Báo cáo Y học: Biosynthesis of vitamin B2 An essential zinc ion at the catalytic site of GTP cyclohydrolase II ppt

Biosynthesis of vitamin B
2
An essential zinc ion at the catalytic site of GTP cyclohydrolase II
Johannes Kaiser
1
, Nicholas Schramek
1
, Sabine Eberhardt
1
, Stefanie Pu¨ ttmer
2
, Michael Schuster
2
and Adelbert Bacher
1
1
Lehrstuhl fu
¨
r Organische Chemie und Biochemie, Technische Universita
¨
tMu
¨
nchen, Garching, Germany;
2
Lehrstuhl fu
¨
r
Anorganische und Analytische Chemie, Technische Universita
¨
tMu
¨

nchen, Garching, Germany
GTP cyclohydrolase II catalyzes the hydrolytic release
of formate and pyrophosphate from GTP producing
2,5-diamino-6-ribosylamino-4(3H)-pyrimidinone 5¢-phos-
phate, the first committed intermediate in the biosynthesis of
riboflavin. The enzyme was shown to contain one zinc ion
per subunit. Replacement of cysteine residue 54, 65 or 67
with serine resulted in proteins devoid of bound zinc and
unable to release formate from the imidazole ring of GTP or
from the intermediate analog, 2-amino-5-formylamino-
6-ribosylamino-4(3H)-pyrimidinone 5¢-triphosphate. How-
ever, the mutant proteins retained the capacity to release
pyrophosphate from GTP and from the formamide-type
intermediate analog. The data suggest that the enzyme
catalyzes an ordered reaction in which the hydrolytic release
of pyrophosphate precedes the hydrolytic attack of the
imidazole ring. Ring opening and formate release are both
dependent on a zinc ion acting as a Lewis acid, which acti-
vates the two water molecules involved in the sequential
hydrolysis of two carbon–nitrogen bonds.
Keywords: formate; GTP cyclohydrolase; imidazole ring;
pyrophosphate; zinc ion.
GTP cyclohydrolases catalyze the first steps in the biosyn-
thetic pathways of riboflavin, tetrahydrofolate and tetra-
hydrobiopterin. More specifically, GTP cyclohydrolase I
catalyzes the release of C8 of GTP (Compound 1, Fig. 1)
followed by the formation of a novel pyrazine ring with
inclusion of carbon atoms 1¢ and 2¢ of the ribose side chain
[1,2]. The reaction product, dihydroneopterin triphosphate
(Compound 3, Fig. 1), is the first precursor in the biosyn-

thetic pathways of tetrahydrofolate and tetrahydrobiopterin
[3,4]. GTP cyclohydrolase II catalyzes the hydrolytic release
of C8 of GTP accompanied by the release of pyrophosphate
from the carbohydrate side chain of GTP. The enzyme
product, 2,5-diamino-6-ribosylamino-4(3H)-pyrimidinone
5¢-phosphate (Compound 4, Fig. 1), is the first committed
precursor in the biosynthesis of riboflavin (vitamin B
2
)[5].
Recently, GTP cyclohydrolase II was also shown to catalyze
the formation of GMP from GTP at  10% the rate of
formation of the main product, Compound 4 [6]. It was also
shown that the 5¢-triphosphates of 8-oxo-7,8-dihydro-2¢-
deoxyguanosine and 8-oxo-7,8-dihydroguanosine can be
converted into the respective monophosphates, although the
enzyme is unable to open the imidazole ring of the
structurally modified guanine residues of these nucleotides
[7]. Despite certain similarities in their reaction mechanisms,
GTP cyclohydrolases I and II have no detectable sequence
similarity.
Recently, we found that GTP cyclohydrolase I contains
an essential zinc ion at each active site [8]. Mutant proteins
unable to bind zinc are totally unable to catalyze the
opening of the imidazole ring of GTP.
In this paper, we show that a zinc ion complexed to three
cysteine residues is absolutely required for the release of
formate from GTP by GTP cyclohydrolase II, whereas the
metal ion is not required for the enzyme-catalyzed release of
pyrophosphate from the substrate.
EXPERIMENTAL PROCEDURES

Materials
Oligonucleotides were custom-synthesized by MWG Bio-
tech, Ebersberg, Germany. Nucleotide triphosphates were
purchased from Sigma-Aldrich Fine Chemicals, Munich,
Germany. 2-Amino-5-formylamino-6-ribosylamino-4(3H)-
pyrimidinone 5¢-triphosphate was prepared as described
previously using the H179A mutant of GTP cyclohydrolase
I [9]. DNA sequencing was performed by MWG Biotech.
Micro-organisms and plasmids
Bacterial strains and plasmids used in this study are
summarized in Table 1.
Site-directed mutagenesis
Site-directed mutagenesis was performed by PCR using the
overlap extension technique [10]. PCR was performed with
Pfx polymerase (Gibco BRL, Karlsruhe, Germany) to
minimize the error rate. The internal mismatch primers are
showninTable1.
The general scheme of mutagenetic PCR involved three
rounds of amplification cycles using two mismatch and two
flanking primers (primers MF and BamH1rev, Table 1).
During the first round, 20 amplification cycles were carried
Correspondence to A. Bacher, Lehrstuhl fu
¨
r Organische Chemie und
Biochemie, Technische Universita
¨
tMu
¨
nchen, Lichtenbergstr. 4,
D-85747 Garching, Germany. Fax: + 49 89 289 13363,

Tel.: + 49 89 289 13360, E-mail:
(Received 12 June 2002, revised 5 September 2002,
accepted 9 September 2002)
Eur. J. Biochem. 269, 5264–5270 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.03239.x
out with one of the flanking primers and the corresponding
mismatch primer. The plasmid pECH2 [11] was used as
template. During the second amplification cycle, 20 ampli-
fication cycles were carried out using the second flanking
primer and the corresponding mismatch primer. The
plasmid pECH2 was used as template. Compounds from
both amplification rounds were purified by agarose gel
electrophoresis. During the third round, the products of
both round one and two were used as templates, and 20
amplification cycles were carried out using the two flanking
primers. The resulting compound was subjected to agarose
gel electrophoresis, digested with BamHI and EcoRI,
purified using the QIAquick PCR purification kit, and
ligated into plasmid pNCO-113 which had been digested
with the same restriction enzymes. The ligation mixture was
transformed into Escherichia coli XL1-blue cells (Strata-
gene, Heidelberg, Germany). All gene constructs were
verified by DNA sequencing. Protein expression was
performed in E. coli M15 (Table 2).
Enzyme purification
Recombinant GTP cyclohydrolase II of E. coli was purified
by published procedures [12].
Enzyme assays
Enzyme-catalyzed formation of Compound 4 by GTP
cyclohydrolase II was monitored by a published procedure
[6].

Assay of pyrophosphate release
Reaction mixtures containing 100 m
M
Tris/HCl, pH 8.0,
5m
M
MgCl
2
,2m
M
substrate (GTP or Compound 2) and
protein were incubated at 37 °C. Aliquots of 100 lLwere
retrieved at intervals. The reaction was stopped by removal
of the enzyme by ultrafiltration (Nanosep 10K Omega; Pall
Life Sciences, Ann Arbor, MI, USA), and 30 lL aliquots of
the filtrates were applied to an HPLC anion-exchange
column (Gromsil SAX; 200 · 4 mm; 5 lm; Grom, Herren-
berg, Germany). The column was washed with 30 mL 5 m
M
ammonium phosphate, pH 2.7, and was developed with a
linear gradient of 5–530 m
M
ammonium phosphate,
pH 3.8. The flow rate was 1 mLÆmin
)1
. The effluent was
monitored photometrically (Knauer Wellchrom K-2600;
Knauer, Berlin, Germany) at 254 nm, 272 nm, 293 nm and
330 nm.
Zinc determination

A solution containing 2
M
HCl and 400 lgÆmL
)1
protein
was incubated at 90 °C for 5 h and then analyzed using
a Unicam 919 flame atomic absorption spectrometer
(Unicam, Cambridge, UK).
RESULTS
Earlier studies on GTP cyclohydrolase II suggested the
complex reaction pathway shown in Fig. 1 [6]. Briefly, it was
proposed that the reaction is initiated by the hydrolytic
release of pyrophosphate, possibly involving the formation
of a covalent phosphoguanosyl derivative of the enzyme.
Carbon 8 of the guanine moiety is then assumed to be
released as formate by two consecutive hydrolytic reactions.
Thereactionisbelievedtobeterminatedbyhydrolysisof
the presumed phosphodiester or phosphoamide bond
between enzyme and substrate. This reaction sequence can
explain the formation of GMP as a side product accounting
for about 10% of the enzyme activity [6].
Fig. 1. Reactions catalyzed by GTP cyclohydrolases. (A) GTP cyclo-
hydrolase I; (B) GTP cyclohydrolase II [6].
Ó FEBS 2002 Biosynthesis of riboflavin (Eur. J. Biochem. 269) 5265
The recent finding that GTP cyclohydrolase I requires
zinc for the hydrolytic opening of the imidazole ring of GTP
[8] prompted us to analyze GTP cyclohydrolase II from
E. coli for the presence of zinc ions by atomic absorption
spectrometry. As shown in Table 3, the wild-type protein
from E. coli prepared by a published procedure [12] was

found to contain 0.71 zinc ions per subunit.
As structural information on GTP cyclohydrolase II is
not available, we decided to screen for amino acids involved
in zinc chelation by site-directed mutagenesis. Sequence
comparison revealed a CX
2
GX
7
CXC motif which occurs in
all cyclohydrolase II sequences (Fig. 2). Each of the three
cysteine residues was replaced with serine by PCR-assisted
mutagenesis. The mutations were confirmed by DNA
sequencing. The mutant genes could be expressed to high
levels, and the proteins could be purified by the protocol
reported for the wild-type enzyme. Replacement of any of
the three cysteine residues in GTP cyclohydrolase II resulted
in proteins that were devoid of zinc within the limit of
experimental accuracy (Table 3).
The conversion of GTP into the product, Compound 4,
can be monitored photometrically. The series of spectra
shown in Fig. 3 shows isosbestic points at 231 and 271 nm.
Product formation can best be monitored photometrically
at 300 nm at which the substrate, GTP, shows only very low
absorbance.
Each of the mutant proteins failed to convert GTP into
2,5-diamino-6-ribosylamino-4(3H)-pyrimidinone 5¢-phos-
phate (Compound 4, Table 4). The catalytic rates were less
than 1 nmolÆmg
)1
Æmin

)1
. This translates into less than one
product molecule formed per subunit and per hour.
We have previously shown that 2-amino-5-formylamino-
6-ribosylamino-4(3H)-pyrimidinone 5¢-triphosphate (Com-
pound 2, Table 4) can serve as substrate for GTP
cyclohydrolase II, although it does not qualify as a
kinetically competent intermediate [13]. The compound is
Fig. 2. Sequence comparison of GTP cyclohydrolase II. Aae, Aquifex
aeolicus;Aac,Actinobacillus actinomycetemcomitans;Apl,Actinoba-
cillus pleuropneumoniae;Ath,Arabidopsis thaliana;Bsu,Bacillus sub-
tilis;Cmu,Chlamydia muridarum;Cpn,Chlamydophila pneumoniae;
Ctr, Chlamydia trachomatis;Eco,Escherichia coli;Hin,Haemophilus
influenzae;Hpy,Helicobacter pylori;Mtu,Mycobacterium tuberculosis;
Nme, Neisseria meningitides;Pgu,Pichia guilliermondii;Sce,Sac-
charomyces cerevisiae;Ssp,Synechocystis species;Tma,Thermotoga
maritima.
Table 1. Oligonucleotides used in this study. Oligonucleotides were designed to hybridize to the sense (–) and antisense (+) strand of the ribA.
Designation
Primer
orientation Sequence
MF +
ACACAGAATTCATTAAAGAGGAGAAATTAACCATG
BamH1rev – GCAAATGGGATCCACAATGCAAGAGG
P-C54S-f + CATTCCGAATCTCTGACTGGTGAC
P-C54S-r – GTCACCAGTCAGAGATTCGGAATG
P-C65S-f + GCTTGCTGTCTGATTGTGGCTTC
P-C65S-r – GAAGCCACAATCAGAACGCAAGC
P-C67S-f + GCGCTGCGATTCCGGCTTCCAGC
P-C67S-r – GCTGGAAGCCGGAATCGCAGCGC

Table 3. Zinc content of GTP cyclohydrolase II of E. co li.
Mutant Zn
2+
per subunit (mol/mol)
Wild-type 0.71
C54S < 0.1
C65S < 0.1
C67S < 0.1
Table 2. Micro-organisms and plasmids used in this study.
Strain or plasmid Genotype or relevant characteristic Ref. or source
E. coli XL1-Blue recA1, endA1, gyrA96, thi
–
1, hsdR17, supE44,
relA1, lac [F¢, proAB, lacl
q
ZDM15, Tn10(tet
r
)]
Stratagene [28]
E. coli M15 [pREP4] lac, ara, gal, mtl, recA
+
, uvr
+
, [pREP4: lacl, kana
r
] [29]
pNCO113 High-copy expression vector [29]
5266 J. Kaiser et al.(Eur. J. Biochem. 269) Ó FEBS 2002
deformylated by the wild-type enzyme at a rate of
122 nmolÆmg

)1
Æmin
)1
and has been interpreted as an
intermediate analog that can be converted into the enzyme
product, Compound 4, but does not occur as an interme-
diate in the physiological reaction starting with GTP as
substrate. All mutants shown in Table 4 have lost the ability
to catalyze the release of formate from the formamide-type
compound. It follows that a zinc ion is absolutely required
for the opening of the imidazole ring of GTP as well as for
the subsequent hydrolysis of the resulting formamide motif
of Compound 4.
Studies with the H179A mutant of GTP cyclohydrolase I
had shown the formation of the formamide-type Com-
pound 2 (Fig. 1) from GTP to be a reversible reaction with
an equilibrium constant of  0.1 at 30 °C and pH 7.0 [9]. It
was therefore in order to check whether the proteins under
study can catalyze ring closure of Compound 2 with
formation of a guanosine nucleotide. Attempts to detect
GMP or GTP in reaction mixtures containing one of the
proteins in Table 3 and Compound 2 as substrate were
unsuccessful.
We previously showed that GTP cyclohydrolase II
catalyzes the formation of GMP as a minor product by
the release of pyrophosphate from GTP [6]. Specifically,
GMP was formed at  10% of the rate of formation of the
enzyme product, Compound 4. All mutants shown in
Table 3 can catalyze the formation of GMP from GTP,
albeit at a reduced velocity. Specifically, the rate for the

C54S mutant was  60% of that of the wild-type, and
the relative rates of the C65S and C67S mutants were in the
range 10–20%. It follows that the zinc ion is not required for
the release of pyrophosphate from GTP. However, the
release of phosphate from GTP by the wild-type and mutant
proteins requires magnesium ions.
The wild-type enzyme has been shown to catalyze the
release of pyrophosphate from the intermediate analog,
Compound 2. We have now found that the mutants in
Table 3 retain the ability to catalyze that reaction with for-
mation of 2-amino-5-formylamino-6-ribosylamino-4(3H)-
pyrimidinone 5¢-monophosphate, which was identified by
ion-exchange HPLC (Table 4).
GMP and GDP do not serve as substrates for formation
of Compound 2 by wild-type GTP cyclohydrolase II, as
shown already by Foor & Brown [5]. These authors also
reported that GTP cyclohydrolase II is unable to use
nucleotide triphosphates other than GTP as substrate. A
reinvestigation using the recombinant E. coli enzyme
showed that pyrophosphate can be catalytically released
from deoxyGTP by the wild-type enzyme as well as by the
zinc-deficient mutants obtained by replacement of cysteine
residues. Moreover, the wild-type enzyme was able to
catalyze ring-opening reactions with deoxyGTP as substrate
as shown by photometric analysis (Fig. 4). UV absorbance
changes observed with GTP and deoxyGTP were similar
(data not shown). The rate of the ring-opening reaction
catalyzed by wild-type GTP cyclohydrolase II was
182 nmolÆmin
)1

Æmg
)1
for GTP and 38 nmolÆmin
)1
Æmg
)1
fordeoxyGTPassubstrate.
DISCUSSION
Flavin coenzymes are indispensable in all cellular organisms
because of their involvement in redox processes of central
metabolic pathways that are crucial for energy transduction.
The precursor of flavocoenzymes, riboflavin (vitamin B
2
), is
Fig. 3. Ultraviolet spectra. A reaction mixture containing 100 m
M
Tris/HCl,pH8.0,10m
M
MgCl
2
,90l
M
GTP, and 0.25 mg protein
was incubated at 30 °C. Spectra were recorded at intervals of 75 s.
Fig. 4. Formation of products from deoxyGTP by GTP cyclohydrolase
II.
Table 4. Catalytic activity of GTP cyclohydrolase II mutants. The activity with different substrates (first row) and products (second row) is shown.
Protein
Activity (nmolÆmg
)1

Æmin
)1
)
GTP
4
dGTP
12
2
4
GTP
GMP
dGTP
dGMP
2
9
Wild-type 182 38 122 16 25 15
C54S <1 <1 <1 10 1.1 5
C65S <1 <1 <1 2 1.2 <1
C67S <1 <1 <1 3 1.1 <1
Ó FEBS 2002 Biosynthesis of riboflavin (Eur. J. Biochem. 269) 5267
biosynthesized by plants and many micro-organisms,
whereas animals depend on nutritional sources.
For numerous pathogenic micro-organisms, the enzymes
of the riboflavin biosynthetic pathway are essential proteins.
Specifically, Enterobacteriaceae are virtually unable to
absorb flavins from the environment and are therefore
absolutely dependent on their endogenous production [14].
The same has been shown for several yeast species including
Candida guilliermondii [15,16].
Mycobacterium tuberculosis and Mycobacterium leprae

both have complete sets of riboflavin biosynthesis genes. As
these genes have apparently survived the extensive frag-
mentation of genes in M. leprae [17], they are likely to be
essential for the intracellular lifestyle of Mycobacteria. The
genes of riboflavin biosynthesis are therefore putative
targets for the treatment of infections caused by Gram-
negative bacteria and possibly by Mycobacteria and
pathogenic yeasts. The exploration of novel anti-infective
targets is of supreme importance in the light of the rapid
progression of resistance development in all microbial
pathogens.
In contrast with the riboflavin biosynthetic pathway, the
dihydrofolate pathway was already validated as an anti-
infective target in the first half of the last century (for reviews
see references [18,19]). In fact, sulfonamides inhibiting
dihydropteroate synthase were the first chemotherapeutic
agents with a broad antimicrobial and antiprotozoal
spectrum of activity. Later, trimethoprim, an inhibitor of
dihydrofolate reductase, was introduced for the treatment
of bacterial infections, often in combination with sulfona-
mides.
Both the riboflavin and tetrahydrofolate pathway start
from GTP (Fig. 1). The first step of each pathway involves
the hydrolytic opening of the imidazole ring of the substrate
with formation of formate as a byproduct. However, the
enzyme products are different in structure. In the case of
GTP cyclohydrolase I, the ring-opening step is followed by
a complex series of reactions leading to formation of a
dihydropterin [1,2,20–24]. Another difference is the release
of pyrophosphate by GTP cyclohydrolase II but not by

GTP cyclohydrolase I.
Although GTP cyclohydrolase I has been known for
more than three decades, it was only recently shown that the
hydrolytic opening of the imidazole ring and the subsequent
release of formate requires a zinc ion acting as a Lewis acid,
which sequentially activates the two water molecules that
serve as nucleophiles in the two consecutive hydrolytic
reactions [8]. Because of the mechanistic similarities of the
two different GTP cyclohydrolases, we investigated the type
II enzyme for the presence of zinc. The data are consistent
with the presence of one zinc ion per subunit of the
homodimeric enzyme of E. coli. The comparison of numer-
ous putative GTP cyclohydrolase II sequences indicated a
pattern of three absolutely conserved thiols (Fig. 2). The
sequence motif fits well with the typical short spacer/long
spacer motif found in a number of catalytic zinc-binding
sites [25].
The replacement of any of the three conserved cysteine
residues produced mutants with zinc levels below the level of
detection. This suggests that the catalytic zinc ion is chelated
by cysteine residues 54, 65 and 67 of the E. coli enzyme, and
that loss of any one of the three thiol groups is sufficient to
abolish the zinc-binding capacity of the protein. For
comparison, the catalytic zinc of GTP cyclohydrolase I is
chelated by two cysteine and one histidine residues, whereas
a second histidine residue contacts the metal via an
interpolated water molecule (J. Rebelo, G. Auerbach, A.
Bracher, G. Bader, H. Nar, M. Fischer, C. Ho
¨
sl, N.

Schramek, J. Kaiser, R. Huber, and A. Bacher, unpublished
work). The replacement of any of the four amino-acid
residues involved in zinc chelation is sufficient to abolish the
zinc-binding capacity as well as the catalytic activity of the
enzyme.
The mutant proteins resulting from the replacement of
any of the conserved cysteine residues in GTP cyclohydro-
lase II with serine failed to catalyze the formation of the
enzyme product, Compound 2, from GTP at a detectable
rate. Moreover, these mutants failed to release formate from
the formamide-type Compound 4, which is a substrate of
wild-type GTP cyclohydrolase II, although it lacks the
characteristics of a kinetically competent intermediate [13].
We conclude that the catalytic action of zinc is required for
the hydrolytic opening of the imidazole ring as well as for
the subsequent hydrolysis of the formamide-type product 7
with formation of formate.
These findings suggest the hypothetical mechanism
shown in Fig. 5. The formation of a covalent linkage
between the substrate and the enzyme with formation of
pyrophosphate is the first and rate-determining step [13]. A
nucleophilic attack by a zinc-activated water molecule leads
to the formation of a GTP hydrate, Compound 14.
Cleavage of the C8–N9 bond leads to the formamide
intermediate, Compound 15. In analogy with the mechan-
ism of zinc proteases (Fig. 6) [26], the co-ordination number
of zinc could then be increased to five through complexation
of an additional water molecule, which attacks the zinc-
complexed formyl group of the intermediate 16. The
resulting tetrahedral intermediate could lose formate, and

product 4 could be released by hydrolysis of the covalent
bond between enzyme and substrate. In a final hydrolytic
step, the product is released from the enzyme.
It was recently shown that the 5¢-triphosphates of
8-oxo-7,8-dihydro-2¢-deoxyguanosine and 8-oxo-7,8-di-
hydroguanosine can be converted into the respective
monophosphates by GTP cyclohydrolase II, although the
enzyme is unable to open the imidazole ring of the
structurally modified guanine residues of these nucleotides
[7]. GTP cyclohydrolase II has also been shown to catalyze
the conversion of GTP into GMP. This side reaction occurs
at a rate of about 10% compared with the formation of the
product, Compound 4, in the case of the wild-type enzyme
of E. coli. Mutants obtained by replacement of cysteine 54,
65 or 67 retain the capacity to produce GMP from GTP by
hydrolytic release of pyrophosphate, although at a reduced
rate. It follows that zinc is not required for the hydrolytic
release of pyrophosphate. On the other hand, magnesium
ions are required for pyrophosphate release. In fact, none of
the partial reactions specified in Fig. 1 can be observed in
the absence of magnesium ions.
These observations are all consistent with the hypothesis
of an ordered mechanism in which the release of pyrophos-
phate depending on the co-operation of magnesium ions
must precede all other reaction steps (Fig. 7). In parallel to
many other reactions involving nucleoside triphosphates,
magnesium may be required for complexation of the
triphosphate motif before substrate binding. The formation
5268 J. Kaiser et al.(Eur. J. Biochem. 269) Ó FEBS 2002
of a covalent linkage between the substrate and GTP

cyclohydrolase via a phosphodiester or phosphoamide
motif is likely to be the rate-limiting step [27]. After the
hydrolytic release of formate, the covalent linkage between
enzyme and reaction intermediates can be cleaved hydro-
lytically. Cleavage of the phosphodiester or phosphoamide
bond can also occur without preliminary ring opening, thus
affording GMP from GTP. However, it should be noted
that the covalent binding of the intermediate to the enzyme
has not yet been documented directly.
ACKNOWLEDGEMENTS
This work was supported by the Deutsche Forschungsgemeinschaft,by
European Community Grant ERB FMRX CT98-0204, the Fonds der
Chemischen Industrie and the Hans Fischer-Gesellschaft. We thank
Angelika Werner for expert help with the preparation of the
manuscript.
REFERENCES
1. Burg, A.W. & Brown, G.M. (1968) The biosynthesis of folic acid.
VIII. Purification and properties of the enzyme that catalyzes the
production of formate from carbon atom 8 of guanosine tripho-
sphate. J. Biol. Chem. 243, 2349–2358.
2. Shiota, T. & Palumbo, M.P. (1965) Enzymatic synthesis of the
pteridine moiety of dihydrofolate from guanine nucleotides.
J. Biol. Chem. 240, 4449–4453.
3. Brown, G.M. & Williamson, J.M. (1987) Biosynthesis of folic
acid, riboflavin, thiamine, and pantothenic acid. In Escherichia coli
and Salmonella typhimurium (Neidhardt, F.C., Ingraham, J.L.,
Low, K.B., Magasanik, B., Schaechter, M. & Umbarger, H.E.,
eds), pp. 521–538. American Society for Microbiology, Wash-
ington, DC.
4. Nichol, C.A., Smith, G.K. & Duch, D.S. (1985) Biosynthesis and

metabolism of tetrahydrobiopterin and molybdopterin. Annu.
Rev. Biochem. 54, 729–764.
5. Foor, F. & Brown, G.M. (1975) Purification and properties of
guanosine triphosphate cyclohydrolase II from Escherichia coli.
J. Biol. Chem. 250, 3545–3551.
6. Ritz, H., Schramek, N., Bracher, A., Herz, S., Eisenreich, W.,
Richter, G. & Bacher, A. (2001) Biosynthesis of riboflavin. Studies
on the mechanism of GTP cyclohydrolase II. J. Biol. Chem. 276,
22273–22277.
7. Kobayashi, M., Ohara-Nemoto, Y., Kaneko, M., Hayakawa, H.,
Sekiguchi, M. & Yamamoto, K. (1998) Potential of Escherichia
coli GTP cyclohydrolase II for hydrolyzing 8-oxo-dGTP, a
mutagenic substrate for DNA synthesis. J. Biol. Chem. 273,
26394–26399.
8. Auerbach, G., Herrmann, A., Bracher, A., Bader, G., Gu
¨
tlich, M.,
Fischer,M.,Neukamm,M.,Garrido-Franco,M.,Richardson,J.,
Nar,H.,Huber,R.&Bacher,A.(2000)Zincplaysakeyrolein
human and bacterial GTP cyclohydrolase I. Proc. Natl Acad. Sci.
USA 97, 13567–13572.
9. Bracher, A., Fischer, M., Eisenreich, W., Ritz, H., Schramek, N.,
Boyle,P.,Gentili,P.,Huber,R.,Nar,H.,Auerbach,G.&Bacher,
A. (1999) Histidine 179 mutants of GTP cyclohydrolase I catalyze
the formation of 2-amino-5-formylamino-6-ribofuranosylamino-
4(3H)-pyrimidinone triphosphate. J. Biol. Chem. 274, 16727–
16735.
10. Horton, R.M. & Pease, L.R. (1991) Recombination and muta-
genesis of DNA sequences using PCR. In Directed Mutagenesis
(McPherson, M.J., ed.), pp. 217–246. Oxford University Press,

New York.
11. Eberhardt, S., Richter, G., Ritz, H., Brandt, J. & Bacher, A. (1994)
Biosynthesis of riboflavin. Cloning, sequencing, mapping, and
Fig. 5. Hypothetical mechanism for release of formate by GTP cyclo-
hydrolase II.
Fig. 6. Reaction mechanism of zinc proteases [26].
Fig. 7. Cleland notation for the GTP cyclohydrolase II mechanism.
Ó FEBS 2002 Biosynthesis of riboflavin (Eur. J. Biochem. 269) 5269
hyperexpression of the genes ribA coding for GTP cyclohydrolase
II and ribC coding for riboflavin synthase of Escherichia coli.In
Flavins Flavoproteins 1993: Proceedings of the 11th International
Symposium. pp.63–66.DeGruyter,Berlin,Germany.
12. Bacher, A., Richter, G., Ritz, H., Eberhardt, S., Fischer, M. &
Krieger, C. (1997) Biosynthesis of riboflavin: GTP cyclohydrolase
II, deaminase, and reductase. Methods Enzymol. 280, 382–389.
13. Schramek, N., Bracher, A. & Bacher, A. (2001) Biosynthesis of
riboflavin. Single turnover kinetic analysis of GTP cyclohydrolase
II. J. Biol. Chem. 276, 44157–44162.
14. Shavlovskii, G.M., Tesliar, G.E. & Strugovshchikova, L.P. (1982)
Flavinogenesis regulation in riboflavin-dependent Escherichia coli
mutants. Mikrobiologiia 51, 986–992.
15. Shavlovskii, G.M., Logvinenko, E.M., Kashchenko, V.E., Kol-
tun, L.V. & Zakal’skii, A.E. (1976) Detection in Pichia guillier-
mondii of GTP-cyclohydrolase, an enzyme involved in the 1st stage
of flavinogenesis. Dokl. Akad. Nauk SSSR 230, 1485–1487.
16. Oltmanns, O., Bacher, A. & Lingens, F. (1968) Growth of Candida
guilliermondii deficiency mutants with ethyl methanesulfonate. Z.
Naturforsch. B 23, 1556.
17. Cole, S.T., Eiglmeier, K., Parkhill, J., James, K.D., Thomson,
N.R., Wheeler, P.R., Honore, N., Garnier, T., Churcher, C.,

Harris, D., Mungall, K., Basham, D., Brown, D., Chillingworth,
T., Connor, R., Davies, R.M., Devlin, K., Duthoy, S., Feltwell, T.,
Fraser, A., Hamlin, N., Holroyd, S., Hornsby, T., Jagels, K.,
Lacroix, C., Maclean, J., Moule, S., Murphy, L., Oliver, K., Quail,
M.A., Rajandream, M.A., Rutherford, K.M., Rutter, S., Seeger,
K., Simon, S., Simmonds, M., Skelton, J., Squares, R., Squares,
S., Stevens, K., Taylor, K., Whitehead, S., Woodward, J.R. &
Barrell, B.G. (2001) Massive gene decay in the leprosy bacillus.
Nature (London) 409, 1007–1011.
18. Schweitzer, B.I., Dicker, A.P. & Bertino, J.R. (1990) Dihydrofolate
reductase as a therapeutic target. FASEB J. 4, 2441–2452.
19. Hitchings, G.H. (1971) Folate antagonists as antibacterial and
antiprotozoal agents. Ann. NY Acad. Sci. 186, 444–451.
20. Wolf, W.A. & Brown, G.M. (1969) The biosynthesis of folic acid.
X. Evidence for an Amadori rearrangement in the enzymatic
formation of dihydroneopterin triphosphate from GTP. Biochim.
Biophys. Acta 192, 468–478.
21. Shiota, T., Baugh, C.M. & Myrick, J. (1969) The assignment of
structure to the formamidopyrimidine nucleoside triphosphate
precursor of pteridines. Biochim. Biophys. Acta 192, 205–210.
22. Bracher, A., Eisenreich, W., Schramek, N., Ritz, H., Go
¨
tze, E.,
Herrmann, A., Gu
¨
tlich, M. & Bacher, A. (1998) Biosynthesis of
pteridines. NMR studies on the reaction mechanisms of GTP
cyclohydrolase I, pyruvoyltetrahydropterin synthase, and
sepiapterin reductase. J. Biol. Chem. 273, 28132–28141.
23. Schramek, N., Bracher, A. & Bacher, A. (2001) Ring opening is

not rate-limiting in the GTP cyclohydrolase I reaction. J. Biol.
Chem. 276, 2622–2626.
24. Schramek,N.,Bracher,A.,Fischer,M.,Auerbach,G.,Nar,H.,
Huber, R. & Bacher, A. (2002) Reaction mechanisms of GTP
cyclohydrolase I. Single turnover experiments using a kinetically
competent reaction intermediate. J. Mol. Biol. 316, 829–837.
25. Vallee, B.L. & Auld, D.S. (1989) Short and long spacer sequences
and other structural features of zinc binding sites in zinc enzymes.
FEBS Lett. 257, 138–140.
26. Christianson, D.W., David, P.R. & Lipscomb, W.N. (1987)
Mechanism of carboxypeptidase A: hydration of a ketonic sub-
strate analogue. Proc.NatlAcad.Sci.USA84, 1512–1515.
27. Bacher, A., Eisenreich, W., Kis, K., Ladenstein, R., Richter, G.,
Scheuring, J. & Weinkauf, S. (1993) Biosynthesis of flavins. In
Bioorganic Chemistry Frontiers (Dugas, H. & Schmidtchen, F.P.,
eds), pp. 147–192. Springer, Berlin.
28. Bullock, W.O., Fernandez, J.M. & Short, J.M. (1987) XL1-Blue: a
high efficiency plasmid transforming recA Escherichia coli with
beta galactosidase selection. Bio Techniques 5, 376–380.
29. Stu
¨
ber,D.,Matile,H.&Garotta,G.(1990)Systemforhigh-level
production in Escherichia coli and rapid purification of
recombinant proteins: application to epitope mapping, prepara-
tion of antibodies, and structure-function analysis. In Immuno-
logical Methods (Lefkovits, I. & Pernis, P., eds), pp. 121–152.
Academic Press, Orlando, FL.
5270 J. Kaiser et al.(Eur. J. Biochem. 269) Ó FEBS 2002