lines
from imaginal wing discs of Spodoptera frugiperda and Plodia
interpunctella. J. Insect Physiol. 29, 591 –596.
26. Riddiford, L.M., Curtis, A.T. & Kiguchi, K. (1979) Culture of the
epidermis of t he tobacco h o rnworm Manduca sexta. Tissue Cult.
Assoc. Man. 5, 9 75–985.
27. Kramer, K.J., Sanburg, L.L., Kezdy, F.J. & Law, J.H. (1974) The
juvenile hormone bindin g protein in the hemolymph of
Manduca s exta. Proc. Natl Acad. Sci. USA 71, 4 93–497.
28. Sanger, F., Nicklen, S. & Coulson, A.R. ( 1977) DNA sequencing
with ch ain termination inhibitors. Proc . Natl Acad. Sci. USA 74,
5463–5467.
29. Hatt, P J., Liebon, C., Morinie
`
re,M.,Oberlander,H.&
Porcheron, P. (1997) Activity of insulin growth factors and shrimp
neurosecretory o rgan extracts on a lepidopteran cell line. Arch.
Insect Bioc hem. Physiol. 34, 313–328.
30. Auzoux-Bordenave, S., Hatt, P J. & Porc heron, P. (2002) A nti-
proliferative effect of 20-h ydroxyecdysone in a lepidopteran cell
line. Insect Biochem. Mol. Biol . 32, 217 –223.

31. Kozak, M. (1984) Complilation and analysis of sequences
upstream from the translational star t site in eukaryotic mRNAs.
Nucl. A cids. Res. 12 , 857–872.
32. Caverner, D.R. (1987) Comparison of the consensus sequence
flanking translational start sites in Drosophila and v ertebrates.
Nucl. A cids Res. 15 , 1353–1362.
33. Perera, S.C., Ladd, T .R., Dhadi alla, T.S., Krell, P.J., Sohi, S.S.,
Retnakaran, A. & Palli, S.R. (1999) Studies on two ecdysone
receptor isoforms of the spruce budworm, Christoneura fumiferan.
Mol Cell. Endocrinol. 152, 73–84.
34. Jindra, M., Malone, F., H iruma, K. & Ridd iford, L.M. (1996)
Developmental profiles and ecdysteroid regulation of the
mRNAsfortwoecdysonereceptorisoformsintheepidermisand
wings of the tobacco hornworm, Man duca s exta. Dev. Biol. 180,
258–272.
35. Fujiwara, H., Jindra, M., Newitt, R., Palli, S.R., Hiruma, K. &
Riddiford, L.M. (1995) Clon ing of an ecdysone receptor homolog
from Manduca sexta and the developmental p rofi le of its mRNA
in wings. Insect Biochem. Mol. Biol. 25, 845–856.
36. Swevers, L., Drevet, J.R., Lunke, M .D. & Iatrou, K . (1995) The
silkmoth homolog of the Drosophila ecdysone receptor (B1 iso-
form): cloning and analysis of expression during follicular cell
differentiation. Insect Bioc hem. Mol. Biol. 25, 857–866.
37. Kamimura, M., Tomi ta, S. & Fujiwara, H. (19 96) Molecular
cloning of an e cdysone receptor (B1 isoform) homologue from the
silkworm, Bombyx mori, a nd its m RNA expression during wing
disc development. Comp.Biochem.Physiol.113B, 341–347.
38. Mouillet, J.F., Delbecque, J.P., Quennedey, B. & Delachambre,
J. (1997) Cloning of two putative ecdysteroid receptor
isoforms from Tenebrio molitor and their de velopme ntal expres-

sion in th e epidermis during metamorphosis. Eur. J. Biochem. 248,
856–863.
39. Talbot, W.S., Swyryd, E.A. & Hogness, D.S. (1993) Drosophila
tissues with d ifferent metamorphic responses to ec dysone express
different ecdysone receptor isoforms. Cell. 73, 1323–1337.
40. Tora, L., Gronemeyer, H., Turcotte, B., Gaub, M.P. & Chambon,
P. (1988) The amin o- terminal region of the chicken progesterone
receptor s pecifies target gene activation. Na ture 333, 1 85–188.
41.Mottier,V.,Siaussat,D.,Bozzolan,F.,Porcheron,P.&
Debernard, S. (2004) The 20-hydroxyecdysone-induced cellular
arrest in G2 phase i s p receded by an i nhibition o f c yclin expres-
sion. Insect. Biochem. Mol. Biol. 34, 5 1–60.
42. Lynn, D .E. & Oberlander, H. (1981) The effect of cytoskeletal
disrupting agents on the morp hological response of a cloned
Manduca sexta cell line to 20-hydrox yecd yso ne. Rouxs Arch. Dev.
Biol. 190, 150–155.
43. Peel, D.J. & Milner, M.J. (1992) T he response of Drosophila
imaginal disc cell lines to ecdysteroids. Roux’s Arch. D ev Biol. 202,
23–35.
44. Cherbas, L., Koehler, M.M. & Cherbas, P. (1989) Effects of
juvenile hormone on the ecdysone response of Drosophila Kc cells.
Dev. Gen et. 10,188.
45. Ni J.H. & Iiout, H.F. (1994) Insect Hormones. Princeton Uni-
versity Press, Princeton, NJ.
46. Milner, M.J. (1977) The time during which b-ecdysone is required
for the differentiation in vitro and in situ of wing imaginal wing
discs of Dros ophila melanogaster. Dev. Biol . 56, 206 –212.
47. Freedmann, L.P. (1992) Anatomy of the steroid receptor zinc
finger region. Endo. R ev. 13, 1 29–145.
3026 D. Siaussat et al. (Eur. J. Biochem. 271) Ó FEBS 2004

48. Truss, M. & Beato, M. (1993) Steroid h ormone receptors: Inter-
action with deoxyribonucleic ac id and transcription factors. Endo. Rev.
14, 459–479.
49. Maksymowych, A.B., Hsu, T.C. & Litwack, G. (1993) A n ovel,
highly conserved structural motif is present in all members of t he
steroid r eceptor superfamily. Receptor 2, 225–240.
50. Robinow, S., Talbot, W.S., Hogness, D.S. & Truman, J.W. (1993)
Programmed ce ll death in t he Drosophila CN S is ecdyson e-regu-
lated and coupled with a specific ecdysone recep tor i soform.
Development 119, 1251–1259.
51. Huet, F., Ruiz, C. & Richards, G. (1995) Sequential gene activation
by ecdysone in Drosophila melanogaster: the hierarchical equiva-
lence of e arly and e arly late genes. Development 121, 1195–1204.
52. Delachamb re, J., Besson, M.T., Quenn edey, A. & Delbecque, J.P.
(1984) In Biosynthesis, Metabolism and Mode of Action of
Invertebrates Hormones (Hoffmann,J.&Porchet,M.,eds),pp.
245–254. Springer -Verlag, Berlin.
53. Fain, M.J. & Stevens, B. (19 82) Alterations in the cell cycle o f
Drosophila imaginal disc cells pr ecede m etamorphosis. Dev. Bio l.
92, 247–258.
54. Jindra, M. & Riddiford, L.M. (1996) Expression of ecdysteroid-
regulated transcripts in the silk gland of the wax moth, Galleria
mellonella. Dev. Genes Evol. 206, 305–314.
55. Baker, F.D., Tsai, L.W., Reuter, C.C. & Schooley, D.A. ( 1987)
In vivo fluctuation of JH II, JH II acid, and ec dysteroid titer, and
JH II esterase activity, during development of fifth stadium
Manduca s exta. Insect Biochem. 17, 989–996.
56. Zhou, B., Hiruma, K., S hinoda, T. & Riddiford, L.M. (1998)
Juvenile hormone prevents ecysteroid-induced expression of
Broad-complex RNA in the epidermis of the tobacco hornworm,

Manduca se xta. Dev. Biol . 203, 2 33–244.
57. White, K.P., H urban, P., Watanabe, T. & Hogness, D.S. (1997)
Coordination of Drosophila metamorp hosis by two ecdysone-
induced nuclear receptors. Science 276, 114–117.
58. Higgins, D.G. & Sharp, P.M. (1988) CLUSTAL: a package for
performing multiple sequence alignment o n a microcomputer.
Gene 73, 237–244.
Ó FEBS 2004 Effects of JH II on 20E-inducible EcR, HR3, E75 genes (Eur. J. Biochem. 271) 3027