Báo cáo khoa học: Assimilation of excess ammonium into amino acids and nitrogen translocation in Arabidopsis thaliana – roles of glutamate synthases and carbamoylphosphate synthetase in leaves ppt

Assimilation of excess ammonium into amino acids and
nitrogen translocation in Arabidopsis thaliana – roles of
glutamate synthases and carbamoylphosphate synthetase
in leaves
Fabien Potel
1
, Marie-He
´
le
`
ne Valadier
1
, Sylvie Ferrario-Me
´
ry
1
, Olivier Grandjean
2
, Halima Morin
2
,
Laure Gaufichon
1
, Ste
´
phanie Boutet-Mercey
3
,Je
´
re
´

my Lothier
1
, Steven J. Rothstein
4
, Naoya Hirose
1
and Akira Suzuki
1
1 Unite
´
de Nutrition Azote
´
e des Plantes, Institut National de la Recherche Agronomique, Versailles, France
2 Plateforme de Cytologie et Imagerie Ve
´
ge
´
tale, Institut National de la Recherche Agronomique, Versailles, France
3 Plateforme Chimie du Ve
´
ge
´
tal, Institut National de la Recherche Agronomique, Versailles, France
4 Department of Molecular and Cellular Biology, College of Biological Science, University of Guelph, Ontario, Canada
Keywords
amino acid translocation; Arabidop sis thaliana;
carbamoylphosphate synthetase; glutamate
synthase; nitrogen assimilation
Correspondence
A. Suzuki, Unite

´
de Nutrition Azote
´
e des
Plantes, Institut National de la Recherche
Agronomique, Route de St-Cyr, 78026
Versailles cedex, France
Fax: +33 1 30 83 30 96
Tel: +33 1 30 83 30 87
E-mail:
(Received 27 March 2009, revised 22 May
2009, accepted 27 May 2009)
doi:10.1111/j.1742-4658.2009.07114.x
This study was aimed at investigating the physiological role of ferredoxin-
glutamate synthases (EC 1.4.1.7), NADH-glutamate synthase (EC 1.4.1.14)
and carbamoylphosphate synthetase (EC 6.3.5.5) in Arabidopsis. Pheno-
typic analysis revealed a high level of photorespiratory ammonium, gluta-
mine ⁄ glutamate and asparagine ⁄ aspartate in the GLU1 mutant lacking the
major ferredoxin-glutamate synthase, indicating that excess photorespiratory
ammonium was detoxified into amino acids for transport out of the veins.
Consistent with these results, promoter analysis and in situ hybridization
demonstrated that GLU1 and GLU2 were expressed in the mesophyll and
phloem companion cell–sieve element complex. However, these phenotypic
changes were not detected in the GLU2 mutant defective in the second
ferredoxin-glutamate synthase gene. The impairment in primary ammonium
assimilation in the GLT mutant under nonphotorespiratory high-CO
2
con-
ditions underlined the importance of NADH-glutamate synthase for amino
acid trafficking, given that this gene only accounted for 3% of total gluta-

mate synthase activity. The excess ammonium from either endogenous pho-
torespiration or the exogenous medium was shifted to arginine. The
promoter analysis and slight effects on overall arginine synthesis in the
T-DNA insertion mutant in the single carbamoylphosphate synthetase
large subunit gene indicated that carbamoylphosphate synthetase located in
the chloroplasts was not limiting for ammonium assimilation into arginine.
The data provided evidence that ferredoxin-glutamate synthases, NADH-
glutamate synthase and carbamoylphosphate synthetase play specific physi-
ological roles in ammonium assimilation in the mesophyll and phloem for
the synthesis and transport of glutamine, glutamate, arginine, and derived
amino acids.
Abbreviations
AS, asparagine synthetase; CP, carbamoylphosphate; CPSase, carbamoylphosphate synthetase (EC 6.3.5.5); Fd, ferredoxin; Fd-GOGAT,
ferredoxin-glutamate synthase (EC 1.4.1.7); Fd-NiR, ferredoxin-dependent nitrite reductase; GDC, glycine decarboxylase complex; GDH,
glutamate dehydrogenase; GOGAT, glutamate synthase; GS, glutamine synthetase (EC 6.1.1.3); NADH-GOGAT, NADH-glutamate synthase
(EC 1.4.1.14); NAGK, N-acetyl-glutamate kinase; NR, nitrate reductase.
FEBS Journal 276 (2009) 4061–4076 ª 2009 The Authors Journal compilation ª 2009 FEBS 4061
Introduction
Inorganic nitrogen in the form of nitrate and ammo-
nium in the soil is absorbed by roots across the
plasma membrane, and it is in part transported via
the xylem to leaves prior to incorporation into amino
acids in Arabidopsis [1]. Primary nitrogen reduction
from nitrate to ammonium is catalyzed by cytosolic
nitrate reductase (NR; EC 1.6.6.1), and then by plas-
tidial ferredoxin (Fd)-dependent nitrite reductase (Fd-
NiR; EC 1.6.6.4). Photorespiratory glycine oxidation
in the mesophyll mitochondria releases the bulk of
ammonium at high rates of as much as 10–20-fold
those of primary nitrate reduction in leaves [2]. Pri-

mary and photorespiratory ammonium assimilation
into amino acids could take place by four distinct
pathways in Arabidopsis, to meet the needs of protein
synthesis, the maintenance of amino acid pool levels
within the leaves, and nitrogen transport to the grow-
ing apical sinks and roots via the phloem. First, the
glutamine synthetase (GS)–glutamate synthase (GO-
GAT) cycle is the major assimilatory pathway. Gluta-
mine is generated from ammonium and glutamate by
cytosolic GS1 and plastidial GS2 (EC 6.3.1.2). Then,
GOGAT transfers the glutamine amide group to the
2-position of 2-oxoglutarate to yield two molecules of
glutamate, one of which is cycled to GS. The Arabid-
opsis nuclear genome carries multiple genes for many
of the nitrogen assimilatory enzymes, and GOGAT
exists as Fd-GOGAT (EC 1.4.7.1), encoded by GLU1
and GLU2 , and as NADH-GOGAT (EC 1.4.1.14),
encoded by GLT [3]. Second, either ammonium or a
glutamine amide group is integrated into asparagine
by cytosolic asparagine synthetase (AS) [ammonia-
ligasing AS (EC 6.3.1.1) or glutamine-hydrolyzing AS
(EC 6.3.5.4)] [4]. Third, carbamoylphosphate synthe-
tase (CPSase) forms carbamoylphosphate (CP) using
bicarbonate (HCO
À
3
), ATP and ammonium (ammonia-
ligasing CPSase; EC 6.3.4.16), or the glutamine amide
group (glutamine-hydrolyzing CPSase; EC 6.3.5.5) [5].
In Arabidopsis, a single copy each of carA and of

carB encode the small subunit and large subunit,
respectively. The small and large subunits form a
single heterodimeric enzyme that supplies CP as a
precursor for arginine and pyrimidine synthesis [6].
Finally, mitochondrial NADH-glutamate dehydro-
genase (EC 1.4.1.2) could alternatively incorporate
ammonium into glutamate in response to high levels
of ammonium under stress [7].
GOGATs are involved in the major synthetic path-
way of glutamate from primary and photorespiratory
nitrogen [8], and CPSase seems to catalyze a commit-
ted step to recover photorespiratory nitrogen in amino
acid synthesis in Arabidopsis [9]. The amino acids are
then translocated in the apoplasm and in the phloem
via the plasma membrane-located amino acid trans-
porters [10]. Glutamine and asparagine, and to a lesser
extent arginine, glutamate, and aspartate, are trans-
ported in Arabidopsis phloem sap for use in sink cell
development [11]. Therefore, we investigated whether
two Fd-GOGAT isoenzymes and NADH-GOGAT
play overlapping or distinct roles in nitrogen assimila-
tion into amino acids for transport in planta using
mutants deficient in GLU1, GLU2,orGLT. Despite
the in silico data of the Arabidopsis databases, experi-
ments on the in vivo function of CPSase remain largely
unaddressed. Inasmuch as arginine synthesis from CP
relies on the regulation of glutamate conversion to
ornithine [6], we studied the impact of CPSase on
overall arginine synthesis in the carB mutant. In fact,
amino acid synthesis is tightly correlated with amino

acid transport under the fine control of the cellular
and subcellular expression of the nitrogen assimilatory
genes and of the encoded enzymes [12]. Despite their
primary importance, the spatial location and expres-
sion patterns have not been investigated for Fd-GO-
GAT isoenzymes, NADH-GOGAT and CPSase in
Arabidopsis. Thus, we defined their subcellular localiza-
tion and cell type-specific and tissue-specific expression
patterns by promoter::GUS fusion expression in trans-
genic Arabidopsis , in situ mRNA hybridization, and
immunohistochemical localization. The results showed
that each isoenzyme of Fd-GOGAT, NADH-GOGAT
and CPSase had distinct physiological relevance in the
mesophyll and in the phloem for the biosynthesis and
transport of amino acids under photorespiratory and
nonphotorespiratory conditions.
Results
Expression of the genes for GOGATs and CPSase
In order to understand the physiological role of GO-
GATs and CPSase, we first examined the expression
pattern of the genes encoding these enzymes in leaves
and roots from 42-day-old Arabidopsis plants. A
search of the Arabidopsis genome database [13]
revealed that there are two genes for Fd-GOGAT
[GLU1 (AGI: At5g04140)] and GLU2 (At2g41220)],
and one gene for NADH-GOGAT [GLT (At5g53460)].
GLU1 and GLU2 are composed of 33 exons coding for
a protein of 165 kDa, containing a class II (purF)-type
glutaminase domain and short regions for binding to
FMN and iron sulfur center. GLT is composed of 20

Amino acid synthesis and transport in Arabidopsis F. Potel et al.
4062 FEBS Journal 276 (2009) 4061–4076 ª 2009 The Authors Journal compilation ª 2009 FEBS
exons encoding a large protein of 240 kDa. CPSase is
encoded by two genes: carA (At3g27740) and carB
(At1g29900). carA is composed of 10 exons encoding
the 40 kDa small subunit. The small subunit contains
a class I (trpG)-type glutaminase domain to hydrolyze
glutamine to ammonia. carB is composed of three
exons encoding a 120 kDa large subunit, consisting of
the duplicated synthetase regions and the ATP-binding
domains to synthesize CP. GLU1 was mainly expressed
in the leaves, at significantly higher level than GLT
and GLU2 (Fig. 1A). Although GLT and GLU2 were
expressed in the leaves and in the roots, GLT mRNAs
were at least seven-fold more abundant than GLU2
mRNAs (Fig. 1A). carA and carB were more highly
expressed in the leaves than in the roots, and both
leaves and roots contained slightly more abundant
carB mRNAs (Fig. 1B). Among the cytosolic GS1
genes, higher mRNA levels were found for Gln12,
Gln13 and Gln14 than for Gln11 in the leaves
(Fig. 1C). The highest mRNA level was also found for
Gln12 in the roots (Fig. 1C). As compared with gln12,
the chloroplastic GS2 mRNAs were more abundant
than gln12 mRNAs in the leaves and in the roots
(about two-fold and 1.5-fold, respectively) (data not
shown).
Characterization of the T-DNA mutants for
GOGATs and CPSase
With a reverse genetic screen, individual plants with

homozygous mutant alleles were identified for GLU2,
GLT and carB by PCR in combination with the prim-
ers specific for the T-DNA left and right borders. The
GLU2 mutant was truncated by a T-DNA insertion in
intron 9 (Fig. 2A). With the use of primers down-
stream of the insertion site, the GLU2 mRNA level
was approximately 10% of the wild-type level in leaves
(Fig. 2D). The GLT mutant was characterized by a
T-DNA insertion in exon 13 about 50 amino acids
upstream of the FMN-binding domain (Fig. 2B). The
GLT T-DNA mutant contained about 20% of the
wild-type level of GLT mRNA (Fig. 2D). The carB
mutant was disrupted by a T-DNA insertion in the
promoter close to 600 nucleotides upstream of the
A
C
B
Fig. 1. Transcript levels of the genes for
GOGATs, CPSase and GSs in leaves and
roots of Arabidopsis. Arabidopsis plants
were grown for 42 days by hydroponic cul-
ture using 5 m
M nitrate [37] in air supple-
mented with 3000 p.p.m. CO
2
. Transcript
levels were determined by quantitative real-
time RT-PCR. (A) GOGAT genes: GLU1,
GLU2, and GLT. (B) CPSase genes: carA
and carB. (C) GS1 genes: Gln11, Gln12,

Gln13, and Gln14. The values are expressed
as percentage ± standard error relative to
the marker EF1a gene.
F. Potel et al. Amino acid synthesis and transport in Arabidopsis
FEBS Journal 276 (2009) 4061–4076 ª 2009 The Authors Journal compilation ª 2009 FEBS 4063
initial ATG codon (Fig. 2C). The carB mutant
expressed about 10% of the wild-type level of carB
mRNA (Fig. 2D). To evaluate whether the decrease in
the GOGAT transcripts correlates with a functional
deficiency, we assayed GOGAT activities in leaves
from plants grown in air or in high CO
2
(3000 p.p.m.),
where photorespiration is repressed. The Fd-GOGAT
activity, encoded by GLU1 and GLU2, was reduced to
less than 3% in the GLU1 mutant (ethylmethanesulfo-
nate-mutagenized CS254 line) [2], whereas almost wild-
type activity was recovered in the GLU2 mutant in air
and in high CO
2
(Table 1), indicating that GLU1
encodes the major Fd-GOGAT isoenzyme. The
NADH-GOGAT activity, encoded by GLT and repre-
senting only 3% of the total GOGAT activity, was
reduced to approximately one-fourth in the GLT
mutant, whereas NADH-GOGAT activity was less
affected in the GLU1 and GLU2 mutants, irrespective
of the photorespiratory conditions (Table 1). We also
assayed GS and glutamate dehydrogenase (GDH), as
these enzyme activities are closely related to ammo-

nium assimilation. The GS activity was not affected in
the mutants, except for a slight reduction in the GLT
mutant in high CO
2
(Table 1). The GDH activity var-
ied between 75% and 135% of the wild-type activity
for glutamate synthesis and between 45% and 65% for
glutamate oxidation in the three mutants (Table 1).
Phenotypic changes in the GOGAT and CPSase
mutants
As our target was to evaluate the impact of gene func-
tion on ammonium assimilation and amino acid
1 kb
A
B
C
D
3′5′
5′
3′
5′
3′
Fig. 2. Schematic presentation of the gene structure with the
T-DNA insertion site, and RT-PCR analysis of transcript levels in the
Arabidopsis T-DNA insertion mutants. (A) GLU2 with T-DNA inser-
tion in intron 9. (B) GLT with T-DNA insertion in exon 13. (C) carB
with T-DNA insertion in the promoter. Gray triangles correspond to
T-DNA, which is not to scale. Boxes indicate exons, and lines indi-
cate 5¢-flanking regions and introns. The nucleotide sequences at
the gene–insertion junction are shown. The number of the first

nucleotide refers to the position relative to A of the initial transla-
tion initiation ATG codon for methionine. (D) Transcripts estimated
by RT-PCR for GLU1, GLU2, GLT, carB and 25S ribosomal RNA
(rRNA) in the T-DNA mutants for GLU2, GLT and carB and the wild-
type Arabidopsis (WT).
Table 1. Activities of Fd-GOGAT, NADH-GOGAT, GS and GDH in
the mutants and wild-type (WT) leaves of Arabidopsis under
3000 p.p.m. CO
2
or atmospheric air. The enzyme assay conditions
are described in Experimental procedures. GDH was assayed for
NADH-dependent reductive amination (NADH-GDH) and oxidative
deamination (NAD-GDH) of glutamate. The activity is expressed as
lmol of glutamate formed (GOGATs), lmol of hydroxylamine
formed (GS), or lmol of NADH oxidized (or of NAD reduced) (GDH)
h
)1
Æg
)1
fresh weight.
Arabidopsis
lines GLU1 GLU2 GLT WT
CO
2
Fd-GOGAT 0.5 ± 0.1 26.4 ± 2.4 27.3 ± 2.12 8.7 ± 2.2
NADH-GOGAT 0.8 ± 0.1 0.6 ± 0.1 0.2 ± 0.1 0.8 ± 0.1
GS 115.5 ± 10.3 115.0 ± 12.3 87.0 ± 8.1 114.0 ± 10.5
NADH-GDH 28.6 ± 2.4 37.7 ± 4.2 26.8 ± 2.5 36.5 ± 3.2
NAD-GDH 5.5 ± 0.6 13.4 ± 1.5 7.7 ± 0.6 12.3 ± 1.9
Air

Fd-GOGAT 0.5 ± 0.1 28.5 ± 2.3 29.2 ± 2.7 30.2 ± 3.3
NADH-GOGAT 0.8 ± 0.1 0.7 ± 0.1 0.2 ± 0.1 0.9 ± 0.1
GS 84.1 ± 8.9 76.8 ± 7.1 76.6 ± 6.7 75.0 ± 7.0
NADH-GDH 45.7 ± 5.9 32.6 ± 2.8 44.2 ± 3.9 38.2 ± 3.9
NAD-GDH 5.9 ± 0.7 13.4 ± 1.1 11.1 ± 1.0 9.9 ± 0.7
Amino acid synthesis and transport in Arabidopsis F. Potel et al.
4064 FEBS Journal 276 (2009) 4061–4076 ª 2009 The Authors Journal compilation ª 2009 FEBS
metabolism, we determined the levels of ammonium
and free amino acids in leaves and compared them to
the levels in the control wild-type lines. The GLU1
mutant accumulated a large amount of ammonium
48 h after transfer from high CO
2
to air, owing to
photorespiratory ammonium release (Fig. 3A). A slight
accumulation of photorespiratory and nonphotorespi-
ratory ammonium was detected in the GLT mutant
(Fig. 3A). By contrast, the GLU2 and carB mutants
contained a wild-type level of ammonium (Fig. 3A,B).
The ammonium level of the control wild-type line of
the GLU1 mutant 48 h after transfer from high CO
2
to
air (0.66 lmolÆg
)1
fresh weight) (Fig. 3A) was higher
than that of the control wild-type line of the carB
mutant in air (0.5 lmolÆg
)1
fresh weight) (Fig. 3B).

This may be explained in part by the two experiments
A
B
C
D
E
F
G
H
Fig. 3. Ammonium and amino acid contents in leaves of the GLU1 (ethylmethanesulfonate-mutagenized CS254 line), GLU2, GLT and carB
mutants and the wild-type Arabidopsis (WT). Arabidopsis plants were grown for 42 days by hydroponic culture using 5 m
M nitrate [37] in air
supplemented with 3000 p.p.m. CO
2
, and then in air for 48 h. (A) Ammonium contents under high-CO
2
conditions and in air. (B) Ammonium
contents in air. (C) Glutamine (GLN), glutamate (GLU), asparagine (ASN) and aspartate (ASP) contents under high-CO
2
conditions. (D) Gluta-
mine, glutamate, asparagine and aspartate contents in air. (E) Ornithine (ORN), citrulline (CIT) and arginine (ARG) contents in leaves of
Arabidopsis plants cultured with 5 m
M nitrate in air. (F) Ornithine, citrulline and arginine contents in leaves of Arabidopsis plants cultured
with 2 m
M ammonium in air. (G) Ornithine, citrulline and arginine contents under high-CO
2
conditions. (H) Ornithine, citrulline and arginine
contents in air. Arabidopsis lines represent the EMS mutant for GLU1 (GLU1), T-DNA mutants for GLU2 (GLU2), GLT (GLT), and carB (carB),
and wild-type Arabidopsis. The amino acid contents represent means of analysis on leaves from five independent plants.
F. Potel et al. Amino acid synthesis and transport in Arabidopsis

FEBS Journal 276 (2009) 4061–4076 ª 2009 The Authors Journal compilation ª 2009 FEBS 4065
being performed independently. However, many of the
reactions of nitrogen assimilation and amino acid syn-
thesis depend on ATP, reduced Fd, and NAD(P)H,
and take place in the chloroplast. Elevated CO
2
causes
an imbalance of energy and electron transport because
of the lack of photorespiration, which dissipates excess
photochemical energy and reducing equivalents [14].
This increases the number of chloroplasts and starch
grains per mesophyll cell [15], and higher ammonium
accumulation suggests that the control wild-type line
did not completely recover the nitrogen assimilatory
capacity damaged in high CO
2
. In high CO
2
, the
GLU1 and GLT mutants had reduced glutamate levels
and increased glutamine levels (Fig. 3C). The gluta-
mate and glutamine levels were unaffected in the
GLU2 mutant (Fig. 3C). These observations indicate
that the GS ⁄ GLU1 Fd-GOGAT and GS ⁄ GLT
NADH-GOGAT cycles are involved in nonphotorespi-
ratory ammonium assimilation. In air, the highest glu-
tamine ⁄ glutamate ratio of 13.3 was obtained for the
GLU1 mutant, confirming that the GS ⁄ GLU1 Fd-GO-
GAT cycle is the main pathway of photorespiratory
ammonium reassimilation (Fig. 3D). No impairment in

glutamine to glutamate conversion was observed in the
GLT and GLU2 mutants, whereas the GLT mutant
accumulated asparagine (Fig. 3C,D). As CPSase sup-
plies CP for arginine synthesis, the amino acid levels
of the urea cycle were determined. Despite a tight link-
age of CPSase to arginine synthesis, the carB mutant
showed negligible effects on overall arginine levels.
The levels of ornithine, citrulline and arginine
remained low, at between 0.01 and 0.04 lmolÆg
)1
fresh
weight (Fig. 3E). However, arginine accumulated up to
70-fold and 80-fold in the carB mutant and in the
wild-type plants on 2 mm ammonium medium as com-
pared with nitrate medium (Fig. 3E,F). The results
suggest that excess ammonium was incorporated into
arginine as a nitrogen storage compound. The GLU1
mutant showed a 5.8-fold increase in arginine relative
to the wild-type plants in air, whereas in high CO
2
,
arginine remained at a wild-type level, indicating that
the high level of photorespiratory ammonium was in
part refixed into arginine as a detoxification molecule
(Fig. 3H).
Changes in gene expression patterns caused by
exogenous ammonium
As the endogenous photorespiratory ammonium
affected the levels of ammonium and amino acids in
the GLU1 and GLT mutants (Fig. 3), we investigated

whether expression of the ammonium assimilatory
genes of GOGAT, CPSase and GS1 is modified in
response to exogenous excess ammonium (10 mm),
provided as a supplement to the culture medium. Both
GLU1 and GLT were expressed at higher levels than
GLU2 (Fig. 4A). The ammonium caused up to 4.7-fold
induction of GLT mRNAs; the GLU1 mRNA was
induced to a lesser extent (Fig. 4A). The level of carA
mRNA was unaffected and that of carB mRNA was
lowered by the ammonium treatment (Fig. 4B). The
GS1 genes exhibited the contrasting patterns in
response to excess ammonium: a decrease in the Gln12
mRNA and increases in the Gln11 and Gln13 mRNAs
(Fig. 4C).
Expression of promoter::GUS fusions
To investigate the tissue-specific expression of the
genes for GOGATs and CPSase, transgenic lines
expressing an N-terminal translational construct fused
to a GUS reporter gene were generated. The promoter
region upstream of ATG, including a partial coding
sequence, was isolated by PCR from GLU1 (2385 bp)
()1931 ⁄ 454), GLU2 (1501 bp) ()1089 ⁄ 412), carA
(1121 bp) ()1021 ⁄ 100), and carB (992 bp) ()922 ⁄ 70).
The translational fusions to the uidA gene under the
control of the gene promoter were constructed by
inserting the PCR product in-frame to the 5¢-end of
the GUS reporter gene. In the leaf sections of the
transformed Arabidopsis lines, the GLU1::GUS fusion
was expressed in chloroplasts of the mesophyll
(Fig. 5A). Furthermore, a high level of expression was

detected in the vascular cells of minor veins (Fig. 5B).
GUS activity was detected in a layer of cells composed
of the companion cell–sieve element complex close to
the several xylem tracheary elements (Fig. 5B). A low
level of GLU2::GUS expression was found not only in
the mesophyll chloroplasts, but also in the phloem of
minor veins (Fig. 5C). A high level of carA::GUS
expression was found in a cell layer close to the trache-
ary elements of the vascular bundle, together with its
neighboring mesophyll cells (Fig. 5D). The expression
of carB::GUS was associated with the mesophyll chlo-
roplasts and the companion cell–sieve element complex
in the phloem of minor veins (Fig. 5E). In the leaf sec-
tions from the plant transformed with empty vector,
no staining was detected (Fig. 5F).
In situ hybridization of the transcripts
In situ hybridization analysis was carried out to deter-
mine the tissue-specific expression pattern of GLU1,
GLU2 and GLT in the leaf sections. After hybridiza-
tion to the antisense RNA probe, the GLU1 mRNAs
were found on the periphery of the mesophyll chloro-
Amino acid synthesis and transport in Arabidopsis F. Potel et al.
4066 FEBS Journal 276 (2009) 4061–4076 ª 2009 The Authors Journal compilation ª 2009 FEBS
plasts (Fig. 6A). In addition, specific staining appeared
in the phloem against a pale background (Fig. 6B),
consistent with the GLU1 promoter expression patterns
(Fig. 5). The GLU2 mRNAs were found around the
mesophyll chloroplasts (Fig. 6C). Furthermore, strong
GLU2 mRNA staining was detected in the phloem
adjacent to the mesophyll (Fig. 6E). The sense GLU2

mRNA probe gave no specific signal in the mesophyll
or in the vascular cells (Fig. 6D). The GLT mRNAs
were strongly expressed in the phloem, whereas a weak
GLT mRNA signal was associated with the mesophyll
(Fig. 6F), indicating that GLT was mainly expressed in
the vascular cells.
Immunohistochemical localization
As the GLU1::GUS fusion and the GLU1 mRNAs
were expressed both in the mesophyll cells and in the
vascular cells, we examined the localization of Fd-GO-
GAT by the indirect immunofluorescence method,
using a specific antibody against tobacco Fd-GOGAT
as the primary antibody [4]. With the use of confocal
laser-scanning microscopy, the Alexa 405 fluorochrome
signal was detected in the mesophyll cells and in the
vascular cells of minor veins bordering the mesophyll
cells (Fig. 7A). With higher-magnification resolution,
the specific fluorescence of Fd-GOGAT was found to
be located in the mesophyll chloroplasts (Fig. 7C). The
immunofluorescent signal and the corresponding trans-
mission microscopy of the magnified vascular section
showed that the specific signal was associated with the
clustered oval companion cells, which flanked the sieve
elements in close vicinity to the phloem parenchyma
(Fig. 7E,F). With nonimmune serum as the first anti-
body, no signal was found in the leaf sections
(Fig. 7B,D).
Discussion
Recovery of excess ammonium into amino acids
in the mesophyll

The expression analysis showed that the GLU1
mRNAs were mainly expressed in leaves, in which the
GS1 and GS2 genes were coexpressed (Fig. 1). The
GLU1 mRNAs were found around the mesophyll
A B
C
Fig. 4. Regulation of transcript levels of the
genes for GOGATs, CPSase and GS1 in Ara-
bidopsis leaves in response to exogenous
ammonium. Arabidopsis seedlings were
grown for 12 days on Petri dishes with
5m
M nitrate, and then for 48 h in the
absence or in the presence of 10 m
M
ammonium. Transcript levels were deter-
mined by real-time RT-PCR. (A) GOGAT
genes: GLU1, GLU2, and GLT. (B) CPSase
genes: carA and carB. (C) GS1 genes:
Gln11, Gln12, Gln13, and Gln14. The values
are expressed as percentage ± standard
error relative to the marker EF1a gene.
F. Potel et al. Amino acid synthesis and transport in Arabidopsis
FEBS Journal 276 (2009) 4061–4076 ª 2009 The Authors Journal compilation ª 2009 FEBS 4067
chloroplasts, where Fd-GOGAT protein was immuno-
histochemically located (Figs 5–7). GLU2, the other
Fd-GOGAT gene, was also expressed in the mesophyll
cells, albeit at lower levels than GLU1 (Figs 5 and 6).
The high level of expression of GLU1 in comparison
with that of GLU2 and the conditional lethal pheno-

type of the GLU1 mutant confirm that the defect in
the GLU1 Fd-GOGAT cycle caused the inhibition of
photosynthesis, owing to the extensive release of pho-
torespiratory ammonium (up to 5–20 lmolÆh
)1
Æg
)1
fresh weight) [2,16,17]. The high levels of glutamine
and glutamate (nitrogen-rich five-carbon amino acids)
and asparagine and aspartate (four-carbon amino
acids) (up to 80% of the total amino acids) (Fig. 3)
suggest that excess photorespiratory ammonium was
detoxified, in part, in the form of amino acids for
export out of parenchyma cells of the veins. The high
glutamine ⁄ glutamate ratio in the GLU1 mutant (13.3)
as compared with the wild type in air (1.4) (Fig. 3)
reflects the inability of mitochondrial GDH to act as
an alternative ammonium assimilatory pathway in the
leaves, as GDH is a vascular-located enzyme [18]. As
demonstrated here, the minor effects on ammonium
accumulation in the GLU2 mutant in air (Fig. 3) pro-
vide evidence that the GS ⁄ GLU2 Fd-GOGAT cycle
does not contribute to photorespiratory ammonium
reassimilation. The low GLU2 mRNA levels in the
chl
mc
mc
se
te
cc

cc
bs
cc
se
te
se
chl
cc
mc
mc
se
se
cc
cc
te
te
cc
te
chl
se
A
B
C
D
E
F
Fig. 5. Histochemical analysis of promoter::GUS expression for
GLU1, GLU2, carA and carB in Arabidopsis leaves. (A) Mesophyll
section for GLU1. (B) Mesophyll and vascular section for GLU1. (C)
Mesophyll and vascular section for GLU2. (D) Mesophyll and vascu-

lar section for carA. (E) Mesophyll and vascular section for carB. (F)
Control mesophyll and vascular section from Arabidopsis trans-
formed with an empty vector. bs, bundle sheath; cc, companion
cell; chl, chloroplast; mc, mesophyll cell; se, sieve element; te,
tracheary element. Bar: 10 lm.
chl
mc
cc
te
cc
cc
pp
bs
mc
chl
cc
se
te
cc
mc
chl
se
chl
cc
se
bs
cc
tecc
te
bs

mc
mc
mc
A
B
C
D
E
F
Fig. 6. In situ hybridization of the transcripts of GLU1, GLU2 and
GLT in Arabidopsis leaves. (A) Mesophyll section hybridized with
the antisense GLU1 mRNA probe. (B) Vascular section hybridized
with the antisense GLU1 mRNA probe. (C) Mesophyll section
hybridized with the antisense GLU2 mRNA probe. (D) Mesophyll
and vascular section hybridized with the sense GLU2 mRNA probe.
(E) Vascular section hybridized with the antisense GLU2 mRNA
probe. (F) Mesophyll and vascular section hybridized with the anti-
sense GLT mRNA probe. bs, bundle sheath; cc, companion cell; chl,
chloroplast; mc, mesophyll cell; pp, phloem parenchyma cell; se,
sieve element; te, tracheary element. Bar: 10 lm.
Amino acid synthesis and transport in Arabidopsis F. Potel et al.
4068 FEBS Journal 276 (2009) 4061–4076 ª 2009 The Authors Journal compilation ª 2009 FEBS
leaves (Figs 1 and 4) suggest that GLU2 Fd-GOGAT
supplies a constitutive level of glutamate to maintain a
basal level of protein synthesis.
The high levels of photorespiratory ammonium in
the GLU1 mutant seem to be shifted in part to the
CPSase pathway, resulting in substantial accumulation
of arginine (Fig. 3). Arginine synthesis involves orni-
thine formation from glutamate [6]. Carbamoylation

of the ornithine d-amino group with CP leads to the
formation of citrulline as a precursor of arginine syn-
thesis (see Fig. 8 for a diagram of arginine synthesis).
It has been proposed that photorespiratory ammonium
released by mitochondrial glycine decarboxylase com-
plex (GDC; EC 1.4.4.2 ⁄ 2.1.2.10) is reassimilated into
glutamine by GS, and then into CP by CPSase in the
mitochondria [19]. However, the subcellular compart-
mentation of CPSase has been unclear. We showed
that the promoter from either carA or carB directed
the GUS signal to the mesophyll chloroplasts (Fig. 5),
indicating that photorespiratory ammonium is shuttled
via glutamine to CP in the chloroplasts. Glutamine is
hydrolyzed via the class I or trpG-type glutaminase of
the CPSase small subunit. The carB domain of the
CPSase large subunit forms the Cys-NH
2
intermediate
by the conserved triad (Cys293-His377-Glu379) to acti-
vate HCO
À
3
-dependent ATP cleavage prior to release
of CP [20]. The databases also predict importation of
the large subunit (cleavage at Cys62) and small subunit
(cleavage at Val33) to the chloroplast stroma [21,22].
In addition, plastid-located carbonic anhydrase 1
(At1g58180, cleavage at Ala113) and cytosolic carbonic
anhydrase 2 (At5g14740) can increase the HCO
À

3
sup-
ply via CO
2
⁄ HCO
À
3
interconversion [23,24]. Consis-
tently, mitochondria have been shown to be unable to
use ammonium, and only 0.2% of [
15
N]ammonium
from [
15
N]glycine was metabolized to [
15
N]glutamate,
at a rate of 2.64 nmolÆh
)1
Æmg
)1
protein [25]. However,
it has been shown that GS is localized to the mito-
chondria and that the mitochondria are highly capable
of using glycine to convert ornithine to citrulline (up
to 126 lmolÆh
)1
Æmg
)1
protein) [9]. Because of a lack of

bioinformatic tools to predict to what extent the large
and small precursors are seemingly dual-targeted, a
dual organelle location of the CPSase in the chloro-
plasts and mitochondria cannot not be excluded.
Excess ammonium from either endogenous photores-
piration or exogenous medium appears to be, in part,
shuttled to arginine (Fig. 3). The fact that there were
only slight effects of the carB mutation on overall argi-
nine synthesis, either with excess ammonium or under
standard nitrate conditions, suggests that CPSase is
not the limiting enzyme for arginine biosynthesis.
However, the GLU1 mutant accumulated arginine at a
higher level than the wild-type plants under photore-
spiratory conditions (Fig. 3). It can thus be assumed
that photorespiratory ammonium was shuttled to argi-
nine under the control of N-acetyl-glutamate kinase
(NAGK; EC 2.7.2.8), a key regulatory enzyme in the
arginine synthetic pathway [6].
Nitrogen entry into amino acids and
translocation in the vascular tissue
Under high-CO
2
conditions, when photorespiration is
suppressed, leaf cells depend on the importation of
cc
cc
bs
cc
cc
pp

se
se
chl chl
mc
8.00 µm
mc
phl
phl
mc
mc
phl
A
B
C
D
E
F
Fig. 7. Immunohistochemical localization of Fd-GOGAT in Arabidop-
sis leaves. (A) Mesophyll and vascular section hybridized with the
antibody against Fd-GOGAT as the primary antibody. (B) Control
mesophyll and vascular section hybridized with nonimmune serum
as the primary antibody. (C) Mesophyll section hybridized with the
antibody against Fd-GOGAT as the primary antibody. (D) Control
mesophyll section hybridized with nonimmune serum as the pri-
mary antibody. (E) Vascular section hybridized with the antibody
against Fd-GOGAT as the primary antibody. (F) Transmission of
vascular section corresponding to (E). bs, bundle sheath; cc, com-
panion cell; chl, chloroplast; mc, mesophyll cell; phl, phloem;
pp, phloem parenchyma cell; se, sieve element. Bar: 8 lm.
F. Potel et al. Amino acid synthesis and transport in Arabidopsis

FEBS Journal 276 (2009) 4061–4076 ª 2009 The Authors Journal compilation ª 2009 FEBS 4069
nitrogen via the tracheary elements for amino acid syn-
thesis and subsequent export of the derived amino
acids via phloem sieve elements for use by sink cells
(Fig. 8). Cellular localization of GOGATs and CPSase
in the vascular tissue has been unknown in Arabidop-
sis. To dissect the regulation of amino acid transloca-
tion, we determined whether GOGATs and CPSase
were localized in the phloem companion cell–sieve ele-
ment complex. Cis-acting regulatory elements upstream
of ATG were examined in silico, using the place data-
base [26]. The TATA or TATA-like boxes were identi-
fied for GLU1 (
)61
TTATTT
)56
and
)37
TTATTT
)32
),
GLU2 [
)506
TTATTT
)501
and
)90
TTATTT
)85
()strand)],

GLT (
)311
TATAAAT
)305
), carA (
)277
TATATAA
)271
and
)188
TTATTT
)183
), and carB [
)361
TTATTT
)356
and
)143
TTATTT
)138
()strand)]. Consistent with the meso-
phyll localization, cis-elements active in mesophyll
expression were found: Mem1 motif (CACT) [27];
GLU1 (at positions )258 ⁄ )255, )220 ⁄ )217, and
)129 ⁄ )216), GLU2 ()223 ⁄ )220, )218 ⁄ )215, and )139 ⁄
)216), GLT ()310 ⁄ )307, )28 ⁄ )25, and )24 ⁄ )21),
carA ()237 ⁄ )234, )151 ⁄ )148, and )115 ⁄ )112), and
carB ()405 ⁄ )402 and )79 ⁄ )76). The Mem1 sequence
is supposed to direct mesophyll expression as a result
of transcription repression in the vascular bundle [27].

In addition, the strong cis-elements that determine
vascular patterning were identified: the BS1 motif [28]
[carA (
)875
AGCGGG
)869
), )strand] and the NtBBF1
motif (ACTTTA) [GLU1 ()1180 ⁄ )1175), GLU2
()381 ⁄ )376), GLT ()1499 ⁄ )1494), carA ()237 ⁄ )232),
and carB ()526 ⁄ )521)]. The NtBBF1 motif directs
expression of the oncogene rolB in phloem and xylem
parenchyma [29]. By in situ hybridization, the GLT
mRNAs were found to be confined to the phloem
companion cell–sieve element complex (Fig. 6). The
GLT mutant showed strong inhibition of primary
Fig. 8. Proposed diagram for the role of GOGATs and CPSase in primary nitrogen assimilation, the photorespiratory nitrogen cycle, and
nitrogen translocation. The organelle localizations and stoichiometries of the interconnected enzymatic reactions are not included. CH
2
-THF,
N
5
,N
10
-methylene tetrahydrofolate; FdH, reduced ferredoxin; glycolate-P, 2-phosphoglycolate; N-acetylglutamate-5-P, N-acetyl-glutamate
5-phosphate; OH-pyruvate, hydroxypyruvate; OTC, ornithine transcarbamoylase (EC 2.1.3.3); PGA, 3-phosphoglycerate; RuBP, ribulose
1,5-bisphosphate.
Amino acid synthesis and transport in Arabidopsis F. Potel et al.
4070 FEBS Journal 276 (2009) 4061–4076 ª 2009 The Authors Journal compilation ª 2009 FEBS
ammonium assimilation, with a high glutamine ⁄ gluta-
mate ratio under high-CO

2
conditions (Fig. 3). The
impairment was caused by a lack of only 3% of
the total GOGAT activity, which was restricted to the
small compartment as low as 5% of mature leaf
volume [30]. This underlines the importance of the
companion cells for amino acid trafficking. Moreover,
we found that GLU1 was coexpressed in this cellular
compartment (Figs 5–7). Fd-GOGAT did not compen-
sate for the low NADH-GOGAT activity in the leaves.
This would reflect a supply of glutamate from the
roots by NADH-GOGAT, which was highly expressed
in the roots (Fig. 1).
The companion cell–sieve element complex is the
first cell to collect the solutes and signals, which derive
from the phloem transport and from the retrieval by
xylem-to-phloem pathway. A high level of exogenous
ammonium was found to induce the expression of
GLT, Gln11, and Gln13 (Fig. 4). By contrast, the
decrease in the Gln12 mRNA level suggests that the
Gln12 expression is regulated by a leaf-specific mecha-
nism, because in roots ammonium induces Gln12
expression in the vascular pericycle [31] for the synthe-
sis and transport of glutamine to the leaves. Also, the
high level of ammonium was found to induce ASN1
and ASN2 expression (data not shown). Coexpression
of the genes for GS1, GOGAT and AS in the leaf
phloem (Figs 5–7, and data not shown) indicates that
glutamine ⁄ glutamate and asparagine ⁄ aspartate are, in
part, produced in this cellular compartment. The data

support the view that the GS1 ⁄ NADH-GOGAT cycle
in the phloem functions to enable the entry of excess
ammonium and incoming primary nitrogen into gluta-
mine and glutamate (Fig. 8). These amino acids are
trafficked under the fine control of amino acid trans-
porters [32,33]. Active uptake into yeast cells suggests
that the basic amino acids arginine and lysine are
transported by the specific permeases (AAP3 and
AAP5) for their retrieval along the translocation path-
way and accumulation [34]. Based on the finding of
CPSase in the phloem, the low ability of [
14
C]arginine
to move out of the vascular bundles can be attributed
to the synthesis of arginine precursor by CPSase in the
vascular tissue (Fig. 5). Consistently, leaves fed with
[
14
C]arginine via the xylem saps show more extensive
labeling of the vein than the mesophyll, and the
reverse holds for [
14
C]glutamate and [
14
C]aspartate
[35].
In conclusion, in response to the enhanced levels
of photorespiratory ammonium and exogenously
added ammonium, high levels of ammonium were
converted to amino acids to allow for transport in

Arabidopsis. When the GLU1 mutant was impaired
in the photorespiratory nitrogen cycle, owing to the
absence of the GS ⁄ GOGAT cycle, photorespiratory
ammonium seemed to be shifted to arginine via glu-
tamine and CP generated by CPSase in the chlorop-
lasts. The strong defect of the GLT mutant with
regard to the assimilation of primary ammonium
when grown under high-CO
2
conditions underlines
the importance of amino acid synthesis and traffick-
ing via the phloem companion cell–sieve element
complex, where NADH-GOGAT was mainly located.
Coexpression of the genes for Fd-GOGAT, NADH-
GOGAT, GS1 and AS in the phloem is consistent
with the view that the major nitrogen carriers – glu-
tamine, glutamate, asparagine, and aspartate – are
partly produced in the phloem for translocation
through the vascular bundle (Fig. 8). Further experi-
ments are required to evaluate the excess ammonium
assimilation into CP associated with the formation
of citrulline intermediates in arginine synthesis, and
also the contribution of the phloem to nitrogen
metabolism in Arabidopsis.
Experimental procedures
Isolation of homozygous T-DNA insertion lines
Seeds of T-DNA insertion mutants from a T-DNA mutage-
nized Arabidopsis thaliana Col-0 ecotype for GLU2 (SALK-
018671), GLT (SALK-072454) and carB (SALK-034177)
were obtained from the Nottingham Arabidopsis Stock

Centre (Nottingham, UK). Homozygous mutant lines were
isolated by PCR with the gene-specific primers and T-DNA
border primer. The first PCR was carried out using the fol-
lowing gene-specific primers: GLU2 (SALK_087050) LP, 5¢-
AAACCTGCGAAACCTGAAGCC-3¢; GLU2 RP, 5¢-TCA
CCAAGCAAACCCTCAAGC-3¢; GLT (SALK_072454)
LP, 5¢-TCTCTGGAGGCGCATACAACC-3¢; GLT RP,
5¢-CCAGCGAGATGCACCAGTACC-3¢; carB (SALK_
034177) LP, 5¢-GAGAAGGACATGCGGTACTAG-3¢; and
carB RP, 5 ¢-AGTGAGACACGAGAGAGAGGG-3¢. The
reaction mixture consisted of 0.4 ng of genomic DNA iso-
lated from rosette leaves, 10 pmol of forward primer,
10 pmol of reverse primer and 0.2 units of Taq polymerase
in a total volume of 25 lL. The following program was
used: presoaking at 95 °C for 3 min, and 35 cycles of 94 °C
for 30 s, 55–69 °C for 1 min 30 s, and 72 °C for 1 min
30 s, with postsoaking at 72 °C for 10 min. The second
PCR analysis was carried out using one of two gene-specific
primers (forward or reverse) and the following LBb1 border
primer: 5¢-GCGTGGACCGCTTGCTGCAATT-3¢. The
T-DNA insertion was located, and levels of transcripts
downstream of the insertion site were determined by
RT-PCR. Amplified fragments were visualized by ethidium
bromide staining in agarose gels, and bands were quantified
F. Potel et al. Amino acid synthesis and transport in Arabidopsis
FEBS Journal 276 (2009) 4061–4076 ª 2009 The Authors Journal compilation ª 2009 FEBS 4071
by scanning with an ImageGauge imaging system (Fujifilm
S.A.S., St-Quentin, France).
Plant culture
A. thaliana ecotype Col-0, T-DNA insertion mutants, the

EMS-mutagenenized GLU1 mutant (strain CS254) [2,14]
and the transgenic plants were grown either under
hydroponic conditions in a growth chamber or on Petri
dishes.
Hydroponic culture
For hydroponic culture, surface-sterilized seeds were cold-
treated at 4 °C for 2 days in the dark. Seeds were sown
on top of Eppendorf tubes cut at the bottom and filled
with a medium consisting of a half-strength standard
nutrient solution and 0.8% agar as described in [36].
Seedlings were cultured using the standard solution [37]
under an 8 h light (150 lmolÆphotonsÆm
)2
Æs
)1
;21°C) ⁄ 16 h
dark (17 ° C) photoperiod with 80% relative humidity.
After 42 days, leaves and roots were harvested at 4 h into
a light period, frozen in liquid nitrogen, and kept at
)70 °C prior to analysis.
Growth on Petri dishes
Surface-sterilized Arabidopsis seeds were germinated on
Petri dishes using a nutrient solution containing 5 mm
nitrate, 3% sucrose, and vitamins. Plants were incubated
vertically for 12 days under an 8 h light (150 lmolÆ
photonsÆm
)2
Æs
)1
;21° C) ⁄ 16 h dark (17 °C) photoperiod.

For the ammonium induction experiments, seedlings were
then transferred to the nutrient solution supplemented with
10 mm ammonium for an additional 48 h under the same
regime.
Real-time RT-PCR analysis
Total RNA was extracted, and first cDNA strands were
synthesized from 2 lg of RNA, using an Invitrogen RT
kit (Invitrogen SARL, Cergy Pontoise, France). Real-time
RT-PCR was carried out with a RealMasterMix Cybr
Rox 2.5x kit according to the manufacturer’s instructions
(5 PRIME; Dominique Dutscher SA, Brumath, France).
Amplification was carried out with the following condi-
tions, using 1 lL of a 1 : 10 or 1 : 20 dilution of cDNA
in a total volume of 20 lL: 2 min at 95 °C, and 40
cycles of 95 °C for 19 s, 55 °C for 15 s, and 68 °C for
40 s, on an Eppendorf Realplex
2
MasterCycler (Eppen-
dorf SARL, Le Pecq, France). A melting curve was
obtained to confirm the specificity of the amplification.
For the genes of the multigene family, the following pri-
mer sets were designed along the nonconserved stretches
of the genes. The results were expressed as percentage
relative to EF1a (At5g60390) as a constitutive gene. The
primers used for quantitative real-time PCR are listed in
Table 2.
Construction of GUS fusions by attB
recombination reactions
Binary vectors containing the promoter sequence upstream
of ATG carrying a partial coding sequence of GLU1

(2362 bp), GLU2 (1580 bp), carA (1098 bp) or carB
(1071 bp) was inserted in front of GUS by site-specific
recombination using Gateway vectors [38]. The 5¢-flanking
regions were amplified by PCR using the following gene-
specific primers by introducing attB1 (5¢-AA AAA GCA
GGC T-3¢) and att B2 (5¢-A GAA AGC TGG GT-3¢)
recombination sites at the 5¢-ends and 3¢-ends, respectively:
GLU1 forward, 5¢-AAAACCCTAAACCCCCAATGT-3¢;
GLU1 reverse, 5¢-GAGCATCTTTGACAACTCCATGTG-3¢;
GLU2 forward, 5¢-TCGTGGTGGTTGATTCATTTT-3¢; GLU2
reverse, 5¢-TGTGTTCCATACAACCAAGTGC-3¢; carA
forward, 5¢-CACACCAATCTTTACGAGT-3¢; carA reverse,
5¢-CGACAGAAACCCTAAATCCACCGC-3¢; carB for-
ward, 5¢-TGTCCAGTTGCACCATTATCAAA-3¢; and
carB reverse, 5¢-CCGGATTGGATTTGGAAGAAGCG-3¢.
The PCR products were cloned into pDONR207 and then
in front of the N-terminus of GUS in pMDC163, according
to the manufacturer’s instruction (Invitrogen SARL).
Table 2. Primers used for quantitative real-time RT-PCR analysis.
Amplification was carried out as described in Experimental proce-
dures. F, forward primer; R, reverse primer.
Primer (5¢-to3¢)
GLU1 (At5g04140) F: ATCATTCAAGAGCAGGTTGT
R: GACAGTTGAAAGCAGTTATT
GLU2 (At2g41220) F: TACACATTTGATCGTGGTTT
R: AATCGAAAACCCTTTCTTAA
GLT (At5g53460) F: TTGGACCTGAGCCAACACTTG
R: CATCATCCGTTTTGGTGAGGA
carA (At3g27740) F: TGGTCAGGTGGAGATCAGTGC
R: GAGGCTTCAGGGTGGTACTGG

carB (At1g29900) F: AGGAAGACCACATGCTGCTGA
R: TCAAAGAAGTCCTGAAGAGCGG
Gln11 (At5g37600) F: CCTCTCAGACTCCACTGACAAA
R: TTCACTGTCTTCACCAGGAGC
Gln12 (At1g66200) F: TCTCAGACAACAGTGAAAAGATCA
R: TGTCTTGACCAGGAGCTTGAC
Gln13 (At3g17820) F: GCCACCGGGAAAATCATC
R: TTCACTGTCTTCTCCAGCAGC
Gln14 (At5g16570) F: CGATTCCACTGACCAGACCAT
R: GACTTCACTGTCATCGCCC
Gln2 (At5g35630) F: CACCAAACCTTACTCTGACAGG
R: CACTATCTTCACCAGGTGCTTG
EF1a (At5g60390) F: CTGGAGGTTTTGAGGCTGGTAT
R: CCAAGGGTGAAAGCAAGAAGA
Amino acid synthesis and transport in Arabidopsis F. Potel et al.
4072 FEBS Journal 276 (2009) 4061–4076 ª 2009 The Authors Journal compilation ª 2009 FEBS
Recombinant vectors containing the GUS fusion construct
were transferred by electroporation into Agrobacterium
tumefaciens (strain C58PMP90) [39]. A. thaliana ecotype
Col-0 was transformed by dipping floral tissues into trans-
formed Ag. tumefaciens containing 5% sucrose and 0.005%
(v ⁄ v) surfactant Silvet L-77 [40]. Transformants were recov-
ered from the seeds selected on Murashige–Skoog medium
containing 30 mgÆL
)1
hygromicine B.
GUS histochemical analysis
In situ staining of GUS activity was carried out by incubating
tissues in 50 mm sodium phosphate (pH 7.0), 0.1 mm
K

3
[Fe(CN)
6
], 0.1 mm K
4
[Fe(CN)
6
] and 1.9 mm 5-bromo-4-
chloro-3-indolyl b-d-glucuronic acid (X-glucuronide) at
37 °C for 2–18 h according to [41]. After removal of chloro-
phyll with 70% ethanol, tissues were embedded in resin using
Kuzler Histo-Technique-Set 7100 (Heraeus Kuzler, Fried-
richsdorf, Germany) as described in [42]. Eight-micrometer
sections were cut with a microtome (Jung RM 2055; Leica
Microsystems, Wetzlar, Germany). GUS staining was visual-
ized using a Leica DMR microscope (Leica Microsystems).
In situ hybridization
Tissue inclusion
Leaf tissues were fixed in 4% (v ⁄ v) paraformaldehyde and
0.1% Triton X-100 in NaCl ⁄ P
i
(10 mm sodium phosphate,
pH 7.0, 130 mm NaCl). Tissues were dehydrated in a grad-
ual series of ethanol in NaCl ⁄ P
i
(10%, 30%, 50%, 70%,
and 96%) and ethanol ⁄ histoclear [2 : 1, 1 : 1 and 1 : 2
(v ⁄ v)] at 4 °C. Tissues were then incubated in 100% histo-
clear, histoclear ⁄ paraffin (1 : 1, v ⁄ v) and paraffin at 59 °C.
Hybridization probe preparation

Total RNA was extracted using an RNA isolation kit (Qia-
gen, GmbH, Germany), and first cDNA strands were syn-
thesized from 2 lg of RNA using an Omniscript RT kit
(Qiagen). Sense and antisense DNA probes were amplified
by PCR using the following gene-specific primers by intro-
ducing a T7 sequence (5¢-TGTAATACGACTCACTA
TAGGGC-3¢) at the 5¢-ends of reverse and forward prim-
ers, respectively: GLU1 forward, 5¢-ATCATTCAAGA
GCAGGTTGT-3¢; GLU1 reverse, 5¢-GACAGTTGAAAG
CAGTTATT-3¢; GLU2 forward, 5¢-TCAACATTTGATCG
TGGTTT-3¢; GLU2 reverse, 5¢-AATCGAAAACCCTT
TCTTAA-3¢; GLT forward, 5¢-GGTGGGCTGATGATGT
ATGGA-3¢; and GLT reverse, 5¢-CATCATCCGTTTTG
GTGAGGA-3¢. Amplified sense and antisense DNAs
(400 ng each) were subjected to in vitro transcription using
a transcription kit (Promega, Madison, WI, USA) in the
presence of digoxigenin-UTP. DNAs were removed by DNase
digestion. RNA probes were controlled by electrophoresis.
In situ hybridization
Eight-micrometer sections were prepared using a microtome
and dried on glass slides (DAKO 2024; Dako, Basingstoke,
UK). Samples were deparaffined in histoclear, hydrated
through a gradual ethanol series (96%, 85%, 50%, and
30%, v ⁄ v), and washed in NaCl ⁄ P
i
(6.5 mm Na
2
HPO
4
,

1.5 mm KH
2
PO
4
, pH 7.3, 14 mm NaCl, 2.7 mm KCl). Pro-
teins were removed by proteinase K digestion (4 lgÆmL
)1
in
10 mm Tris ⁄ HCl, pH 7.5, 50 mm EDTA). Samples were
treated with 0.5% (v ⁄ v) acetic anhydride in 1.3 m trietha-
nolamine (pH 7.0). Samples were dehydrated in a gradual
series of ethanol in NaCl ⁄ P
i
(30%, 50%, 70%, 85%, 96%,
and 100%, v ⁄ v), and prehybridized with 50% (v ⁄ v) formal-
dehyde, 5· SSC (1· SSC: 150 mm NaCl and 15 mm sodium
citrate, pH 7.0), 100 lgÆmL
)1
tRNA, 50 lg ÆmL
)1
, heparin
and 0.1% Tween-20. Samples were hybridized with the
sense or antisense probe in situ hybridization solution
(Dako). Slides were washed in 0.2· SSC, and then T2 solu-
tion (0.5% blocking reagent dissolved in T1 solution:
100 mm Tris ⁄ HCl, pH 7.5, 150 mm NaCl) (Roche Diagnos-
tics Gmbh, Penzberg, Germany) and T3 solution (T1 solu-
tion with 1% BSA and 0.5% Triton X-100). Slides were
incubated with anti-digoxigenin antibody conjugated with
alkaline phosphatase (Roche Diagnostics Gmbh) in T3

solution. After washing with T3 solution, alkaline phospha-
tase activity was developed with 5-bromo-4-chloro-3-indol-
yl-phosphate (50 mgÆmL
)1
) and Nitroblue tetrazolium
(75 mgÆmL
)1
). Slides were washed with TE and sealed with
gel mount formol 1 (Microm Microtech France, Franche-
ville, France). Fluorescence was observed using a Leica
DMR microscope (Leica Microsystems).
Indirect immunofluorescence analysis
Leaf sections were fixed in 3.7% (w ⁄ v) formaldehyde dis-
solved in 50 mm Pipes buffer (pH 6.9), 5 mm MgSO
4
, and
5mm EGTA (MTSB), and then in NaCl ⁄ P
i
(6.5 mm
Na
2
HPO
4
, 1.5 mm KH
2
PO
4
, pH 7.3, 14 mm NaCl, 2.7 mm
KCl). Tissues were dehydrated in a graded series of ethanol
(30%, 50%, 70%, 90%, and 97%), and embedded in wax.

Eight-micrometer sections were cut with a microtome and
mounted onto slides, and then dewaxed and rehydrated in
a graded series of ethanol (97%, 90%, and 50%). Antigen
unmasking was carried out in 10 mm citrate buffer (pH
6.0), and blocked with 1% (w ⁄ v) BSA in NaCl ⁄ P
i
(blocking
solution). Leaf sections were hybridized with the primary
rabbit IgG against tobacco Fd-GOGAT, and then goat
anti-(rabbit IgG) labeled with Alexa 405 (Molecular Probes,
Carlsbad, CA, USA) dissolved in blocking solution. Preim-
mune serum was used as the control primary IgG. Immu-
nofluorescence was observed with a laser diode (25 mW,
405 nm) using a Leica objective (HC PL APO 63·⁄1.20
Water Corr ⁄ 0.17 Lbd. BL) and a spectral confocal laser-
F. Potel et al. Amino acid synthesis and transport in Arabidopsis
FEBS Journal 276 (2009) 4061–4076 ª 2009 The Authors Journal compilation ª 2009 FEBS 4073
scanning microscope (TCS-SP2-AOBS) (Leica Micro-
systems). Low speed scan (200 lines per second) images
(512 · 512 pixels) were generated, and Alexa 405 fluores-
cence was measured at a specific bandwidth (407–427 nm)
after spectral adjustment to eliminate the background noise.
The red autofluorescence of tissues was observed between
509 and 628 nm.
Amino acid analysis
Amino acids were extracted from 20 mg samples at 4 °C
with 1 mL of 2% (w ⁄ v) sulfosalicylic acid. After centrifuga-
tion at 17 500 g for 15 min, supernatants were adjusted to
pH 2.1 with LiOH. Total amino acid contents were esti-
mated by the method of [43]. Amino acids were separated

by ion exchange chromatography on a JLC-500 ⁄ V amino
acid analyzer (Jeol Ltd, Tokyo, Japan).
Enzyme preparation and assays
GS was extracted and assayed by measuring c-glutam-
ylhydroxamate produced by its synthetase reaction
according to [44]. Fd-GOGAT and NADH-GOGAT were
extracted and assayed as described in [12]. Glutamate
formation with ferredoxin or NADH as electron donor
was determined by HPLC. GDH was assayed for
NADH-dependent glutamate synthetic activity and NAD-
dependent glutamate oxidation activity as described in
[44].
Determination of metabolites and total soluble
proteins
Free ammonium contents were determined by the phenol
hypochlorite assay of Berthelot [45]. Soluble protein con-
tents were determined by the Coomassie Blue dye-binding
assay (Bio-Rad Laboratories, Hercules, CA, USA).
References
1 Crawford NM & Forde BG (2002) Molecular and
developmental biology of inorganic nitrogen nutrition.
In The Arabidopsis Book (Somerville C & Meyerrowitz
E, eds), pp 1–25. American Society of Plant Biologists,
Rockville, MD.
2 Somerville CR & Ogren WL (1980) Inhibition of photo-
synthesis in Arabidopsis mutants lacking leaf glutamate
synthase activity. Nature 286, 257–259.
3 Suzuki A & Knaff D (2005) Glutamate synthases: struc-
tural, mechanistic and regulatory properties, and role in
the amino acid metabolism. Photosynth Res 83, 191–

217.
4 Masclaux-Daubresse C, Reisdorf-Cren M, Pageau K,
Lelandais M, Grandjean O, Kronenberger L, Valadier
M-H, Feraud M, Jouglet T & Suzuki A (2006) Gluta-
mine synthetase ⁄ glutamate synthase pathway and
glutamate dehydrogenase play distinct roles for sink ⁄
source nitrogen cycle in tobacco. Plant Physiol 140,
444–456.
5 Moffatt BA & Ashihara H (2002) Purine and pyrimi-
dine nucleotide synthesis and metabolism. In The Ara-
bidopsis Book (Somerville C & Meyerrowitz E, eds), pp
1–20. American Society of Plant Biologists, Rockville.
6 Slocum RD (2005) Genes, enzymes and regulation of
arginine biosynthesis in plants. Plant Physiol Biochem
43, 729–745.
7 Skopelitis DS, Paranychianakis NK, Paschalidis KA,
Pilakonis ED, Dellis ID, Yakoumakis DI, Kouvarakis
A, Papadakis AK, Stephanou EG & Roubelakis-
Angelakis K (2006) Abiotic stress generates ROS that
signal expression of anionic glutamate dehydrogenases
to form glutamate for proline synthesis in tobacco and
grapevine. Plant Cell 18, 2767–2781.
8 Lancien M, Martin M, Hsieh M-H, Leustek T,
Goodman H & Coruzzi GK (2002) Arabidopsis glt-1
mutant defines a role for NADH-GOGAT in the
non-photorespiratory ammonium assimilatory pathway.
Plant J 29, 347–358.
9 Taira M, Valtersson U, Burkhart B & Ludwig RA
(2004) Arabidopsis thaliana GLU2-encoded glutamine
synthetase is dual targeted to leaf mitochondria and

chloroplasts. Plant Cell 16, 2048–2058.
10 van Bel AJE (2003) The phloem, a miracle of ingenuity.
Plant Cell Environ 25, 125–149.
11 Lam H-M, Coschigano K, Schultz C, Melo-Oliverira
R, Tjaden G, Oliveira I, Ngai N, Hsieh MH &
Coruzzi G (1995) Use of Arabidopsis mutants and
genes to study amide amino acid biosynthesis. Plant
Cell 7, 887–898.
12 Valadier M-H, Yoshida A, Grandjean O, Morin H,
Kronenberger J, Boutet S, Raballand A, Hase T,
Yoneyama T & Suzuki A (2008) Implication of the
glutamine synthetase ⁄ glutamate synthase pathway in
conditioning the amino acid metabolism in bundle
sheath and mesophyll cells of maize leaves. FEBS
J 275, 3139–3206.
13 Arabidopsis Genome Initiative (2000) Analysis of the
genome sequence of the flowering plant Arabidopsis tha-
liana. Nature 408, 796–815.
14 Ogren WL (1984) Photorespiration: pathways,
regulation, and modification. Annu Rev Plant Physiol
35, 415–442.
15 Teng N, Wang J, Chen T, Wu X, Wang Y & Lin J
(2006) Elevated CO2 induces physiological, biochemical
and structural changes in leaves of Arabidopsis thaliana
.
New Phytol 172, 92–103.
16 Suzuki A & Rothstein S (1997) Structure and regula-
tion of ferredoxin-dependent glutamate synthase from
Amino acid synthesis and transport in Arabidopsis F. Potel et al.
4074 FEBS Journal 276 (2009) 4061–4076 ª 2009 The Authors Journal compilation ª 2009 FEBS

Arabidopsis thaliana. Cloning of cDNA, expression in
different tissues of wild-type and gltS mutant strains,
and light induction. Eur J Biochem 243, 708–718.
17 Coschigano KT, Melo-Oliveira R, Lim J & Coruzzi
GM (1998) Arabidopsis gls mutants and distinct
Fd-GOGAT genes: implication for photorespiration
and primary nitrogen assimilation. Plant Cell 10,
1–12.
18 Harel E, Lea PJ & Miflin BJ (1977) The localization
of enzymes of nitrogen assimilation in maize leaves
and their activities during greening. Planta 134, 195–
200.
19 Ludwig RA (1993) Arabidopsis chloroplasts dissimilate
l-arginine and l-citrulline for use as N source. Plant
Physiol 101, 429–435.
20 Trotta PP, Burt ME, Haschemeyer RH & Meister A
(1971) Reversible dissociation of carbamyl phosphate
synthetase into a regulated synthesis subunit and a sub-
unit required for glutamine utilization. Proc Natl Acad
Sci USA 68, 2599–2603.
21 Emanuelsson O, Nielsen H, Brunak S & von Heijne G
(2000) Predicting subcellular localization of proteins
based on their N-terminal amino acid sequence. J Mol
Biol 300, 1005–1016.
22 Heazlewood JL, Tonti-Filippini J, Verboom RE &
Millar AH (2005) Combining experimental and pre-
dicted datasets for determination of the subcellular
location of proteins in Arabidopsis. Plant Physiol 139,
598–609.
23 Fett JP & Coleman JR (1994) Characterization and

expression of two cDNAs encoding carbonic anhydr-
ase in Arabidopsis thaliana. Plant Physiol 105, 707–
713.
24 Chollet R, Vidal J & O’Leary MH (1996) Phosphoenol-
pyruvate carboxylase: a ubiquitous highly regulated
enzyme in plants. Annu Rev Plant Physiol Plant Mol
Biol 47, 273–298.
25 Yamaya T, Oaks A, Rhodes D & Matsumoto H (1986)
Synthesis of [
15
N]glutamate from [2-
15
N]glutamate and
[
15
N]glycine by mitochondria isolated from pea and
corn shoots. Plant Physiol 81, 754–757.
26 Higo K, Ugawa Y, Iwamoto M & Korenga T (1999)
Plant cis-acting regulatory DNA elements (PLACE)
database. Nucleic Acids Res 27, 297–300.
27 Gowik U, Burscheidt J, Akyldiz M, Schlue U, Koczor
M, Streubel M & Westhoff P (2004) cis-Regulatory ele-
ments for mesophyll-specific gene expression in the C4
plant Flaveria trinervia, the promoter of the C4 phos-
phoenolpyruvate carboxylase gene. Plant Cell 16, 1077–
1090.
28 Lacombe E, Van Doorsselaere J, Boerjan W, Boutet
AM & Grima-Pettenatti J (2000) Characterization of
cis-elements required for vascular expression of the
Cinnamoyl CoA reductase gene and for protein–DNA

complex formation. Plant J 23, 663–676.
29 Baumann K, De Paolis A, Costantino P & Gualberti G
(1999) The DNA binding site of the Dof protein
NtBBF1 is essential for tissue-specific and auxin-regu-
lated expression of the rolB oncogene in plants. Plant
Cell 11, 323–333.
30 Bowsher CG & Tobin AK (2001) Compartmentation of
metabolism within mitochondria and plastids. J Exp
Bot 52, 513–527.
31 Ishiyama K, Inoue E, Watanabe-Takahashi A, Obara
M, Yamaya T & Takahashi H (2004) Kinetic properties
and ammonium-dependent regulation of cytosolic isoen-
zymes of glutamine synthetase in Arabidopsis. J Biol
Chem 279, 16598–16605.
32 Fischer W-N, Andre
´
B, Rentsch D, Krolkiewicz S,
Tegeder M, Breitkreuz K & Frommer WB (1998)
Amino acid transport in plants. Trends Plant Sci 3,
188–195.
33 Okumoto S, Koch W, Tegder M, Fischer WN, Biehl A,
Leister D, Stierhof YD & Frommer WB (2004) Root
phloem-specific expression of the plasma membrane
amino acid proton-co-transporter AAP3. J Exp Bot 55,
2155–2168.
34 Fischer W-N, Kwart M, Hummel S & Frommer WB
(1995) Substrate specificity and expression profile of
amino acid transporter (AAPs) in Arabidopsis. J Biol
Chem 270, 16315–16320.
35 McNeil DL, Atkins CA & Pate JS (1979) Uptake

and utilisation of xylem-born amino compounds
by shoot organs of legume. Plant Physiol 63,
1076–1081.
36 Orsel M, Eulenburg K, Krapp A & Daniel-Vedele F
(2004) Disruption of the nitrate transporter
genes AtNRT2.1 and AtNRT2.2 restricts growth at
low external nitrate concentration. Planta 219,
714–721.
37 Coı
¨
c Y & Lesaint C (1971) Comment assurer une bonne
nutrition en eau et en ions mine
´
raux en holticulture.
Holticulture Franc¸ aise 8, 11–14.
38 Curtis MD & Grossniklaus U (2003) A gateway
cloning vector set for high-throughput functional
analysis of genes in planta. Plant Physiol 133, 462–469.
39 Koncz C & Schell J (1986) The promoter of
TL-DNA gene 5 controls the tissue-specific expression
of chimeric genes carried by a novel type of
Agrobacterium binary vector. Mol Gen Genet 204,
383–396.
40 Clough SJ & Bent AF (1998) Floral dip: a simplified
method for Agrobacterium-mediated transformation of
Arabidopsis thaliana. Plant J 16, 735–743.
41 Jefferson RA (1987) Assaying chimeric gene in plants:
the GUS gene fusion system. Plant Mol Biol Rep 5,
387–405.
42 Feraud M, Masclaux-Daubresse C, Ferrario-Me

´
ry S,
Pageau K, Lelandais M, Ziegler C, Leboeuf E, Jouglet
T, Viret L, Spampinato A et al. (2005) Expression of a
F. Potel et al. Amino acid synthesis and transport in Arabidopsis
FEBS Journal 276 (2009) 4061–4076 ª 2009 The Authors Journal compilation ª 2009 FEBS 4075
ferredoxin-dependent glutamate synthase gene in
mesophyll and vascular cells and functions of the
enzyme in ammonium assimilation in Nicotiana tabacum
(L.). Planta 222, 667–677.
43 Rosen H (1957) A modified ninhydrin colorimetric
analysis for amino acids. Arch Biochem Biophys 67,
10–15.
44 Ferrario-Me
´
ry S, Valadier MH, Godefroy N, Miallier
D, Hirel B, Foyer CH & Suzuki A (2002) Diurnal
changes in ammonia assimilation in transformed
tobacco plants expressing ferredoxin-dependent gluta-
mate synthase mRNA in the antisense orientation.
Plant Sci 163, 59–67.
45 Berthelot M (1859) Re
´
pertoire Chimie Pure Applique
´
e.
1, 284.
Amino acid synthesis and transport in Arabidopsis F. Potel et al.
4076 FEBS Journal 276 (2009) 4061–4076 ª 2009 The Authors Journal compilation ª 2009 FEBS