Báo cáo Y học: The effect of amino-acid substitutions I112P, D147E and K152N in CYP11B2 on the catalytic activities of the enzyme pdf

The effect of amino-acid substitutions I112P, D147E and K152N
in CYP11B2 on the catalytic activities of the enzyme
Stephanie Bechtel
1
, Natalya Belkina
2
and Rita Bernhardt
1
1
Universita
¨
t des Saarlandes, Saarbru
¨
cken, Germany;
2
Insitute of Biomedical Chemistry RAMS, Moscow, Russia
By replacing specific amino acids at positions 112, 147 and
152 of the human aldosterone synthase (CYP11B2) with the
corresponding residues from human, mouse or rat
11b-hydroxylase (CYP11B1), w e have been able to investi-
gate whether these residues belong to structural determi-
nants of individual enzymatic activities. When incubated
with 11-d eoxycorticostero ne ( DOC), the 11b-h ydroxylation
activity of the m utants was most effectively increased b y
combining D147E and I112P (sixfold increase). The two
substitutions displayed a n additive effect. The same tendency
can be observed when using 11-deoxycortisol as a substrate,
although the effect is less pronounced. The second step of the
CYP11B2-dependent DOC conversion, the 18-hydroxyla-
tion activity, was not as strongly increased as the
11b-hydroxylation potential. A ctivity was unaffected by

D147E, whereas the single mutant I112P displayed the most
pronounced activation (70% enhancement), thus causing
different increasing effects o n the first two enzymatic reaction
steps. A slightly enhanced aldosterone synthesis f rom DOC
could be m easured due to increased levels of the i ntermedi-
ates. However, the 18-oxidation activity of all the mutants,
except for I112S and D147E, was slightly reduced. The
strongly enhanced 18-hydroxycorticosterone and a ldoster-
one formation observed in the mutants p rovides important
information on a possible role of s uch amino-acid replace-
ments in the development of essential h ypertension.
Furthermore, the results indicate the possibility of a differ-
ential as well as independent modification of CYP11B2
reaction steps. The combination of functional data and
computer modelling of CYP11B2 suggests an indirect
involvement of r esidue 147 in the regulation of CYP11B
isoform specific substrate conversion due to its location on
the protein surface. In addition, the results indicate the
functional significance of amino-acid 112 in the putative
substrate access channel of human CYP11B2. Thus, we
present the first example of substrate re cognition a nd
conversion being attributed to the N-terminal part of human
CYP11B2.
Keywords: c ytochrome P450; 11 b-hydroxylase, aldosterone
synthase; N-terminal protein region; engineering substrate
specificity.
Cytochromes P 450 a re key enzymes in the biotransforma-
tion of drugs, xenobiotics and steroids (reviewed in [1]).
The synthesis of the most important glucocorticoid and
mineralocorticoid hormones in humans (cortisol and

aldosterone, respectively), take place in t he adrenal gland.
It has been shown that i n pig [2] and frog [3] t his synthesis
is performed by a single P450 enzym e (CYP11B1). In
contrast, bovine h as two closely relate d isoenzymes
encoded by different genes [4,5] that synthesize both
cortisol and aldosterone. In several other species, including
human [6,7], mouse [ 8] and r at [9,10], t wo distinct isofo rms
of the CYP11B subfamily, namely CYP11B1 and
CYP11B2, have been characterized, w hich are specialized
to synthesize cortisol or aldosterone. In human, the
terminal three steps in the biogenesis of aldosterone are
catalyzed by the aldosterone synthase (CYP11B2) exclu-
sively in the z ona glomerulosa [11]. The 11b-and
18-hydroxylation of the substrate 11-deoxycorticosterone
(DOC) leads to corticosterone (B) and 18-hydroxycorticos-
terone (18-OH-B), whose 18-oxidation yields aldosterone.
In the zona fasciculata/reticularis, the 11b-hydroxylase
(CYP11B1) catalyzes the 11b-hydroxylation of 11-deoxy-
cortisol to produce cortisol which is normally secreted
100- to 1 000-fold in excess over a ldosterone [12]. C YP11B1
is also able to produce corticosterone from 11-deoxycorti-
costerone but it cannot convert c orticosterone i nto
aldosterone [7,13]. The translated proteins of t he two
human i soenzymes o f C YP11B contain 503 amino acids,
including a 24-residue N-terminal mitochondrial targeting
sequence, and s hare 93% sequence i dentity [6]. There are
only 32 a mino-acid differences in the mature forms of t he
two cytochrome P450 proteins. The apparent molecular
masses of the aldosterone synthase and 11b-hydroxylase
have been determined to be 48.5 and 50 kDa, respectively

[13]. Both enzymes are lo calized in the i nner mitochondrial
membrane and f unction alongside the flavoprotein adreno-
doxin reductase (AdR) [14], and adrenodoxin (Adx) [15].
Correspondence to R. Bernhardt, Universita
¨
t des Saarlandes, FR. 8.8
Biochemie, P O Box151150, D-66041 Saarbru
¨
cken, Germany.
Fax: + 4 9 681302 4739, Tel.: + 49 681302 4241,
E-mail:
Abbreviations: CYP11B1, c ytochrome P450
11b
,11b-hydroxylase;
CYP11B2, cytochrome P450
aldo
, aldosterone synth ase; Adx, adreno-
doxin; AdR, adrenodoxin reductase; SS, Dahl salt- sensitive rat; S R,
Dahl salt-resistant rat; SRS, substrate recognition site; DOC,
11-deoxycorticosterone; B, corticosterone; 18-OH-B, 18-hydroxy-
corticosterone; A ldo, aldosterone; HPTLC, high p erformance thin
layer chromatography; D M EM, Dulbecc o’s m o dified E a gle’s med ium.
Enzymes:steroid11b-hydroxylase and aldosterone synthase
(EC 1.14.15.4); adrenodoxin re ductase ( EC 1.1 8.1.2).
Note: a website is available at h ttp://www.uni-saarland.de/fak8/
bernhardt/
(Received 2 9 August 2001 , revised 30 November 2001, a ccepted 7
December 2001)
Eur. J. Biochem. 269, 1118–1127 (2002) Ó FEBS 2002
Lifton et al. [ 16] described a patient carrying a chimeric

gene consisting of a 5 ¢-CYP11B1 r egulatory s equence fused
to a 3¢-CYP11B2 portion, causing glucocortico id-remedi-
able aldosteronism. The encoded chimeric p rotein, w hich is
a result of an unequal meiotic cross-over upstream of
intron 5, possessed efficient aldosterone synthase activity.
Previous studies have primarily concentrated on the
C-terminal amino a cids, emphasizing t heir importance f or
the individual a ctivities of CYP11B1 a nd CYP11B2. For
instance, by s ubstituting the positions 301, 30 2 a nd 32 0 i n
CYP11B2 by CYP11B1-specific residues, a switch in the
regio- and stereospecificity of the enzymatic activity can be
observed [17]. Moreover, an aldosterone synthase activity
could b e converted from CYP11B2 to the 11b-hydroxylase,
when creating a C YP11B1 double mutant c ontaining the
aldosterone synthase specific amino acids glycine and
alanine a t positions 288 and 320, respectively [18 ]. Bo
¨
ttner
et al . [ 19] have shown that the mutant A320V of CYP11B1
displays only 20% aldostero ne synthase wild-type activity
when expressed in COS-1 cells in the presence of DOC,
indicating that other amino acids, including some at the
N-terminus, contribute to efficient CYP11B1 and CYP11B2
wild-type activity. In addition, it is known from the crystal
structures of CYP101, CYP108 and CYP102 that the
N-terminal region encodes an amino-acid sequence that is
involved in substrate recognition and binding as well as
redox partner binding [20]. This finding was also supported
by results obtained with microsomal P 450 proteins.
Ridderstro

¨
m et al. [ 21] have shown t he functional i mpor-
tance of Arg97 and Arg108 in the activity of CYP2C9,
especially for substrate binding, by site-directed mutagenesis
and homology modelling.
The phenotypical abnormality of hypertension was
examined using the model system of Dahl salt-sensitive
(SS) and s alt-resistant ( SR) r ats demonstrating the essential
role of exons 3 and 4 of aldosteron e synthase [22], w hich
also implicates t he significance o f the N-terminal region of
CYP11B2 in e nzymatic activity. These studies prompted us
to perform protein sequence- and structure-based align-
ments of human CYP11B f amily members with mouse a nd
rat CYP11B1 and CYP11B2, human CYP2C9 and P450s
with known three-dimensional s tructures. We concentrated
our efforts on the N-terminal amino acids, which differ
between the human CYP11B1 and CYP11B2 enzyme, and
are c and idate residues for influencing the enzymatic activity
of human aldosterone synthase. As the two helices, B and C,
of the structurally known c ytochromes P450 located in the
N-terminal pro tein regions play an essential role i n the high
substrate s electivity and redox partner interaction [23,24],
we investigated whether t he amino acids of human
CYP11B2 located in regions aligned with these helices are
of functional importance. They were replaced by the
corresponding amino a cids of hum an, mouse a nd rat
CYP11B1 u sing site-directed mutagen esis and t he mutants
were characterized with respect to their hydroxylation
selectivity.
MATERIALS AND METHODS

Materials
Expression vector pSVL was purchased from Pharmacia
Biotech Inc. Oligonucleotides were synthesized on an
Applied Biosystems model 380A DNA synthesizer at
BioTez (Berlin). COS-1 cells were obtained from the
American Type Culture Collection. Cell culture media,
pyruvate, glutamine, antibiotics and Hepes were from
Sigma. Fetal bovine serum and DEAE-dextran were
obtained from GibcoBRL and Pharmacia Biotech Inc.,
respectively. Chloroquine, Hank’s balanced salt solution,
dimethylsulfoxide, 11-deoxycorticosterone, corticosterone,
18-hydroxycorticosterone, aldosterone, 11-deoxycortisol,
cortisol, 4-chlor-1-naphthol and secondary horseradish
conjugated anti-(rabbit IgG) Ig were all from Sigma.
[
14
C]11-deoxycorticosterone and [
3
H]11-deoxycortisol were
purchased from DuPont NEN. HPTLC plates silica ge l 60
F
254
and s olvents w ere f rom M erck. The BCA a ssay kit for
quantitation of total protein was purchased from Pierce.
Site-directed mutagenesis and expression vectors
Mutations were inserted into human C YP11B2 cDNA by
site-directed mutagenesis u sing th e Q uick Change Kit from
Stratagene Ltd (Cambridge, UK), according to m anufac-
turer’s instructions and using mutagenic p rimers listed in
Table 1 . The cell culture expression construct pSVL/

CYP11B2 w as used as a t emplate. This construct contains
the cDNA encoding human aldosterone synthase. The
sequence corresponds to that published by Kawamoto et al.
[7] with one variation at position 249, where we found Ser
instead of Arg, as described by Mornet et al.[6].All
exchanges w ere c onfirmed by automatic sequencing using a
LiCor-4000 DNA sequencer (MWG Biotech, Ebersberg,
Germany), thus excluding undesired mutations.
To express t he human 11b-hydroxylase enzyme, we u sed
the cDNA sequence corresponding to that described by
Mornet et al. [6], except for three modifications. These
modifications led to the following variations in the encoded
protein: Leu at position 5 2 is r eplaced by Me t, Ile 78 i s
replaced by Val, and at position 494 we found Phe instead of
Cys, as published by Kawamoto et al. [ 25]. The c DNA was
cloned into the mammalian cell expression vector pSVL. All
standard procedures were carried out as described by
Sambrook et al .[26].
Cell culture
COS-1 cells were grown at 37 °Cand6%CO
2
in
Dulbecco’s modified E agle’s medium (DMEM) supple-
mented with 5% fetal bovine serum, 0.1 mgÆmL
)1
strepto-
mycin, 100 UÆmL
)1
penicillin, 1 m
M

pyruvate and 4 m
M
L
-glutamine.
Table 1. Sequences of forward oligonucleotides e mployed fo r t he
mutagenesis of the human aldosterone synthase and the corresponding
amino-acid exchanges. Nucleotides represented in bold characters
indicate mismatched bases in CYP11B2. Codons for the changed
amino acids ar e underlined.
Mutation Oligonucleotide sequences
I112S CCTGCAGGATG
CCCCTGGAG
I112P CCTGCAGGATG
AGCCTGGAG
D147E GCTGAACCCA
GAAGTGCTGTCGCCC
D147E/K152N ACCCA
GAAGTGCTGTCGCCCAACGCCG
TGC
Ó FEBS 2002 Effect of I112P, D147E, K152N on CYP11B2 activity (Eur. J. Biochem. 269) 1119
Transient transfections and enzymatic assays
Transfections were performed using the DEAE-dextran
method as described previously [27], modified a s f ollows:
COS-1 cells we re plated at a density of 6 · 10
5
cells per 6-cm
dish and grown overnight. Next day, the medium was
aspirated and the cells were subjected to starvation by
incubating in 2 mL fetal bo vine serum-free medium
containing Hepes to a final c oncentration of 5 0 m

M
. The
incubation time was fi xed to 2 h. After removing the
medium, the C OS-1 cells were cotransfected with 5 lgof
CYP11B2 or CYP11B1 expression plasmid and 3 lgof
pBAdx4 (a generous gift from M. Waterman, D epartment
of Biochemistry, V anderbilt University School of Medicine,
Nashville, USA) mixed with 1 mL s tarvation Medium
supplemented with 250 lg DEAE-dextran. After 1 h, 2 mL
of complete medium containing chloroquine to a final
concentration o f 100 l
M
were added, and t he incubation of
the cells was continued for 2 h . For the subsequent
dimethylsulfoxide treatment, the medium was replaced by
2 m L o f H ank’s balanced salt s olution supplemented with
10% dimethylsulfoxide for exactly 2 min. Afterwards, the
cells were washed twice with Hank’s balanced salt solution
and cultured with 3 mL of complete medium. To assay f or
CYP11B1- and CYP11B2-dependent activities, the cells
were incubated 24 h after transfection with 2 mL complete
medium containing either 30 l
M
DOC and 6 nCi
14
C-labelled DOC or 30 l
M
11-deoxycortisol a nd 0.6 lCi
3
H-labelled 11-deoxycortisol. Following a 48-h incubation

period, steroids were extracted twice from the c ell culture
supernatant with m ethylene c hloride a nd the organic phase
was dried. The residues were d issolved in 10 lL methanol
and spotted onto glass-baked silica-coated high perfor-
mance thin layer chromatography (HPTLC) plates. The
HPTLC plates were developed twice in methylene chloride/
methanol/water (300 : 20 : 1, v/v/v). The reacti on products
were identifie d by comigration o f unlabeled steroid refer-
ences an d quantified after 2 days exposure on a bioimaging
analyser (BAS-2500, Fuji P hoto Film Co., Ltd). After
substrate incubation, the transfected COS-1 cells were lysed,
as described p reviously [19], a nd subjected to immunolog-
ical d etection of cytochro me P 450 expression a ccording to
standard procedures [26,28] using an anti-(human CYP11B)
serum (a kind gift from H. Takemori, Department of
Physiological Chemistry, O saka University Medical School
Osaka, Japan). The total amounts of protein were quanti-
fied using a BCA assay kit, according to t he manufacturer’s
protocol.
Alignment of P450 sequences and protein modelling
Multiple s equence a lignment was carried out usin g
CLUSTALW
1.8 [29]. The secondary structure p redictions
were produced by the network method using
PHDSEC
[30].
The modelling o f t he thre e-dimensional structure of
CYP11B1 was carried out by homology modelling with
bacterial c ytochromes w ith known three-dimensional s truc-
ture from the Protein Data Bank [31], using the

SYBYL
6.6
subroutine
COMPOSER
(Tripos Inc., St Louis, MO, USA).
The standard procedure of p rotein modelling using
COMPOSER
includes the following steps: (a) determination
of an initial set of topologically equivalent r esidues by using
the multiple s equence alignment method, which is then used
to produce an optimal structural alignment of the cyto-
chromes P450 with known stru cture; (b) determination of
structurally conserved regions (SCRs) of the p roteins b ased
on this structural alignment; (c) building o f the backbone of
each SCR in the model by fitting a most appropriate
fragment from one of the cytochromes P 450 with known
three-dimensional structure and determination of the side-
chain conformations based on information about the
backbone secondary structure and the s ide chains o f the
corresponding residues i n e ach o f t he protein templates; ( d)
searching f or protein loops i n o rder to design the backbone
conformations of t he structurally variable regions (SVRs)
with visual inspection to avoid poor steric interaction w ith
surrounding parts of the protein model.
The models of the three-dimensional structure of
CYP11B2 and the mutants were made by using p oint
mutations and protein loop search for regions which are
different for CYP11B1 and CYP11B2 by means of the
SYBYL
programme suite, as described previously [32].

Energy m inimizatio n was perfo rmed for t he structures of
the models in the presence o f water; t he Tripos Force Field
was used. The optimum was r eached when the energy
gradient was lower than 0.05 kcalÆmol
)1
ÆA
˚
)1
. However, n o
more than 500 minimization steps were u sed. The Powell
Conjugate Gradient method was u sed for energy minimi-
zation in both cases. V erification of the obtained models
was c arried out using
PROCHECK
[33] and
PROSA
[34] and all
the models showed appropriate quality.
RESULTS
Alignment of human, mouse and rat CYP11B1
and CYP11B2 with crystallized cytochromes P450
and human microsomal CYP2C9
Although the sequence identities between the multitude of
P450 enzymes, identified t o date, are frequently less t han
20%, there is a Ôstructural coreÕ common to all P450s [23],
indicating high conservation of secondary structu re. Based
on this fact, we performed amino-acid sequence and
structure alignments o f human 1 1b-hydroxylase and aldo-
sterone synthase with structurally known P450s and the
human CYP2C9 ( Fig. 1). W e focused on the distribution o f

32 amino a cids that d iffer in the mature forms of CYP11B1
and C YP11B2, in order to i dentify candidates residues for
determining the efficient c atalytic functions of the two
enzymes. We discovered that residue 112 is located in a
region aligned with t he substrate recognition s ite (SRS) 1 of
CYP2 family members [35] and the B helix of the c rystal-
lized P450s (Fig. 1). As the helices A, B, B¢,FandGofthe
crystallized P450 proteins may contribute to the high
substrate specificity to cytochrome P450 [23], an d as the
conversion of a multitude of compounds might be due to
the high variability i n the SRS o f th e family 2 P 450s [35],
amino acid 112 of CYP11B1 a nd CYP11B2 may therefore
be involved in specific substrate recognition of human 11b-
hydroxylase and aldosterone synthase. Residues 147 and
152 are encoded by exon 3 . Its functional relevance was
demonstrated by the use of the model system of Dahl SS
and SR rats [ 22] encoding the amino-acid substitution
E136D. The double mutant E136D/Q251R in Dahl SR rats
resulted in a 1000-fold enhanced enzymatic a ctivity i n D ahl
SR rats. Furthermore, amino acids 147 and 152 are placed
1120 S. Bechtel et al. (Eur. J. Biochem. 269) Ó FEBS 2002
Fig. 1. M ultiple s equence alignment be tween s everal cy tochromes P 450. Th e a lignment w as do ne us ing
CLUSTALW
1.8 ( 31). The regions corre-
sponding to he lices and the heme-binding area of the structurally known P 450s are indicated and examplified by the underlines in the CYP101
sequence. T he shaded po sitions in t he human CYP11B sequences re present the residues selected for investigation, whereas t he shaded p art in t he
CYP2C9 sequence ind icates its put ative SRS1, belonging t o the substrate r ecognition sites i n CYP2 family m embers identified b y Gotoh ( 37) .
Ó FEBS 2002 Effect of I112P, D147E, K152N on CYP11B2 activity (Eur. J. Biochem. 269) 1121
in an area aligned with the C helix of the so far crystallized
P450 enzymes ( Fig. 1). These amino acids could p lay a n

important functional role, especially with regard to the
interaction w ith Adx, i n a ccordance with the observation
that the helices B, C, J, J ¢, K, L of several known b acterial
P450s seem to be involved in redox partner binding [24].
Site-directed mutagenesis and expression
of CYP11B2 mutants
Three single mutants, two double mutants and one triple
mutant of CYP11B2 were created by site-directed muta-
genesis u sing the oligonucleotides listed i n Table 1, in
addition to th e complementary oligonucleo tides. Thus, the
human aldosterone synthase wild-type amino acids were
replaced with the corresponding residues of human, mouse
and rat CYP11B1, respectively, as summarized in Table 2 .
The successful insertion of the intended mutations was
verified by sequence analysis.
By performing three independent transfection experi-
ments, we found no substantial deviations in expression
levels b etween the wild-type and mutant proteins. This result
suggests t hat the amino-acid exchanges had no influence o n
protein stability o r expression le vel (data not shown).
Enzymatic activity of aldosterone synthase mutants
To analyse the enz ymatic specificities of the CYP11B2
mutants, as compared to the wild-type proteins, we
contransfected the resultant plasmids together with pBAdx4
into COS-1 cells. The coexpression of bovine adrenodoxin
has been demonstrated to be a u seful approach to increase
the activity of the human s teroidogenic enzymes, as well as
the sensitivity of the t est system [ 17,36–38]. To estimate the
aldosterone-producing or cortisol-synthesizing potential,
the cells were incubated with either DOC or 11-deoxycor-

tisol, respectively. Different concentrations of DOC o r
11-deoxycortisol (ranging from 10 to 80 l
M
) a nd differen t
incubation times were used to optimize the incubation
conditions; the optimal conditions were found to be 30 l
M
DOC o r 3 0 l
M
11-deoxycortisol and 48 h incubation.
Under the conditions tested, c omparable relative activities
between the respective c onstructs were detected without
affecting the viability of C OS-1 cells during s ubstrate
incubation (data not shown). Using the optimized con di-
tions, t he different mutants and the wild-type enzymes were
characterized with respect to all three catalytic activities
11b-hydroxylation, 18-hydroxylation and 18-oxidation.
The mutated CYP11B2 enzymes were analysed by
incubating them with DOC as substrate (Fig. 2). No
significant alteration in substrate conversion was detectable
for mutant I112S, as compared to CYP11B2 wild-type,
indicating that this amino-acid exchange had n o effec t on
the enzymatic activity. The same observation was made f or
the single mutant K152N (M. Hampf, Max-Delbru
¨
ck-
Centre, B erlin, G ermany, p ersonal c ommunication). I n
contrast, a ll other mutants induced markedly different
steroid profiles relative to the wild-type of CYP11B2, as
shown in Fig. 2. It is obvious that more intermediates (B

and 18-OH-B) were produced from DOC due to a
substantial increase in the activities of the mutants. How-
ever, the three enzymatic steps were affected to diffe rent
extents, represented b y the relative activities as shown in
Fig. 2B. As e vident from the comparison of the 11b-
hydroxylation activities of all constructs (Fig. 2B), the
introduction of Pro a t position 112 enhanced the activity of
the first enzymatic reaction s tep more than three fold,
Table 2. Corresponding amino ac ids of human CYP11 B2 and
CYP11B1 as well as m ouse and rat CYP11B1 at t he positions s elected
for mutagenesis.
Position
Human
CYP11B2
Human
CYP11B1
Mouse and
rat CYP11B1
112 I S P
147 D E N
152 K N K
Fig. 2. Enzymatic activities of aldosterone synthase and 1 1b-hydroxy-
lase. (A) Enzymatic activities of aldosterone synthase and 11b-
hydroxylase w ild-type enzymes and different CYP11B2 site-directed
mutants expressed in COS-1 cells towards 11-deoxycorticosterone
(30 l
M
DOC a nd 6 nCi of [
14
C]DOC). Mock rep resen ts the tran sfec-

tion with the empty vector pSVL. Steroid patterns o f DOC conversion
are given as means ± SEM o f four similar independent experiments
performed in duplicate. T he am ounts of t he su bstrate, t he i ntermedi-
ates corticosterone (‘B’) and 18-hydroxycorticosterone (18-OH-B) and
the final product aldosterone (Aldo) are presented as percentages of
total activity. (B ) R elative a ldostero ne syn thase act ivities. T he effects
of the aldosterone synthase mu tants on the 11b-hydroxylation (ratio of
RB + 18-OH-B + A ldo/DOC), 18-hydroxylation [ ratio of R18-OH-
B plus Aldo)/B] and 18-oxidation (ratio of Aldo/18-OH-B) activity of
CYP11B2 are presented. The a ctivities are shown as means ± SEM
(n ¼ 8).
1122 S. Bechtel et al. (Eur. J. Biochem. 269) Ó FEBS 2002
whereas a fourfold increase was observed f or the D147E
mutant, representing the strongest effect on the 11b-
hydroxylation a ctivity o f all single mutants investigated
here. When both mutations were introduced into CYP11B2,
the 11b-hydroxylation c apacity was additionally activa ted,
obtaining a s ixfold enhancement i n relation to the wild-typ e
enzyme (Fig. 2B). I n c ontrast, t he introduction of another
amino-acid exchange (I112P/D147E/K152N) led to a 26%
reduction in 11b-hydroxylation activity, as compared to th e
double mutant I112P/D147E, which demonstrated slightly
increased a ctivity o f the first enzymatic reaction s tep, as did
the single mutant D147E (Fig. 2B). The same observation
was made for mutant D147E/K152N (exhibiting a 20%
reduction), as compared to t he single mutant D147E. The
11b-hydroxylation activity of the double replacement mu-
tant, D147E/K152N, equalled almost t hat of mutant I112P.
Obviously, K 152N in combination with the mutations
D147E and I112P/D147E minimized the activating c harac-

ter of the corresponding mutants (Fig. 2 B). The second
catalytic step performed by human C YP11B2 was not as
strongly enhanced as the fi rst enzymatic modification i n all
mutants studied (Fig. 2 B). The construct containing the
I112P substitution could be clearly identified as the single
mutant displaying the strongest activation of the 18-
hydroxylation; 1.7-fold compared to the CYP11B2 wild-
type, suggesting a critical r ole of t his residue in the second
enzymatic r eaction step o f C YP11B2 (Fig. 2B). In c ontrast,
this reaction step seems to be unaffected by the single
replacement D147E. The same observation was made f or
the double replacement mutant I112P/D147E showing 18-
hydroxylation activity c omparable to C YP11B2 wild-type
(Fig. 2 B), thus suggesting a slightly negative influ ence of
D147E on the second hydroxylation s tep when combined
with I112P.
Interestingly, insertion o f one more human CYP11B1-
specific residue at position 152 (I112P/D147E/K152N) leads
to an increase (13%) in h ydroxylation a t position 18
(Fig. 2 B), c ompared to the corresp onding double mutant
without K152N. This data indicates that K152N positively
affected the 1 8-hydroxylation potential when c ombined
with I112P and D147E. Investigation of aldosterone
synthesizing abilities demonstrated that all mutants pro-
duced slightly higher amounts of this steroid than CYP11B2
wild-type (Fig. 2A). Comparing the relative amounts o f
aldosterone and 18-OH-B formation ( Fig. 2A), it becomes
clear that 18-oxidation activity displays a s lightly d ecreased
efficiency in all investigated mutants, except f or I112S a nd
D147E, when compared to the CYP11B2 wild-type emzyme

(Fig. 2B).
In the second set of experiments, we investigated the
activity of wild-type a nd mutant proteins towards the 11b-
hydroxylase-specific substrate, 11-deoxycortisol. As seen for
DOC, we observed an overall tendency of all mutants,
except I112S, t o strongly improve the substra te conversion
in relation to the CYP11B2 wild-type p rotein (Fig. 3 ). By
replacing t he amino acids in positions 112 and 147 of
CYP11B2 with those f ound in mouse, rat and human
CYP11B1, the two single substituted proteins I 112P and
D147E were obtained. These mutants displayed i ncreases of
80% (1.8-fold) and 90% (1.9-fold) in cortisol-synthesizing
activities, r espectively, as compared to the CYP11B2 wild-
type enzyme (Fig. 3A,B). A s shown in Fig. 3A, the product
formation for the double mutant I112P/D147E w as
enhanced by more than 200%, which represents a 2.7-fold
increase on CYP11B2 wild-type activity (Fig. 3 B), when
incubated with 11-deoxycortisol. The data from the I112P/
D147E mutant indicate an additive effect of the two single
mutants. The combined substitutions at positions 147 and
152 (double mutant D147E/K152N), and 112, 1 47 and 1 52
(triple mutant I 112P/D147E/K152N) gave r ise to c ortisol-
producing activity increases of 1.6-fold and 2.5-fold,
respectively, compared t o the CYP11B2 wild-type. These
results s how that the replacement of lysine 152 by gluta-
mine did not further enhance the cortisol production of
the corresponding single or double mutant (Fig. 3B),
demonstrating that the 11b-hydroxylase activity of
CYP11B2 seems t o b e unaffecte d by an amino-acid change
at position 15 2.

DISCUSSION
In humans, certain phenotypical abnormalities, such as
essential hypertension, cardiovascular or endocrine diseases,
Fig.3.Assessmentof11b-h ydroxylase a ctivity and determination of
11b-hydroxylase capacity. (A)Assessmentof11b-hydroxylase activity
of CYP11B2 var iants e xpressed i n COS-1 cells. Cells were cotrans-
fected with the indicated wild-type proteins, mutants or the empty
vector pSVL a s a negative control (Mock) an d the c DNA o f b ovine
Adx.Datashownaremeans±SEMoffourseparatetransfections,
each done in duplicate. (B) Determination of 11b-hydroxylase capacity
of CYP11B2 mutants in relation to the wild-type enzyme, when
incubated with 11-deoxycortisol. The 11b-hydroxylation of
11-deoxycortisol catalysed by the mutated proteins is shown as
percentage of CYP11B2 wild-type ac tivity, fixed t o 100%. The values
given are means ± SEM of four separate transfections, each
performedinduplicate.
ÓFEBS 2002 Effect of I112P, D147E, K152N on CYP11B2 activity (Eur. J. Biochem. 269) 1123
are p artially caused by gen etic variations of CYP11B1 and/
or CYP11B2 [39,40]. Due to this fact, it is of great interest to
obtain a deeper insight i nto the structural features under-
lying the determination o f individual activities of these
enzymes. Several structural determinants of human 11b-
hydroxylase and aldosterone synthase have already been
elucidated in previous studies [17–19,41,42]. These stuc tures
are mainly located in the C-terminal regions of CYP11B1
and CYP11B2. So far, the role of distinct amino acids of the
N-terminal regions of human C YP11B isozymes h as n ot
been studied extensively, although it is known that the
N-terminal domains of CYP11B1 and CYP11B2 differ
more from each other than the C-terminal ones, as also seen

in CYP11B isoforms o f other mammals such as rat, hamster
or mouse ( Fig. 1). Therefore, our studies were focussed o n
the residues at positions 112, 147 and 152 due to their
location in protein regions aligned with functionally
important areas o f crystallized P450 e nzymes [20,43]
(Fig. 1 ). In this way, we intended to i dentify k ey amino-
acid residues of C YP11B2 implicated in t he regulation of
individual r eaction steps. Swapping the amino acid at
position 147 from CYP11B2 to CYP11B1, led to a s tronger
increase in the hydroxylation at the 11b-position of the
substrates than mutant I112P, with a smaller effect in case of
11-deoxycortisol compared with DOC. The results obtained
with the single substitution (D14 7E) are in contrast to those
presented b y Fisher et al. [44]. They reported no effect of
D147E on the 11b-hydroxylation o f 11-deoxycortisol. The
observed difference might be due to polymorphisms i n the
CYP11B locus, different experimental conditions or differ-
ent steroid detection methods used by either group. The
double mutant I112P/D147E e xerted the most p ronounced
enhancement o f the 11 b-hydroxylation of b oth substrates
(sixfold and 2.7-fold increases, as compared to the
CYP11B2 wild-type activity, in the case of DOC a nd
11-deoxycortisol, respectively), indicating an almost addi-
tive effect, but not a synergistic effe ct, o f t he two substi-
tutions. Th e conversi on of 11-deoxycortisol was not altered
by the replacement K152N, while the substitution slightly
influenced the enzymatic reaction steps of aldosterone
synthesis from DOC, s uggesting only minor functional
relevance of lysine 152 in human C YP11B2.
In contrast to the insertion of glutamic acid in position

147, the replacement I112P also increased the 18-hydroxy-
lation activity (1.7-fold increase c ompared t o t he CYP11B2
wild-type enzyme; Fig. 2B), in addition to significantly
enhancing the 11b-hydroxylation potential. The absolute
amount of aldosterone formation was slightly enhanced for
all mutants (Fig. 2A). However, the 18-oxidation activity
(Fig. 2 B) was either e qual to the wild-typ e (D147E only), or
even slightly decreased ( all o ther mutants). Although the
enzymatic activity remained unchanged by th e intraspecies
replacement I112S (Table 2), the esse ntial r ole o f residue
112 of human aldosterone synthase was clearly shown by
mutant I112P. This demonstrated the importance of the
correct residue at position 112 to ensure the s pecies-specific
selectivity of substrate hydroxylation. Thus, mutant I112P
produced an increased amount of 18-OH-B compared to
the w ild-type. This is in a ccordance with the observation
that rat CYP11B2, which contains proline instead of
isoleucine in position 112, produces higher levels of 18-
OH-B than human CYP11B2 [45,46]. I112 and S112 seem
to be conserved in the human enzymes to prevent the
strongly increased 18-OH-B production as seen when
proline is i nserted. The position of residue 112 in the
recently developed computer model of human C YP11B2
[32] (Fig. 4 ) suggests structural modifications in the sub-
strate access channel induced by its r eplacement. Therefore,
the observed significantly higher hydroxylation activities of
the r esulting mutants m ight be attributed to a faster a nd
easier passage of the substrate, possibly caused by a
substrate access channel enlargement (Fig. 5). Also, t he
slightly reduced oxidation activity of these constructs

suggests a facilitated intermediate dissociation from the
active site before be ing oxidized at the 18th position. Thus,
the amino-acid replacement I112P located in t he B-helix of
the C YP11B2 model (Fig. 4), might lead to a partial loss of
enzymatic specificity. This suggestion is i n agreement with
the observed contribution of helices A, B, B¢,FandGtothe
high specificity of other cytochromes P450 [47].
Our finding of an exclusive increase in the 1 1b-hydroxy-
lation capacity of CYP11B2 by the replacement D147E
indicates that residue 147 in the CYP11B isoform is
involved in spe cific s ubstrate conversion. This conclusion
agrees with earlier observations mad e by Bo
¨
ttner et al .[36]
who, while evaluating the f unctional relevance of the region
flanked by amino acids 296 and 339 in human CYP11B1,
found out that resid ues other than those investigated,
appeared to be required for efficient 11b-hydroxylation. The
position of D147 o n the protein surface of the CYP11B2
model (Fig. 4) suggests, however, that an indirect influence
exists, possibly via the m ediation of structural modifications
induced by redox partner binding o r by the interaction with
other proteins of the mitochondrial membrane, such as
CYP11A1. It was previously shown that CYP11B1 and
CYP11B2 were able to interact not only with the redox
partner but also with CYP11A1 [ 37,48]. As a consequence,
in the bovine system an enhancement of the 11b-hydroxy-
lase activity was observed, whereas the aldosterone synthe-
Fig. 4. C omputer model of the three-dimensional structure of the human
CYP11B2. Th e view is focused on the investigated amino acids and the

heme-group of the P450 enzyme which are marked. The arrow
indicates the putative substrate access channel. The p utative I-helix,
running through the molecule like a tunnel, is s hown in th e center.
1124 S. Bechtel et al. (Eur. J. Biochem. 269) Ó FEBS 2002
sizing activity was suppressed [49]. However, this effect
seems to be species-specific, as in the human system n o effect
of CYP11A1 on the product pattern has been found [37]. As
the observed effects o f mutant D147E investig ated here can
be attributed to a c onservative a mino-acid exchange, t he
side-chain size variations at position 147 seem to be
important. A similarly crucial e ffect on the e nzymatic
activity was demonstrated for mutant E198D of human
CYP11B2, leading t o a reduction in aldosterone synthase
activity [50].
Taken together, our data clearly d emonstrate for th e first
time the functional relevance of N-terminal amino acids in
human CYP11B2 for substrate recognition. In addition,
they provide evidence t hat amino acids that a re placed
outside the a ctive center ( Fig. 4) are essential for efficient
catalytic activity of human aldosterone synthase. Our
observations are supported by data obtained with other
cytochrome P450 family members. Amino-acid 4 of Gunn
rat CYP2C11 has been shown t o play a n important role in
testosterone hydroxylation, possibly in modulating sub-
strate channel conformation [51], whereas Arg112 of
CYP101, located on the protein surface, is essential for
electron transfer from putidaredoxin to this cytochrome
P450 enzyme [52].
However, i t becomes a pparent by our data that in
contrast to studies on Dahl SR rats [22], the examined

amino-acid replacements between the two human CYP11B
isoenzymes in exon 3 exerted a more modulating effect than
a dramatically in creasing effect on the enzymatic activity.
Nevertheless, it is conceivable that pathological abnormal-
ities observed in p atients with essential hypertension could
be caused by simil ar mutations as the analysed ones, due to
their strongly increase d 18-OH-B and i ncreased aldosterone
formation. Our hypothesis is in a ccordance with the report
of Fardella et al. [53], suggesting e ssential hypertension for
the mutant K251R of CY P11B2. This mutation caused a
400% and 50–80% enhancement in the formation of
18-OH-B and aldosterone, respectively.
In conclusion, the studies presented here are the first
example o f conferring CYP11B1 specific cortisol-producing
function to the aldosterone synthase, t hereby simultan-
eously increasing the CYP11B2 specific catalytic activity.
Furthermore, we were able to demonstrate that the three
enzymatic reaction steps of aldosterone synthesis could not
only be modified independently, as evident with mutant
D147E (where only the first reaction step was increased),
but also differentially, as seen by mutant I112P ( where the
three hydroxylation steps were affected to a different
amount). This indicates t he possibility of dissecting the
single reactions in aldosterone synthase activity by mutating
defined positions in the primary structure, supporting the
idea of divergent s tructural determinants of each reaction
step.
ACKNOWLEDGEMENTS
This w ork was supported by a Grant fro m the Deutsche Forschungs-
gemeinschaft t o R. B., Be 1343/2-6, a nd a visitor Grant from the

Deutsche Forschu ngsgemeinschaft to N. B. We thank Michael Lisurek
for assistance with computer modelling and Katharina Bo mpais for
expert DNA sequenc ing. We also express our gratitude to Achim Heinz
for h elpful discussion.
REFERENCES
1. Bernhardt, R. (1996) Cytoc hrome P450 structure, function, and
generation of reactive oxygen species. Rev. Physiol. Biochem.
Pharmacol. 127, 137–221.
2. Yanagibashi, K., Haniu, M., Shively, J.E., Shen, W.H. & Hall, P.
(1986) The synthesis of aldosterone b y the adrenal c ortex. Two
zones (fasciculata and glomerulosa) possess one enzyme for 11
beta-, 18-hydroxylation, and aldehyde synthesis. J. Bi ol. Chem.
261, 3 556–3562.
3. Nonaka, Y ., Takemori, H., Halder, S.K., Sun, T., Ohta, M.,
Hatano, O., Takakusu, A. & Okamoto, M. (1995) Frog
cytochrome P-450 (11 beta, aldo), a single enzyme involved in the
final steps of glucocorticoid and mineralocorticoid biosynthesis.
Eur. J. Bio c hem. 229, 2 49–256.
4. Morohashi, K., Yoshioka, H., G othoh, O., Okada, Y., Yamam-
oto, K., Miyata, T., Sogawa, K., Fujii-Kuriyama, Y. & Omura, T.
(1987) Molecular c lo ning and nucleotide s eq uence of DNA of
Fig. 5. P utative structures of the s ubstrate access c hannel of human
CYP11B2 wild-type enzyme ( A) an d t he two mutants I112S (B) and
I112P (C). The heme-groups and the analysed amino acids in position
112 are displayed i n capped sticks.
Ó FEBS 2002 Effect of I112P, D147E, K152N on CYP11B2 activity (Eur. J. Biochem. 269) 1125
mitochondrial cytochrome P-450 (11 beta) of bovine adrenal
cortex. J. Biochem. 102, 559– 568.
5. Mitani, F., Shimizu, T., Ueno, R., Ishimura, Y., Izumi, S.,
Komatsu, N. & Watanabe, K. (1982) Cytochrome P-45011 beta

and P450scc in a drenal cortex: z onal distribution an d intrami-
tochondrial localization by the horseradish peroxidase-labeled
antibody m ethod. J. Histochem. Cytochem. 30, 1066–1074.
6. Mornet, E., Dupont, J ., Vitek, A. & White, P.C. (1989) Charac-
terization of two g enes encod ing hu man steroid 11 b eta-h ydrox-
ylase ( P-450
11b
). J. Biol. C hem. 264, 2 0961–20967.
7. Kawamoto, T., Mitsuuchi, Y., O hnishi, T., Ichikawa, Y.,
Yokoyama, Y., Sumimoto , H., Toda, K., Miyahara, K.,
Kuribayashi, I. & Nakao, K., et al. (1990) Cloning and expression
of a cDNA for human cytochrome P-450
aldo
as related t o p rimary
aldosteronism. Bioc hem. Biop hys. Res. Commun. 173, 309– 316.
8. Domalik, L.J., Chaplin, D.D., Kirkman, M.S., W u, R.C., Liu, W.,
Howard, T .A., Seldin, M .F. & Parker, K.L. (1991) Different iso-
zymes of m o use 11 beta-hydroxylase produce m ineralocorticoids
and glucocorticoids. Mol. Endocrinol. 5 , 1853–1861.
9. Nonaka, Y., Ma tsukawa, N., Morohashi, K., O mura, T .,
Ogihara, T., Teraoka, H. & Okamoto, M. (1989) Molecular
cloning a nd sequence an alysis of cDNA encoding rat adrenal
cytochrome P-450
11b
. FE BS Lett. 25 5 , 21–26.
10. Mukai,K.,Imai,M.,Shimada,H.&Ishimara,Y.(1993)Isolation
and charact erizatio n of r at CYP1 1B ge nes in volve d in l ate s teps
of mineralo- a nd glucocorticoid syntheses. J. Biol. Chem. 26 8,
9130–9137.
11. Mitani, F. (1979) Cytochrome P450 i n a drenocortical mitochon-

dria. Molec. Cell. B iochem. 24, 21–43.
12. Pascoe, L., Curnow, K.M., Slutsker, L., Connell, J.M.C., Speiser,
P.W., New, M.I. & White, P.C. (1992) Glucocorticoid-suppress-
ible hyperaldosteronism results from hybrid genes created by
unequal crossovers betwee n CYP11B1 and CY P11B2. Proc. Natl
Acad. Sci. USA 89 , 8327–8331.
13. Ogishima, T., Shibata, H., Mitani, F., Suzuki, H., S aruta, T. &
Ishimura, Y. (1991) Aldosterone synthase cytochrome P-450
expressed in the adrenals of patients with p rimary aldosteronism.
J. Biol. Chem. 26 6, 10731–10734.
14. Sagara, Y., Takata, Y., Miyata, T., Hara, T. & Horiuchi, T. (1987)
Cloning and sequence analysis of adrenodoxin reductase cDNA
from bovine adrenal cortex. J. Biochem. (Tokyo) 102, 1333–1336.
15. Grinberg, A.V., Hannemann, F., Schiffler, B., Mu
¨
ller, J.,
Heinemann, U. & B ernhard t, R. (2000) Adrenodoxin: s tructure,
stability, an d electron t ransfer properties. Proteins 40 , 590–612.
16. Lifton, R.P., Dluhy, R.G. & Powers, M. (1992) Chimaeric 11 beta-
hydroxylase/aldosterone s ynthase gene c auses glucocorticoid-
remediable aldosteronism and human hypertension. Nature 355,
262–265.
17. Bo
¨
ttner, B., Schrauber, H. & Bernhardt, R . (1996) Engineering a
mineralocorticoid- to a g lucoco rticoid-synthesizing cyto chro me
P450. J . Biol. Chem. 271, 8028–8033.
18. Curnow, K.M., Mulatero, P., Emeric-Blanchouin, N., Aupetit-
Faisant, B., Corvol, P. & Pascoe, L. (1997) The amino acid
substitutions Ser288Gly and Val320Ala convert the cortisol

producing enzyme, CYP11B1, into an aldosterone producing
enzyme. Nat. Struct. Biol. 4, 32–35.
19. Bo
¨
ttner, B. & Bernhardt, R. (1996) Changed ratios of glucocor-
ticoids/mineralocorticoids caused by point mutations in the
putative I-helix regions of CYP11B1 and CYP11B2. Endocr. Res.
22, 4 55–461.
20. Graham-Lorence, S .E. & Peterson, J.A. (199 6) Structural align-
ments of P450s and e xtrapolatio ns t o t he unknown. Methods
Enzymol. 27 2, 315–325.
21. Ridderstro
¨
m, M., Masimirembwa, C., Trump-Kallmeyer, S.,
Ahlefelt, M., Otter, C. & Andersson, T.B. (2000) Arginines 97 and
108 in CYP2C9 are important determinants of the catalytic
function. Bio chem. Biophys. R es. Commun. 270, 983–987.
22. Cover, C.M., Wang, J .M., St-Lezin, E., Kurtz, T.W. & Mellon,
S.H. (1995) Molecular variants in the P450c11AS gene a s d eter-
minants of aldosterone synthase activity in the Dahl rat model of
hypertension. J. Biol. Chem. 270, 16555–16560.
23. Peterson, J.A. & Graham, S.E. ( 1998) A close family resemblance:
the importance of structure in understanding cytochromes P450.
Structure 6 , 1079–1085.
24. Graham-Lorence, S. & Peterson, J.A. (1996) P450: structural
similar ities and functional differences. FASEB J. 10 , 206–214.
25. Kawamoto, T., Mitsuuchi. Y., Toda, K., Miyahara, K.,
Yokoyama, Y., Nakao, K., Hosoda, K., Y amamoto, Y., I mura,
H. & Shizuta, Y. (1990) Cloning of cDNA and genomic DNA for
human c ytochrome P-45011 beta. FEBS Lett. 269, 345–349.

26. Sambrook, J., Fritsch, E.F. & Maniatis, T. (1989) Molecular
Cloning: a Laboratory M anual, 2nd ed n. Cold Spring Harbor
Laboratory Press, C old Spring Harbor, New Yo rk .
27. Zuber, M .X., Mason, J.I., S impson, E.R. & Wa terman, M.R.
(1988) Simultaneous tra nsfection of COS-1 c ells with mitochon-
drial and microsomal steroid hydroxylases: incorporation of a
steroidogenic pathway into nonsteroidogenic cells. Proc. Natl
Acad. Sci. USA 85 , 699–703.
28. Laemmli, U.K. (1970) Cleavage of structural proteins during the
assembly of the head o f bacteriophage T4. Nature 227, 680–685.
29. Thompson, J.D., Higgins, D.G. & Gibson, T.J. ( 1994) CLUSTAL
W: improving the sensitivity of progressive multiple sequence
alignment through sequence weighting, position-specific gap pen-
alties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680.
30. Rost, B. & Sander, C . (1993) Prediction of protein s tructure at
better than 70% ac curacy. J. M ol. Biol. 232, 5 84–599.
31. Berman, H.M., Westbrook, J., Feng, Z., Gilliland, G., Bhat, T.N.,
Weissig, H., Shindyalov, I.N. & Bourne, P.E. (2000) The protei n
data bank. N uc leic Acids Re s. 28, 235–242.
32. Belkina, N.V., Lisurek, M., Ivanov, A.S. & B ernhardt, R. (2001)
Modelling of 3D-structures of cytochromes P450 11B1 and 11B2.
J. Inorg. Biochem. 87, 197–207.
33. Laskowski, R.A., M acArthu r, M .W ., Moss, D.S. & Thornton,
J.M. (1993) PROCHECK: a program to check the stereochemical
quality of p rotein structures. J. Appl. Cryst. 26, 283–291.
34. Sippl, M.J. (1993) Recognition of errors in three-dimensional
structures of proteins. Proteins 17, 355–362.
35. Gotoh, O. (1992) Sub strate recognition sites in cytochrom e P450
family 2 (CYP2) proteins inferred from comparative analyses of
amino a cid and co ding nucleotide sequences. J. Biol. C hem. 267,

83–90.
36. Bo
¨
ttner, B., D enner, K. & Bernhardt, R. (1998) Co nfer-
ring aldosterone synthesis to human CYP11B 1 by replacing key
amino acid residues with CYP11B2-specific ones. Eur. J. Bioc hem.
252, 458–466.
37. Cao, P R. & Bernhardt, R. (1999) Interaction of CYP11B1
(cytochrome P -450
11b
) with C YP11A1 (cy tochrome P -450
scc
)in
COS-1 c ells. Eur. J. Biochem. 262, 720–726.
38. Cao, P R. & Bernhardt, R. (1999) Modulation of aldosterone
biosynthesis by adrenodoxin mutants with different electron
transport efficiencies. Eur. J. Biochem. 265 , 152–159.
39. White, P.C., Curnow, K.M. & Pascoe, L . (1994) Disorders of
steroid 11b-hydroxylase isozymes. Endocr. R ev. 15, 421–438.
40. Peter, M., Dubuis, J M. & Sippell, W.G. (1999) Disorde rs of the
aldosterone synthase and steroid 11b-hydroxylase deficiencies.
Horm. Res. 41 , 211–222.
41. White,P.C.,Dupont,J.,New,M.I.,Leiberman,E.,Hochberg,Z.
& Rosler, A. (1991) A mutation in CYP11B1 (Arg448 fi His)
associated with steroid 11b-hydroxylase deficiency in Jews of
Moroccan or igin. J. Clin. Invest. 87, 1664–1667.
42. Geley;, S., Jo
¨
hrer, K., Peter, M., Denner, K., Bernhardt, R.,
Sippell, W.G. & Kofler, R. (1995) Amino acid substitution R384P

in aldosterone synthase causes corticosterone methyloxidase type I
deficiency. J. Clin. Endocrinol. M etab. 80, 424–429.
1126 S. Bechtel et al. (Eur. J. Biochem. 269) Ó FEBS 2002
43. Hasemann, C.A., Kurumbail, R.G., Boddupalli, S.S., Peterson,
J.A. & Deisenhofer, J. (1995) Structure and function of
cytochromes P450: a comparative analysis of three crystal struc-
tures. St ructure 3, 41–62.
44. Fisher, A., Fraser, R., Mc-Connell, J. & Davies, E. (2000) Amino
acid residue 147 of human aldosterone synthase and 11beta-
hydroxylase plays a key role in 11beta-hydroxylation. J. Clin.
Endocrinol. Metab. 85, 1 261–1266.
45. Nonaka, Y., Fujii, T., Kagawa, N., Waterman, M .R., Takemori,
H. & Okamoto, M. (1998) Structure/function relationship of
CYP11B1 associated with Dahl’s salt-resistant rats – expression of
rat CYP11B1 and CYP11B2 in Escherichia c oli. Eur. J. Bioche m.
258, 8 69–878.
46. Nonaka, Y., Fujii, T., Bernhardt, R. & O kamoto, M. (1998)
Amino acid r esidues in I- a nd K-helices of r at CYP11B1 and
CYP11B2 a re important in expression o f 18-hydroxylation a ctiv-
ity. Endocr. R es. 24, 6 15–618.
47. Graham, S.E. & Peterson, J.A. (1999) How similar are P450s and
what c an t heir differences teach u s? Arch. Biochem. B iophys. 369 ,
24–29.
48. Schwarz, D ., Chernogolov, A. & K isselev, P. (1999) Complex
formation in vesicle-reconstituted mitoch ondrial cytochrome P450
systems ( CYP11A1 and C YP11B1) as evidenced by r otational
diffusion experiments using EPR and ST-EPR. Biochemistry 38,
9456–9464.
49. Ikushiro, S., Kominami, S. & Takemori, S. ( 1992) Adrenal
P-450scc modulates activity of P-45 011 beta in liposomal a nd

mitochondrial m embranes. I mplication of P-450scc in zone
specificity of aldosterone biosynthesis in bovine adrenal. J. Biol .
Chem. 26 7, 1464–1469.
50. Portrat-Doyen, S., Tourniaire, J., Richard, O., Mulatero, P.,
Aupetit-Faisant, B., Curnow, K.M., Pascoe, L. & Morel, Y.
(1998) Isolated aldosterone synth ase deficien cy caused by simul-
taneous E198D and V386A mutations in the CYP11B2 gene.
J. Cli n. Endocrinol. Metab. 83, 4156–4161.
51. Biagini, C.P., Philpot, R.M. & Celier, C.M. (1999) Nonsubstrate
recognition site r esidues are involved in testosterone hydroxylation
by cytochrome P450 CYP 2C11. Arch. Biochem. Biophys. 361,
309–314.
52. Koga, H., S agara, Y., Yaoi, T., T sujimura, M., Nakamura, K.,
Sekimizu,K.,Makino,R.,Shimada,H.,Ishimura,Y.&Yura,K.,
et al. (1993) Essential role of the Arg112 r esidue of cytochrome
P450cam for electron transfer from reduced putidaredoxin. FEBS
Lett. 33 1, 109–113.
53. Fardella, C.E., Rodriguez, H., Hum, D.W., Mellon, S.H. &
Miller, W.L. (1995) Artificial mutations in P450c11AS
(aldosterone sy nt hase) c a n in crease enzymatic activity: a model
for low-renin hyperten sio n? J. Cl in. Endocrinol. Metab. 80, 1 040–
1043.
Ó FEBS 2002 Effect of I112P, D147E, K152N on CYP11B2 activity (Eur. J. Biochem. 269) 1127