Báo cáo khoa học: Fish otolith contains a unique structural protein, otolin-1 doc

Fish otolith contains a unique structural protein, otolin-1
Emi Murayama
1
, Yasuaki Takagi
2
, Tsuyoshi Ohira
1
, James G. Davis
3
, Mark I. Greene
3
and Hiromichi Nagasawa
1
1
Laboratory of Bioorganic Chemistry, Graduate School of Agricultural and Life Sciences, The University of Tokyo, Japan;
2
Otsuchi Marine Research Center, Ocean Research Institute, The University of Tokyo, Japan;
3
Department of Pathology
and Laboratory Medicine, University of Pennsylvania School of Medicine, PA, USA
A collagen-like protein was identi®ed from the otoliths of the
chum salmon, Oncorhynchus keta. The otolith, composed
mainly of calcium c arbonate with small a mount of or ganic
matrices, is formed in the inner ear and serves as a part of the
hearing and balance systems. Although the organic matrices
may play important roles in the growth of otolith, little is
known a bout their chemical n ature a nd physiological func-
tion. In this study, a major organic component of the otolith,
designated otolin-1, which m ay serve as a t emplate for
calci®cation, was puri®ed. The sequences of two tryptic
peptides from otolin-1 revealed high homology with parts of

a saccular c ollagen w hich had been described p reviou sly
[Davis, J.G., O berholtzer, J.C., Burns, F.R. & Greene, M.I.
(1995) Science 267, 1031±1034]. Cloning of a cDNA coding
for otolin-1 revealed that the deduced amino-acid sequence
contained a collagenous domain in the central part of the
protein. Although c ollagen is the most abundant structural
protein in the animal body, otolin-1 mRNA was expressed
speci®cally in the sacculus. Immunohistochemical studies
showed that otolin-1 is synthesized in the transitional
epithelium and transferred to t he otolith and otolithic
membrane. This is the ®rst report concerning characteriza-
tion of a structural protein containing many tandem repeats
of the sequence, Gly-Xaa-Yaa, typical for collagen from the
biomineral composed of calcium carbonate.
Keywords: otolith; collagen; calcium carbonate; b iomineral-
ization; chum salmon.
The inner e ar of teleost ®shes includes three semicircular
canals and three otolithic o rgans c onsisting of the sacculus,
utricle and lagena [1], each of which contains an otolith
called sagitta, asteriscus and lapillus, respectively. Being the
largest of the three, sagitta has been the most widely studied
and is often referred to the term ÔotolithÕ. The ®sh otolith
(sagitta) i s a calci®ed mass that resides in the portion of the
endolymphatic sac called sacculus and participates in ®sh
auditory and vestibular function [2,3]. The otolith is
composed principally of calcium carbonate but also contain
small amount of organic matrices. Although the organic
matrices are considered to play important roles in otolith
formation [4], little is known about their chemical nature
and function.

The otolith has some unique characteristics in com-
parison with other calci®ed tissues. First, there are no
interconnected or attached cells in or on the o tolith, and it
is attached to the otolithic membrane which, in turn, is
connected to the sensory epithelium of the sacculus.
Unlike bones which are c ontinuously re-absorbed and
re-precipitated, otoliths are metabolically inert except
under severe stress [5]. Second, otoliths have ®ne incre-
ments that are added daily throughout postembryonic life
[6,7] probably caused by an alternate deposition of
calcium carbonate-rich a nd organic matrices-rich layers
[8,9]. Base d on these characteristics, otoliths are widely
used for age and growth rate determination in ®shes [10].
Third, otolith i s the only tissue composed of calcium
carbonate in the ®sh whereas bones, teeth and scales are
composed of calcium phosphate. Furthermore, otoliths
are the ®rst calci®ed tissue that arise during embryonic
development in ®shes [11]. In the rainbow trout,
Oncorhynchus mykiss, w e observed the appearance of
plural primordia (otolith nuclei) on approximately t he
15th day in postfertilization ®sh reared at 10 °C.
The composition of endolymph surrounding the otolith is
an important factor for otolith g rowth. This ¯uid is
supersaturated with calcium and bicarbonate ions, a nd its
precise composition is critical for calci®cation [12]. Local
alkaline microenvironments in the endolymph are r equired
to promote the precipitation of the calcium carbonate
[13,14], while endolymph alone does not allow the sponta-
neous precipitation of calcium carbonate. A pH gradient
exists in the s acculus and its r egulation is also important for

the rate of calcium deposition [15]. The otolithic membrane,
an accessory structure that couples the otolith to the sensory
epithelium in the sacculus, may be one site for otolith
formation and it is composed of a gelatinous layer and a
subcupular meshwork. Davis et al. revealed that the con-
stituent of the gelatinous layer of the otolithic membrane
contained meshwork-forming collagens referred to as
saccular collagen in the bluegill sun®sh Lepomis macrochirus
[16,17]. However, it is still unknown about the chemical
nature of organic matrices of subcupular meshwork and
otolith.
Correspondence to H. Nagasawa, Department of Applied Biological
Chemistry, Graduate School of Agricultural and Life Sciences, The
University of Tokyo, Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan.
Fax: + 81 3 5841 8022, Tel.: + 81 3 5841 5132,
E-mail:
Abbreviations: sSC, sun®sh saccular collagen; N-NC domain,
N-terminal noncollagenous domain; C-NC domain, C-terminal
noncollagenous domain; OMP-1, otolith matrix protein-1; ABC,
avidin-biotin-peroxidase complex.
(Received 2 8 August 2001 , revised 22 October 2 001, accepted 26
November 2 001)
Eur. J. Biochem. 269, 688±696 (2002) Ó FEBS 2002
We previously identi®ed otolith matrix protein-1
(OMP-1), a major component of EDTA-soluble matrix
proteins in otoliths of teleost ®shes [18]. OMP-1 has 40%
homology to the C-terminal half of the human melano-
transferrin, a monomeric glycoprotein produced by
human melanoma cells [19] and belonging to the trans-
ferrin family whic h plays a role in iron metabolism [20].

In the rainbow trout, EDTA-soluble matrix proteins
including OMP-1 are synthesized and secreted from the
transitional and squamous epithelial c ells in the sacculus
[21,22]. When otoliths are decalci®ed with EDTA, gelati-
nous insoluble materials remain. It has been reported that
the primordia (otolith nuclei) before calci®cation also had
gel-like material [11,23]. Thus, these gelatinous materials
are thought to be important in the formation of the
otolith.
Here, we describe the characterization of a collagen-like
protein identi®ed as a major component of EDTA-insoluble
gelatinous material obtained from the chum salmon
otoliths.
EXPERIMENTAL PROCEDURES
Fish and otolith
Chum salmon, Oncorhynchus keta, with an average weight
of 3000 g, were captured at the Otsuchi Marine Research
Center, Ocean Research Institute, The University of
Tokyo in Iwate Prefecture. Experimental animals were
randomly selected and anesthetized with 2-phenoxyetha-
nol. Otoliths (sagittae) which weighed  10 mg per single
otolith were collected from the sac culus after decapitation
and stored at room temperature until use. For immuno-
histochemical studies, homing adult chum salmon were
caught by a trap net set at the mouth of Otsuchi Bay,
Iwate prefecture, in November, 2000, and transferred to
the outdoor tank of Otsuchi Marine Research Center.
They were reared in running seawater at  15 °C under a
natural photoperiod.
Extraction of EDTA-insoluble matrix protein from otoliths

Otoliths of chum salmon were rinsed with distilled water
and decalci®ed with 0.5
M
EDTA (pH 8.0) with occa-
sional shaking. The resulting suspension was centrifuged
and the residual precipitate was obtained. The EDTA-
insoluble materials were washed with distilled water
extensively, and extracted with 10 m
M
Chaps at 50 °C
for 2 h.
De-N-glycosylation
The C haps-extracted matrix proteins derived f rom ®ve
otoliths of the chum salmon were desalted with an ultrafree
cartridge (10 000 cut off, Millipore Co.) and concentrated to
a ®nal volume of 2.5 lL, which was added to a mixture o f
2.5 lL o f d enaturing buffer [1% SDS, 1
M
Tris/HCl
(pH 8.6), 0.1
M
2-mercaptoethanol]. The resulting solution
was heated at 100 °C for 3 min. Then, 13 lL of distilled
water and 1 mU of glycopeptidase F (TaKaRa) were added
to this solution, which was incubated at 37 °C for 15 h.
Then, the reaction mixture was concentrated and applied to
SDS/PAGE analysis.
N-terminal and internal amino-acid sequence analyses
Chaps-extracted matrix proteins from t he EDTA-insoluble
materials of 10 otoliths were concentrated by ultra®ltration

as described above and applied to SDS/PAGE with 10%
polyacrylamide gel according to the method of Laemmli
[24]. After electrophoresis, the gel was stained with 0.1%
Coomasie Brilliant Blue G-250 ( Wako, Osaka) or subjected
to electroblotting. Chaps-extracted matrix proteins separa-
ted on SDS/PAGE were electrically transferred to a
poly(vinylidene d i¯uoride) (PVDF) membrane (ATTO,
Tokyo) and stained with 0.2% Coomasie Brilliant Blue
R-350 (Pharmacia). A portio n of the m embrane carrying a
blotted matrix protein with an apparent molecular mass of
100 kDa was cut out and applied to a protein sequencer
(Applied Biosystems model 491cLC) in the pulsed-liquid
mode. On the other hand, the m atrix protein was electro-
eluted from the gel in an elution buffer (20 m
M
Tris/HCl,
pH 8.0, 0.1% SDS) and the eluate was desalted and applied
to a protein sequencer as described above. To analyze
internal amino-acid sequences, the gel carrying the matrix
protein with an apparent molecular mass of 100 kDa was
cut out, crushed into small pieces, and rinsed well with
distilled water. To a tube containing the crushed gel, 300 lL
of 0.1
M
ammonium bicarbonate containing 10% acetonit-
rileand1%TritonX-100wasaddedand1.5lLofTPCK-
treated trypsin (Promega) solution (1 mgámL
)1
in 0.1
M

ammonium bicarbonate) was added. This enzyme solution
was incubated at 37 °C for 24 h. The mixture was ®ltered to
remove small gel pieces, and applied to reverse-phase HPLC
using a Capcell Pak C
18
column (2.0 ´ 150 mm, Shiseido).
Separation was p erformed with a 50-min linear gradient of
10±60% acetonitrile in 0.05% tri¯uoroacetic acid at a ¯ow
rate of 0.2 mLámin
)1
. Fragment peptides were collected
manually by monitoring the absorbances at 225 nm. Mass
spectra of the fragment peptides were measured by MALDI
TOF-MS (Voyager Biospectrometry, Applied Biosystems)
in the positive ion mode using a-cyano-4-hydroxycinnamic
acid as the matrix. Fractions containing more than two
peptides were further puri®ed by reverse-phase HPLC under
the same conditions as above except for the u se of 10 m
M
ammonium bicarbonate instead of 0.05% tri¯uoroacetic
acid. Each peak m ate rial was collected manually and
applied to a protein sequencer as described above.
PCR ampli®cation
Degenerate oligonucleotide primers sOT5¢-R1 (GCYTGRT
CDATRTCYTGICC), designed based on a partial
sequence of the fragment peptide obtained in this experi-
ment, and bgSC-F (TAYAAYGGCARGGICAYTGG
GA), designed on a partial sequence of saccular collagen
previously reported by Davis et al. [16], w ere prepared.
First-strand cDNA was synthesized with a Ready-To-Go

T-primed First-Strand kit (Pharmacia) using 1 lgoftotal
RNA which was isolated from sacculi of chum salmon using
Isogen (Nippongene). The resulting cDNA was then diluted
100-fold, and 1 lL of the diluted solution was used for the
PCR reaction with 1 l
M
of each primer (sOT5¢-R1 and
bgSC-F), 1 ´ LA PCR
TM
buffer II (TaKaRa), 2.5 m
M
MgCl
2
, 400 l
M
dNTP and 1 U of TaKaRa LA Taq
TM
in
a total volume of 20 lL reaction. The ampli®cation was
performed at 95 °C for 2 min at the initial step followed by
Ó FEBS 2002 Collagen-like protein from ®sh otolith (Eur. J. Biochem. 269) 689
35 cycles at 95 °C for 30 s, 54 °Cfor30s,and72°Cfor
30 s. A ®nal extension step was performed at 72 °Cfor
3 min. PCR reactions with only one degenerate primer
(sOT5¢-R1 or bgSC-F) were performed in p arallel as
negative control.
5¢ and 3¢ RACE
First-strand cDNA was s ynthesized with a SMART
TM
RACE cDNA Ampli®cation kit (Clontech) using 1 lgof

total RNA which was isolated from sacculi of chum salmon.
A speci®c primer, TGCGGCGCGCGGGGCCGGTTGC
GCACG (sOT5¢-R2) corresponding to nucleotides 1370±
1397 in Fig. 1A was prepared. 5¢ RACE was performed
with this primer and a universal primer mix (UPM,
Clontech) matching the adapter sequence a t 5¢ end o f
cDNA under the same conditions as described above w ith
the following changes; dimethyl sulfoxide was added at a
®nal concentration of 5%, and the reactions included ®ve
cycles at 94 °Cfor5sandat72°C f or 3 min, followed by
®ve cycles at 94 °Cfor5s,at70°Cfor10s,andat72°C
for 3 min, and 25 cycles at 94 °Cfor5s,at68°Cfor10s,
and at 72 °Cfor3min.3¢ RACE was performed with a
cDNA template synthesized with a Ready-To-Go T-primed
First-Strand kit (P harmacia) as d escribed above. A speci®c
primer, TACGGCCAAGACATCGACCA (sOT3¢-F)
corresponding to nucleotides 1443±1462 in Fig. 1A was
prepared. P CR ampli®cation was performed wi th this
primer and an RTG primer (Pharmacia) matching the
adapter sequence at 3¢ end of the cDNA under the same
conditions as described above with the following changes;
the reaction cycles were reduced to 25, the annealing step
was performed at 55 °C, and t he extension was performed
for 1 min.
Nucleotide sequence analysis
Nucleotide sequence analysis w as performed f or both
strands using the dideoxynucleotide chain termination
method [25] on a Long-Read Tower
TM
DNA sequencer

(Amersham Pharmacia Biotech). Plasmid DNA was puri-
®ed by the alkaline lysis metho d [26]. A sample of 10 lgof
plasmid DNA was used for sequencing with a Thermo
Sequenase Cy 5 d ye terminator cycle sequencing kit
(Amersham Pharmacia Biotech).
Northern blot analysis
Samples of 10 lg each of t otal RNA prepared from the
chum salmon tissues including the sacculi, semicircular
canals, brain, heart tissue, liver, muscle, skin and scales were
subjected to electrophoresis on a 1% agarose gel in 40 m
M
3-(N-morphorino)-propanesulfonic acid (pH 7.0), contain-
ing 18% formamide, then transferred to Hybond N
+
nylon
membrane (Amarsham Pharmacia Biotech), and baked at
80 °C for 2 h. These RNA samples were probed with
otolin-1 cDNA fragment corresponding to nucleotide
1284±1465 in Fig. 1A, randomly labeled with [a-
32
P]dCTP
using a Random Primer DNA Labeling Kit Ver. 2
(TaKaRa). Hybridization was performed at 42 °C in 50%
formamide, 6 ´ NaCl/Cit (0.1
M
NaCl, 0.1
M
sodium
citrate), 1 ´ Denhardt's solution, 0.5% SDS and
20 lgámL

)1
calf thymus DNA for 12 h. The membrane
Fig. 1. Nucleotide sequence of a cDNA encoding otolin-1 and its
deduced amino-acid sequence. (A) T he nu cleotide (upper) and amino-
acid (lower) sequences are i ndicat ed. The putative s ignal peptide (1±25)
is indicated by w h ite text on b l ack background, and the residues t hat
have been direc tly m icroseque nced are i n dicated by a dotted-underline.
Putative O-glycosylation sites are marked b y circles, and possible
N-glycosylation s ites are b oxed. The collagenous domain is indicated
by large boxed-in area. Glycine residues in the collagenous domain are
shown in bold. Brackets enclose the region homologous with the C-NC
domains of collagen types VIII and X. The182 bp RT-PCR fragment
sequence is indicated by dotted rectangles. The partial amino-acid
sequences obtained from pro tein analysis are double-und erlined. An
asterisk repre sents th e ter mination co don, and a consensus ÔAATAAAÕ
polyadenylation signal is underlined. ( B) Schematic representation of
the predicted domain organization of otolin-1 and the putative gly-
cosylation sites. The possible N - a nd O-glycosylation s ites are i ndicated
by squares and circles, re spectively. The nucleo tide sequence w as
submitted to DDBJ/EMBL/GenBank and has been assigned the
accession number AB067770.
690 E. Murayama et al.(Eur. J. Biochem. 269) Ó FEBS 2002
was washed at 65 °C with 0.1 ´ NaCl/Cit for 10 min and
autoradiographed on an X-ray ®lm with i ntensifying screen
at )80 °C for 24 h.
Western blot analysis
A PVDF membrane carrying the matrix protein with an
apparent molecular mass of 100 kDa was prepared as
described above. The membrane was incubated in a
blocking solution (5% s kim milk in NaCl/P

i
)for2hat
room temperature, and then immersed in the blocking
solution containing diluted a f®nity-puri®ed sun®sh saccular
collagen reactive immunoglobulins that had been raised
against a synthetic oligopeptide corresponding to the part of
the C-terminal noncollagenous domain [anti-(C-NC) Ig,
where C-NC is a 138-residue C-terminal noncollagenous
domain] [17] at a concentration of 250 ngámL
)1
for more
than 2 h. T he speci®city of the immunoglobulins had
already been examined by immunoprecipitation and West-
ern blotting w ith various kinds of ®sh tissue lysates
including brain, eighth cranial nerve, gill, and semicircular
canals [17], before our experiments were performed. The
membrane was washed three times each with NaCl/P
i
containing 0.1% Tween-20 for 15 min and t hen, incubated
with 1 : 3000 alkaline-phosphatase conjugated goat anti-
(rabbit IgG) Ig (Bio-Rad) diluted in the blocking solution
for 2 h at room temperature. The membrane was washed
again as de scribed above a nd equilibrated with developing
solution (100 m
M
Tris/HCl/100 m
M
NaCl/50 m
M
MgCl

2
,
pH 9.5) for 5 min. The membrane was then incubated with
25 n
M
each of 5-bromo-4-chloro-3-indolyl phosphate and
4-nitrotetrazolium blue diluted in the developing solution
for 15 min. The reaction was s topped by immersing in
distilled water.
Immunohistochemistry
Fish were deeply anesthetized in a 0 .02% aqueous solution
of 2-phenoxyethanol and decapitated. The head was opened
dorsally and the brain was removed using forceps. Right
and left sacculi, each containing an otolith, were removed
and ®xed in a mixture of 4% paraformaldehyde and 0.2%
glutaraldehyde in 0.1
M
cacodylate buffer (pH 7.5) for 4 h
at room te mperature. The ®xed sacculi were de calci®ed in
10% EDTA in 10 m
M
Tris/HCl (pH 7.5) for 2 days at
room temperature. The decalci®ed sacculi were post ®xed
with the same ®xative as described above for 3 h at room
temperature. The sacculi were then dehydrated in ethanol
and embedded in paraf®n. In order to examine the
localization of 100-kDa EDTA-insoluble otolith matrix
protein (otolin-1)-producing cells, undecalci®ed sections of
sacculi were prepared. Sacculi were removed as described
above a nd ®xed in a mixture of 4% paraformaldehyde and

0.2% glutaraldehyde in 0.1
M
cacodylate buffer (pH 7.5) for
4 h at room temperature. The ®xed sacculi were stored
overnight in 7 0% ethanol at 4 °C. After opening the
posterior end of t he sacculus using a s calpel, the otolith was
removed from the sacculus using ®ne forceps. The sacculi
were then dehydrated in ethanol and embedded in paraf®n.
Transverse sections were cut at 6 lm and mounted on
gelatin-coated slides. Deparaf®nized sections were incubated
for 30 min with a 0.6% H
2
O
2
solution to inhibit endo-
genous peroxidase activity and subsequently with NaCl/P
i
containing 2% normal goat serum for 30 min to prevent
nonspeci®c bin ding o f immunoglobulins. The s ections were
then incubated overnight at 4 °C with 500 ngámL
)1
of anti-
(C-NC) Ig [17]. Localization of immunoglobulins w as
visualized by the avidin-biotin-peroxidase complex (ABC)
method [27] using commercial reagents (Vectastain ABC-
PO Kit, Vector Laboratory, Burlingame, CA, USA) and
3,3¢-diaminobenzidine tetrahydrochloride as a substrate.
Sections were mounted and observed under a differential
interface microscope (Carl Zeiss, Oberkochen, Germany).
RESULTS

Extraction and separation of EDTA-insoluble matrix
proteins from the salmon otolith
Otoliths from the chum salmon were d ecalci®ed with an
EDTA solution. The EDTA-insoluble m aterials exhibited a
gel-like texture and retained the shape of the whole otolith.
These EDTA-insoluble materials were solubilized in a
buffered Chaps solution, then were desalted, concentrated
and subjected to SDS/PAGE analysis. At least two proteins,
one with an apparent molecular mass of 100 kDa and
another with  55 kDa were detected (Fig. 2A). The former
was designated otolin-1 according to the de®nition which
had been described by Degens et al. [4], and the latter was
found to be OMP-1 which we had previously identi®ed and
biochemically char acterized as a major component of
EDTA-soluble matrix proteins [18].
Fig. 2. Characterization of otolin-1 extracted from EDTA-insoluble
matrix pro tein of O. keta otolith. Each sample was subjected to SDS/
PAGE analysis on 10% gel under reduced conditions and stained with
Coomasie Brilliant Blue. (A) Pro®le of the EDTA-insoluble otolith
matrix proteins e xtrac ted with Chaps (lan e 2). The u pper arrow indi-
cates otolin-1 and the lower one OMP- 1, a major component of
EDTA-soluble matrix proteins. Lane 1, molecular mass standards. (B)
Possible N-glycosylation of otolin-1. Lane 1, molecular mass stan-
dards. Chaps-extracted matrix proteins before (lane 2) and after (lane
3) glycopeptidase-F (GPF) digestion. The upper arrow indicates t he
untreated otolin-1, and the lower one ind icates otolin-1 treated w ith
GPF. (C) W estern blot analy sis of Chaps-e xtracted EDTA-insoluble
matrix proteins with anti-(C-NC1) Ig. Otolin-1 is indicated by the
lower arrow and the upper one indicates high molecular mass proteins
(200 kDa).

Ó FEBS 2002 Collagen-like protein from ®sh otolith (Eur. J. Biochem. 269) 691
N-terminal and internal amino-acid sequences
The EDTA-insoluble matrix proteins recovered from the
salmon otolith were resolved by SDS/PAGE analysis and
transferred to a PVDF membrane. T he part of the
membrane that contained otolin-1 was cut out and subjected
to N-terminal protein sequence analysis. The N-terminal
seven amino-acid residues were identi®ed except for
positions 3 and 4 (Table 1). Otolin-1 obtained from the
acrylamide gel by e lectroelution was desalted and also
applied to a protein sequ encer. The results showed that the
N-terminal 15 amino-acid residues were identi®ed except for
positions 1±4 (Table 1).
To analyze the internal amino-acid sequences, otolin-1
was digested w ith trypsin in the acrylamide g el after
electrophoresis and then the digested peptides recovered
from the gel were carboxymethylated. The resulting peptides
were then separated by reverse-phase HPLC (Fig. 3). As the
hatched area (Fig. 3A) was found to contain two tryptic
fragments by MALDI TOF-MS analysis, they were sepa-
rated by reverse-phase HPLC under different conditions
(Fig. 3B) and sequ enced (Table 2).
BLAST
search analysis
[28] revealed that the s equences of both peptides had a high
homology to the sun®sh saccular collagen ( sSC) [16].
Cloning of a cDNA encoding otolin-1
Two degenerate oligonucleotide primers, sOT5¢-R1 and
bsSC-F, were designed based on the amino-acid sequence of
the internal peptide no. 1 and a part of C-terminal sequence

of noncollagenous domain of the sSC, respectively. Using
these primers, PCR was carried out using ®rst strand cDNA
synthesized from chum salmon saccular poly(A)+ R NA as
a template. This yielded a single product of 182 bp in length
(Fig. 1A). Then, a speci®c primer (sOT5¢-R2) was designed
based on this PCR product and 5¢ RACE was p erformed,
giving a 1.5 kbp product. The deduced amino-acid sequence
encoded on this RACE-product contained t he N-terminal
sequence, con®rming that it corresponded to the otolin-1
protein. To identify the 3¢ end o f t he otolin-1 transcript, an
otolin-1-speci®c primer (sOT3¢-F), was designed and
3¢ RACE was performed, g enerating a 444-bp product t hat
contained a deduced amino-acid sequence of the internal
sequence no. 1 and 2.
Thereby the full length otolin-1 cDNA was completed
(Fig. 1A) and it was found to contain a 1524 nucleotide
ORF followed by a 282 nucleotide 3¢ noncoding region that
contained the consensus ÔAATAAAÕ polyadenylation signal
located 16 nucleotides upstream from the start of t he
poly(A) tail. This ORF was found to encode a 508-residue
precursor protein that consisted of a 25-residue signal
peptide and a 227-residue collagenous domain ¯ anked by a
118-residue N-terminal noncollagenous (N-NC) domain
and a 138-residue C-NC domain (Fig. 1B). Otolin-1 con-
tained the collagenous domain at the position from 119 to
345 and two potential N-glycosylation sites at positions 96
and 391, one in each noncollagenous domain (Fig. 1A,B).
As the N -NC domain contained m any serine and threonine
residues, the
NETDGLYC

2.0 program [29] was used to predict
Fig. 3. Elution pro®le of puri®cation of the t ryptic peptides of otolin-1 on
reverse-phase HPLC. (A) The ®rst step RP-HPLC. Column, Capcell
Pak C
18
column (2.0 ´ 150 mm); solvent, 10±60% acetonitrile in
0.05% tri¯uoroacetic acid; ¯ow rate: 0 .2 mLámin
)1
;detection,
absorbance at 225 n m; temperature, 40 °C. The concentration of
acetonitrile is indicated by t he do tted line. The ha tched a rea showed
the fraction containing t wo tryptic peptides. (B) The seco nd step
RP-HPLC. Solv ent, 10±60% acetonitrile in 10 m
M
NH
4
HCO
3
;other
conditions are the same as those described above. Peaks 1 and 2
represent internal fragments 1 a nd 2, resp ective ly.
Table 1. N-terminal amino-acid sequences of otolin-1. Preparation 1 :
otolin-1 was prepared on a PVDF membrane. Preparation 2: otolin-1
was prepared by e lec troelutio n from t he gel. ?, Unidenti®able value.
Preparation Sequence Position
1 T-R-?-?-R-R-P 1±7
2 ?-?-?-?-R-R-P-K-P-Q-N-T-K-K-P 1±15
Table 2. Amino-acid sequences of two puri®ed internal peptides of
otolin-1 by the s eco nd RP-HPLC. Degenerate primer (sOT 5¢-R1) was
designed at the position indicated by the underlined sequence, running

right to left. Position refers to the position in the predicted amino-acid
sequence .
Peptide Sequence Position
Internal 1 D-S-L-Y-
G-Q-D-I-D-Q-A-S-N-L-A-L-L-R 427±444
Internal 2 L-A-S-G-D-Q-V-W-L-E-T-L-R 445±457
692 E. Murayama et al.(Eur. J. Biochem. 269) Ó FEBS 2002
potential O-glycosylation sites (Fig. 1A,B). In vivo
N-glycosylation was evident as glycopeptidase-F digestion
of otolin-1 decreased its apparent molecu lar mass b y
10 kDa as observed on SDS/PAGE (Fig. 2B). When a
homology search using the full length of otolin-1 sequence
was conducted using the Swiss-Prot database, it revealed
that otolin-1 has 68% identity to the sun®sh saccular
collagen [16]. Furthermore, the C-terminal noncollagenous
domain of otolin-1 also had homology to the C-terminal
noncollagenous do mains of the collagen types VIII and X
(Fig. 4).
Tissue-speci®c expression of the otolin-1 mRNA
in the sacculi
To examine the expression levels of the otolin-1 mRNA in
various tissues including the sacculi, semicircular canals,
brain, heart tissue, liver, muscle, skin and scales, Northern
blot analysis was p erformed using a cDNA fragment
encoding a part of otolin-1 (nucleotides 1284±1465, Fig. 1A)
as a probe. The otolin-1 transcript was only detected in the
mRNA from the sacculus a nd was approximately 1.9 kb in
length (Fig. 5). This transcript size agreed well with that of
the otolin-1 cDNA (Fig. 1A).
Localization of otolin-1

To examine the localization of otolin-1, Western blot
analysis and immunohistochemical experiments were per-
formed using anti-(C-NC) Ig [17] that were predicted to
recognize the otolin-1 molecule. In the Chaps-soluble matrix
proteins, a band corresponding to otolin-1 and a broader
band of higher molecular mass were detected (Fig. 2C). The
presence of the higher molecular mass form suggested the
possible existence of an aggregation product that includes
otolin-1. The upper panel in Fig. 6 is schematic represen-
tation of a transverse section of t he chum salmon sacculus.
The saccular wall is a single-layer e pithelium surrounded by
a thin connective tissue layer. The thickest part of the
epithelium is the sensory epithelium comprised of sensory
hair cells and supporting cells. Next to the sensory
epithelium, the transitional epithelium extends outward
until it to transitions into a squamous epithelium comprised
of small, cuboidal- or ¯at-shaped cells. Columnar-shaped
cells are typically found in the transitional epithelium and
are interspersed with mitochondria-rich cells. The otolith
membrane is composed of a gelatinous layer and a
subcupular meshwork, and together they af®x the otolith
to the underlying sensory epithelium. In decalci®ed sections,
the anti-(C-NC) Ig detected the otolin-1 protein in both the
otolith and the gelatinous layer of the otolithic membrane,
but not in the subcupular meshwork (Fig. 6A,B). In
addition, the otolin-1 protein did not appear to be uniformly
distributed within the otolith: some parts stained intensely,
while other parts showed only weak staining. The staining
of the gelatinous layer o f the otolithic membrane w as
modest. In undecalci®ed sections, t he otolin-1 immuno-

reactivity was observed in some of the transitional epithelial
cells, w hich were located adjacent t o the sensory epithelium
(Fig. 6C). The immunoreactivity appeared to be more
concentrated in the basal aspect of those cells. T he number
of immunoreactive cells varied depending on the part of the
sacculus. The sensory epithelium, squamous epithelium and
mitochondria-rich cells were negative for otolin-1 staining.
DISCUSSION
In different ®sh species, the otolith has a species-speci®c
shape that is likely to be due to differential accretion o f t he
Fig. 4. Comparison of the amino-acid sequence of otolin-1 with thos e of other collagens. Align ment of most h omologous regions from the C-NC
domains of otolin-1 (Oto1), sun®sh saccular collagen (sSC), human type X collagen (hType X) and mouse type VIII collagen (mType VIII). The
positions of identical and similar r esidu es are indicated by s haded box an d bold t ype, respectively.
Fig. 5. Tissue speci®c expression of otolin-1 mRNA. Total RNA (10 lg
each) prepared from semicircular canals (SeC), sacculi (Sa), brain (B),
heart tissue (H), liver (L), muscle (M), skin (SK) and scales (SC) were
subjectedtoNorthernblotanalysis.Theblotwasprobedwitha
[a-
32
P]-labeled otolin-1 cDNA as described in Experimental proce-
dures. Size was determined by comparison of migration with RNA size
markers (Gibco). Lower panel shows 18S and 28S rRNA bands
stained with ethidium b romide before blo tting.
Ó FEBS 2002 Collagen-like protein from ®sh otolith (Eur. J. Biochem. 269) 693
inorganic constituents and differential utilization of the
matrix proteins that serve within as a framework. In this
paper, a collagen-like structural protein termed otolin-1 in
the salmon otolith has been identi®ed an d characterized.
When salmon otoliths were decalci®ed, residual, gelatinous
materials in the shape of the otolith r emained and the

otolin-1 protein was determined to be a major component of
this gelatinous material. Thus, it is possible that otolin-1 is
part of the i nternal framework of the otolith where it may,
in part, provide the nucleation site for precipitation of
calcium carbonate crystals.
Otolin-1 has 68% identity (to sSC) that was originally
identi®ed by differential screening of a sun®sh saccular
cDNA library [16]. Though there is high conservation
between both of their C-NC domains, the N-NC domain of
otolin-1 was much l onger than that of the sSC an d appears
to be distinct from that of the sSC. The otolin-1 C-NC
domain, like that of the sSC, had high homology to the
C-NC domain of collagen types VIII [30] and X [31]
(Fig. 4). Collagen types VIII and X are non®brillar short
chain collagens that form three-dimensional meshwork. The
collagenous domain of otolin-1 is smaller than that of the
collagen types VIII and X, and contains 74 perfect Gly-X-Y
repeats w ith three interruptions (imperfect Gly-X-Y
repeats). It is also known that C -NC and N-NC domains
of collagen types VIII and X form the nodes, while the
collagenous domains form the interconnecting spacers and
together collectively they o ligomerize supramolecularly into
a t hree-dimensional, hexagonally arranged lattice [32,33]. If
otolin-1 aggregates like these co llagens, it m ight possibly
provide nucleation sites to facilitate calci®cation.
Furthermore, one or both of two potential N-linked
glycosylation sites (located at positions of 96 and 391)
identi®ed in the otolin-1 protein appear to be utilized in vivo
as glycop eptidase-F digestion was able to reduce the
apparent molecular m ass from 100 to 90 kDa in our

biochemical a nalyses. In addition, many putative O-linked
glycosylation sites are observed at the N-NC domain. These
sugars may facilitate the aggregation of the collagen with
each other and/or with other resident extracellular matrix
moieties such as proteoglycans. Consistent with this possi-
bility, our studies have also indicated that the EDTA-
insoluble, otolith-derived material contained various kinds
of sugars (data not shown).
Collagens are structural proteins present in many an imal
species. Collagen t ype VIII is found loosely dispersed in the
basement membranes of various tissues [34] while collagen
type X is found only in the matrix of the hypertrophic zone
of the epiphyseal growth plate cartilage [35±37], yet is not
the p rimary organic constituent deposited during endo-
chondral ossi®cation. Thus, c ollagen type VIII may serve as
a m olecular b ridge b etween different types of matrix
molecules, whereas collagen type X may serve, in some
manner not yet understood, in the process of mineralization
[38]. In this study, Northern blot analysis revealed that
otolin-1 mRNA was expressed only in the sacculus and
could not be detected even in the semicircular canals,
another sensory structure found in the teleost inner ear.
Therefore, otolin-1 is a special collagen-like protein whose
mRNA distribution is strictly limited in the sacculus.
We also examined the localization of otolin-1 among the
various structures and cells contained within the salmon
sacculus. Immunohistochemical analysis using anti-(C-NC)
Fig. 6. Schematic representation and light micrographs of chum salmon
sacculus stained with anti-(C-NC) Ig. (A) Decalci®ed section. Otolith
(OT) and gelatinous layer (GL). Boundary of OT and GL is shown by

the dotted line. In OT, some regions are stained intensely while other
regions show only modest staining. GL is stained weakly. Bar 
50 lm. (B) D ecalci®ed s e ction. O tolithic m embrane and sensory epi-
thelium ( SE). In the otolithic m embrane, immunoreactivity is weakly
observed in GL, but not in the subc upular meshwork (SM). SE does
notreactwith anti-(C-NC) Ig. Bar  50 lm. (C)Undecalci®ed section.
SE and transitional epithelium ( TE). A part of transitional epithelial
cells, which are located at the periphery of SE, is positively stained with
anti-(C-NC) Ig. Mitochondria-rich cell (*) is negative. Bar  50 lm.
694 E. Murayama et al.(Eur. J. Biochem. 269) Ó FEBS 2002
Ig revealed that otolin-1 was distributed in the otolith,
gelatinous layer of the otolithic membrane and in a part of
the t ransitional epithelial cells. D avis et al. r eported that
anti-(C-NC) Ig reacted with the columnar supporting cells
and t he gelatinous layer of the otolithic membrane, but not
with lower ®lamentous subcupular meshwork in the bluegill
sun®sh [17]. Our observations are consistent with those
previously reported, but we have extended those observa-
tions by dem onstrating that this p articular form of collagen
is also incorporated into and/or onto the otolith. Further-
more, we have detected otolin-1 as a minor component in
the endolymph (data not shown). Based on these results,
otolin-1 was synthesized and secreted apically from the
transitional epithelium into the endolymph, then immedi-
ately incorporated into the otolith and the gelatinous layer
of the otolithic membrane. However, it is still unclear
whether otolin-1 is deposited to the otolith via the o tolithic
membrane or not. In the otolith, otolin-1 did not appear to
be uniformly distributed as some regions were strongly
immunoreactive while other regions were much less so. We

do not yet know how this might be signi®cant concerning
this differen ce. We expected that immunoreactivity was
observed i n t he daily rings, but it was not con®rmed in t his
study. Immunoelectron microscopic analyses may be
required to fully de®ne the p recise distribution and function
of the otolin-1 protein associated with the salmon otolith.
On the basis of these results a nd the fact that the
primordia (otolith nuclei) are organic materials secreted
from the sensory epithelium [23], it may b e that, early on, a
certain part of the primordial otolithic m embrane a nd later
of the gelatinous layer of the otolithic membrane proper,
may s erve as a ÔfoundationÕ for the growth of each
primordium. Then, additional precipitation may occur on
the outer surface of each primordium staying on the suitable
positions of the gelatinous layer. Wh at kind of interaction
does it occur between the primordia and the gelatinous
layer? Do they contain same matrices? Khan et al. r evealed
that at least nine bands were observed from a sample of th e
gelatinous layer of the otolithic membrane from t he
rainbow trout, O. mykiss using SDS/PAGE [39]. Dunkel-
berger et al. noted that the ®brous materials of subcuplar
meshwork could penetrate through the gelatinous layer and
incorporated in the overlying otolith in the juvenile mum-
michog, Fundulus heteroclitus [40]. They also mentioned that
the gelatinous layer is closely associated with the otolith
surface, but incorporation of the ®bers into t he otolith w as
not observed. In the present study, it is not clear whether the
otolin-1 protein detected in the otolith is continuous with
that detected in the g elatinous layer o f the otolithic
membrane or not. To understand the mechanism of onset

of otolith f ormation, a more detailed molecular study of the
interaction between these components at the zone where
new otolith primordia accrues to become ÔnewÕ calci® ed
otolith will be required.
These s tudies suggest the possibility that ®sh might a lso
make use of collagens to promote the mineralization of
calcium carbonate, i.e. in the formation of the otolith just
as they d o for bones and dentin. Major component of
bones and den tin is ®brillar collagen, while that of otolith
is otolin-1 which is a unique molecule belonging to the
family of a short-chain, meshwork-forming collagen.
Thus, otolin-1 may contribute to form biominerals
composed of calcium carbonate in contrast to ®brillar
collagen in bones and dentin made of calcium phosphate.
It has been said that the proteinaceous materials
contained in the otolith are noncollagenous proteins [41].
In this experime nt, we identi®ed a collagen-like protein
containing many tandem repeats of the sequence,
Gly-Xaa-Yaa, from the otolith, one of the biomineralized
tissues composed of calcium carbonate, for the ®rst time.
In contrast, it was reported that a part of the matrix
protein, Lustrin A, from shell and pearl nacre of Haliotis
rufescens, which were also composed of calcium carbon-
ate, had some similarity to the type I collagen [42]. The
region having a homology to the type I collagen is,
however, limited in only 30 amino-acid residues, in which
two glycine residues were replaced by other amino-acid
residues. In addition, it is known that the interaction of
collagen with other matrix proteins is important for bone
formation. In the case o f otolith matrix p roteins, the

EDTA-insoluble fraction also contained OMP-1 as shown
in Fig. 2A, a major component of EDTA-soluble matrix
protein [18]. Therefore, OMP-1 may be trapped by the
meshwork of otolin-1. Further analyses of these complex
intermolecular interactions will be required to understand
how otolin-1, in certain saccular microenvironment,
contributes to otolith formation.
ACKNOWLEDGEMENTS
We are grateful to Dr Akihisa Urano of Division of Biological
Sciences, Hokkaido University for h is g ene rous gift of chum
salmon. We also thank Dr Goro Yoshizaki and Mr Yutaka
Takeuchi of Department of Aquatic Biosciences, Tokyo University
of Fisheries for generous discussion about embryonic development.
This work was supported by Grants-in-Aid for Creative Basic
Research (no. 12NP0201) and for Scienti®c Research (no. 12 876025
and 13660176) from the Ministry of Education, Culture, Sports,
Science and Technology of Japan. E. M. was sup ported by
Research Fellowships o f Japan S ociety for the Promotion of
Science for Young Scientists.
REFERENCES
1. Lowenstein, O. (1971) T he labyrinth. In Fish Physiology: Vol. V.
Sensory Systems and Electric Organs (Hoar, W.S. & Randall, D.J.,
eds), pp. 207±240. Academic Press, New Y ork.
2. Manning, F.B. (1924) Hearing in the gold®sh in relation to the
structure of i ts ear. J. Exp. Zool. 41, 5±20.
3. Fay, R.R. (1980) The gold®sh ear c odes the axis of acoustic par-
ticle rotation in t hreedime nsions. Science 22 5 , 951±953.
4. Degens, E.T., Deuser, W.G. & Haedrich, R.L. (1969) Molecular
structure and compos ition of ®sh otoliths . Mar. Biol. 2, 105± 113.
5. Mugiya, Y. & Uchimura, T. (1989) Otolith resorption by anaer-

obic stress in the gold®sh Carassius auratus. J. Fish. Biol. 35, 813±
818.
6. Pannella, G. ( 1971) Fish otoliths: daily growth layers and peri-
odical patterns. Science 17 3 , 1124±1127.
7. Brothers, E .B., Mathews, C.P. & L asker, R. (1976) Daily growth
increments in otoliths from lar val and a dult ®shes. Fish. Bull. 74,
1±8.
8. Mugiya, Y. (1984) Diurnal rhythm in otolith formation in the
rainbow trout, Salmogairdneri: seasonal reversal of the rhythm in
relation to plasma calcium concentrations. Comp. Biochem.
Physiol. 78A, 2 89±293.
9. Mugiya, Y. (1987) Phase dierence between calci®cation and
organic matrix formation in t he diurnal growth o f otoliths in t he
rainbow trout, Salmo gairdneri. Fish. Bull. 85 , 395±401.
Ó FEBS 2002 Collagen-like protein from ®sh otolith (Eur. J. Biochem. 269) 695
10. Campana, S.E. & Neilson, J .D. (1985) Microstructure of ®sh
otoliths. Can. J. Fish. A quat. Sci. 42, 1014±1032.
11. Radtke, R.L. & Dean, J.M. (1981) Increment formation in the
otoliths of embryos, arvae, and juveniles of the mummichog,
Fundulus heteroclitus. Fish. Bull. 80, 201±215.
12. Romanek, C.S. & Gauldie, R.W. (1996) A predictive model of
otolithgrowthin®shbasedonthechemistryoftheendolymph.
Comp. Biochem. Physiol. 114A, 71±79.
13. Mugiya, Y. (1981) Diurnal rhythm in otolith formation in the
gold®sh, Carassius auratus. Comp. Biochem. Physiol. 68A, 6 59±662.
14. Payan, P., Kosmman, H., Watrin, A., Mayer-Gostan, N. &
Boeuf, G. (1997) Ionic composition of endolymph in teleosts:
origin and importance of endolymph alkalinity. J. Exp. Biol. 200,
1905±1912.
15. Gauldie, R.W. & Nelson, D.G.A. (1990) Otolith growth in ®shes.

Comp. Biochem. Physiol. 97A, 119±135.
16. Davis, J.G., Oberholtzer, J.C., Burns, F.R. & Greene, M.I. (1995)
Molecular cloning and characterization of an inner ear-speci®c
structural protein. Science 267, 1031±1034.
17. Davis, J.G., Burns, F .R., N avaratnam, D ., Lee, A.M., Ichimiya,
S., Oberholtzer, J.C. & Greene, M.I. (1997) Identi®cation of a
structural constituent and one possible site of postembryonic
formation o f a teleost otolithic membrane. Proc. Natl A cad. Sci.
USA 94, 707± 712.
18. Murayama,E.,Okuno,A.,Ohira,T.,Takagi,Y.&Nagasawa,H.
(2000) Molecular cloning and expression of an otolith matrix
protein cDNA from the rainbow trout, Oncorhynchus mykiss.
Comp. Biochem. Physiol. 126B, 511±520.
19. Woodbury, R .G., Brown, J.P., Yeh, M.Y., Hellstro
È
m, I. & Hell-
stro
È
m, K.E. (1980) Identi®cation of a cell s urface protein, p97, in
human melanomas and certain otherneoplasmis. Proc. Natl Acad.
Sci. USA 77, 2183±2187.
20. Aisen, P. & Leibman, A. (1972) Lactoferrin and transferrin: a
comparative study. Biochim. Biophys. Acta 25 7 , 314±323.
21. Takagi, Y. & Takahashi, A. (1999) Characterization of otolith
soluble-matrix producing cells in the saccular e pithelium of rain-
bow trout (On corhynchus my kis) inner e ar. Anat. R ec. 25 4, 3 22±329.
22. Takagi, Y. (2000) Ultrastructural immunolocalization of the
otolith water-soluble-matrix in the inner ear of rainbow trout just-
hatched fry. Fis h Sci. 66, 71±77.
23. Sokolowski, B.H.A. (1986) Development of the otolith in

embryonic ® shes with special ref erence to the toa d ® sh, Opsanus
tau. Scan. Electron. Microsc. 4, 1635±1648.
24. Laemmli, U.K. (1970) Cleavage of structural proteins during
assembly of the bacteriophage T 4. Nature 227, 680± 685.
25. Sanger, F., Nicklen, S. & Coulson, A.R. (1977) DNA sequencing
with chain-terminating inhibitors. P roc. Natl Acad. Sci. USA 74 ,
5463±5467.
26. Sambrook, J., Fritsch, E.F. & Maniatis, T. (1989) Molecular
Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor
Laboratory Press, Co ld Spring Harbor NY, U SA.
27. Hsu, S.M., Raine, L. & Fanger, H. (1981) Use of avidin-biotin-
peroxidase complex (ABC) in immunoperoxidase techniques: a
comparison be twee n ABC and u n labeled antibody (P AP) proce-
dures. J. Histochem. Cy tochem. 29, 577±580.
28. Altschul, S.F., Madden, T.L., Schaer, A.A., Zhang, J., Zhang,
Z., Miller, W. & L ipman, D.J. (1997) Gapped BLAST and PSI-
BLAST: a new generation of proteindatabase searc h programs.
Nucleic A cids Res. 25, 3389±3402.
29. Hansen, J.E., Lund, O., Tolstrup, N., Gooley, A.A., Williams,
K.L. & Brunak, S. (1998) NetOglyc: prediction of mucin type
O-glyco sylation sites b ased on sequencecontext and surfa ce
accessibility. Gl ycoconj. J. 15 , 115±130.
30. Muragaki, Y., Shiota, C., Inoue, M., Ooshima, A., Olsen, B.R. &
Ninomiya, Y. ( 1992) a1 (VIII)-collagen gene transcripts encode a
short-chain collagen polypeptide and are expressed by various
epithelial, endothelial and mesenchymal cells in newborn mouse
tissues. Eur. J. Biochem. 207 , 895±902.
31. Ninomiya, Y., Gordon, M., van der Rest, M., Schmid, T.,
Linsenmayer, T. & Olsen, B.R. (1986) The developmentally
regulated type X collagen gene contains a long open reading frame

without introns. J. Bio l. Chem. 261, 5 041±5050.
32. Sawada, H., Konomi, H. & Hirosawa, K. (1990) Characterization
of the collagen in the h exago nal lattice of Descemet's membrane:
its relation to t ype VIII collagen. J. Cell Biol. 110, 219±227.
33. Kwan, A.P.L., Cummings, C.E., Chapman, J.A. & G rant, M.E.
(1991) Mascromolecular o rganization of c hicken type X collagen
in vitro. J. Cell Bio l. 114, 597±604.
34. Eyre, D.R. (1980) Collagen: molecular diversity in the body's
protein scaold. Science 20 7 , 1315±1322.
35. Sage, H., Pritzl, P. & Bornstein, P. (1980) A unique, pepsin-
sensitive collagen synthesized by aortic endothelial cells in culture.
Biochemistry 19 , 5747±5755.
36. Schmid, T.M. & Conrad, H.E. (1982) A unique low molecular
weight collagen s ecre ted by cultured chick e mbryo chondrocytes.
J. Biol. Chem. 257, 12444±12450.
37. Kielty, C.M., Kwan, A.P.L., Holmes, D.F., Schor, S.L. & Glant,
M.E. (1985) Type X collagen, a product of hypertrophic chon-
drocytes. Biochem. J. 27, 5 45±554.
38. Sutmuller, M., Bruijn, J.A. & de Heer, E. (1997) Collagen types
VIII and X, two non-®brillar, short-chain collagens. Structure
homologies, functions a nd involvement inpathology. Histo l. His-
topathol. 12, 557±566.
39. Khan, K.M. & Drescher, D.G. (1990) Proteins of t he ge latinous
layer of the trout saccular otolithic m embran e. He ar. Res. 43,149±
158.
40. Dunkelberger, D.G., Dean, J.M. & Watabe, N . (1980) The
ultrastructure of the otolithic memb rane and oto lith in the juven ile
mummichog, Fundulus heteroclitus. J. Morphol. 163, 367±377.
41. Campana, S.E. (1999) Chemistry and composition of ®sh otoliths:
pathway, mechanisms an d applic ations. Mar. Ecol. Prog. Ser. 188,

263±297.
42. Shen, X., Belcher, A.M., Hansma, P.K., Stucky, G .D . & Mo rse,
D.E. (1997) Molecular cloning and characterization of Lustrin A,
a m atrix protein from shell a nd pearl n acre of Haliotis rufescens.
J. Biol. Chem. 272, 32472±32481.
696 E. Murayama et al.(Eur. J. Biochem. 269) Ó FEBS 2002