Báo cáo khoa học: Engineering triterpene production in Saccharomyces cerevisiae – b-amyrin synthase from Artemisia annua docx

Engineering triterpene production in Saccharomyces
cerevisiae – b-amyrin synthase from Artemisia annua
James Kirby
1
, Dante W. Romanini
2
, Eric M. Paradise
1,3
and Jay D. Keasling
1,3,4,5
1 California Institute for Quantitative Biomedical Research, University of California, Berkeley, CA, USA
2 Department of Chemistry, University of California, Berkeley, CA, USA
3 Department of Chemical Engineering, University of California, Berkeley, CA, USA
4 Department of Bioengineering, University of California, Berkeley, CA, USA
5 Physical Biosciences Division, Lawrence Berkeley National Laboratory, Berkeley, CA, USA
Triterpenes belong to the isoprenoid family of com-
pounds and are recognized by their C
30
backbones.
They are typically synthesized by the cyclization of the
sterol precursor 2,3-oxidosqualene into a multi-ringed
compound with a single alcohol group. Fungi and
mammals convert 2,3-oxidosqualene to the triterpene
compound lanosterol in the biosynthetic pathways to
ergosterol and cholesterol, respectively. The equivalent
step in plant primary metabolism is the cyclization of
2,3-oxidosqualene to cycloartenol for the production
of membrane sterols. Cycloartenol is also the triter-
pene precursor of brassinosteroid phytohormones that
regulate plant growth and development [1,2]. Based on
chemical and genetic analyses performed to date, it

appears that plants are more diverse than animals or
fungi in the range of tritepene products synthesized [3].
However, despite the fact that a large variety of triter-
pene compounds have been isolated from plant sources
[4], the majority of triterpene synthase genes isolated
to date have encoded either lupeol or b-amyrin synth-
ases (EC 5.4.99.–) [1]. b-amyrin in particular serves as
the olefin precursor to a wide range of downstream
products. The action of oxidative enzymes (typically
cytochrome P450 monooxygenases) and glyco-
syltransferases convert b-amyrin to various triterpene
saponins in different plant species [5–7]. These sapo-
nins may perform protective roles in the host plant,
acting as antimicrobial [8] and insecticidal [9] agents,
and many of these compounds are also of interest
from a human health perspective. The effect of plant
saponins on low-density lipoprotrein cholesterol
absorption and arterial atherosclerosis has received
much attention, leading to the development of several
cholesterol-reducing dietary supplements [10]. Saponins
Keywords
Artemisia annua; isoprenoids; metabolic
engineering; Saccharomyces cerevisiae;
b-amyrin synthase
Correspondence
J. D. Keasling, Berkeley Center for
Synthetic Biology, 717 Potter Street,
Building 977, Mail code 3224, University of
California, Berkeley, CA 94720-3224, USA
Fax: +1 510 495 2630

Tel: +1 510 495 2620
E-mail:
(Received 12 December 2007, revised 11
February 2008, accepted 18 February 2008)
doi:10.1111/j.1742-4658.2008.06343.x
Using a degenerate primer designed from triterpene synthase sequences, we
have isolated a new gene from the medicinal plant Artemisia annua. The
predicted protein is highly similar to b-amyrin synthases (EC 5.4.99.–),
sharing amino acid sequence identities of up to 86%. Expression of the
gene, designated AaBAS,inSaccharomyces cerevisiae, followed by GC ⁄ MS
analysis, confirmed the encoded enzyme as a b-amyrin synthase. Through
engineering the sterol pathway in S. cerevisiae, we explore strategies for
increasing triterpene production, using AaBAS as a test case. By manipula-
tion of two key enzymes in the pathway, 3-hydroxy-3-methylglutaryl-CoA
reductase and lanosterol synthase, we have improved b-amyrin production
by 50%, achieving levels of 6 mgÆL
)1
culture. As we have observed a
12-fold increase in squalene levels, it appears that this strain has the capa-
city for even higher b-amyrin production. Options for further engineering
efforts are explored.
Abbreviation
HMGR, HMG-CoA reductase.
1852 FEBS Journal 275 (2008) 1852–1859 ª 2008 The Authors Journal compilation ª 2008 FEBS
may also find applications in ruminant nutrition [11],
as anticancer agents [12,13], and as vaccine adjuvants
[14].
Although triterpene synthases have been expressed
in microbial hosts such as Saccharomyces cerevisiae,
there has been little effort made so far to engineer the

metabolism of a microbial host for enhanced produc-
tion of triterpenes. By contrast, there have been many
considerable efforts to engineer microbes for higher
production of mono-, sesqi- and diterpenes [15]. These
projects have mainly focused on the overexpression of
enzymes involved in either of the two pathways
(mevalonate or 1-deoxy-d-xylulose-5-phosphate) res-
ponsible for the biosynthesis of isoprenoids [16–18]. In
S. cerevisiae, the mevalonate pathway is responsible
for the biosynthesis of isoprenoids and sterols. A good
deal is known about regulatory mechanisms within
the pathway, although the majority of studies have
focused on the upper part of the pathway, from acetyl-
CoA to squalene. Our knowledge of how the lower
half of the pathway, from squalene to ergosterol, is
regulated remains somewhat limited. As the branch
point for triterpene biosynthesis is located in this latter
half of the pathway, the optimal steps to increase their
production in yeast are not immediately apparent.
Artemisia annua, or sweet wormwood, has been used
medicinally for centuries, predominantly in China [19].
A sesquiterpene constituent, artemisinin, is one of the
most important drugs used in the treatment of
malaria. In an effort to isolate and characterize new
terpene synthases from A. annua, we have designed
degenerate primers for use in RT-PCR. Here, we
describe the isolation of a b-amyrin synthase gene
from A. annua and its expression in S. cerevisiae. Our
findings on engineering overproduction of b-amyrin in
S. cerevisiae should be relevant to the production of

any triterpene.
Results
Isolation and verification of a b-amyrin synthase
In order to isolate new triterpene synthase genes from
A. annua, several degenerate primers were designed
from an alignment of plant triterpene synthase protein
sequences. 3¢ RACE reactions were carried out on
RNA isolated from A. annua leaf tissue, and a product
of the expected size was obtained with the primer
TriF1 (Table 1). The fragment was cloned and the
sequence was found to be homologous to triterpene
synthase genes. Gene-specific primers were designed
for 5¢ RACE, and a product was obtained that
contained the likely start codon, based on protein
sequence alignments, with 175 nt of the upstream
5¢ UTR sequence. The predicted full-length gene
encodes a 762 amino acid protein that shares over
70% identity with plant b-amyrin synthases. The most
closely related protein (AAX14716), sharing 86%
sequence identity, is the b-amyrin synthase from
Aster sedifolius, a plant which belongs to the asteroi-
deae, the same sub-family as A. annua (Fig. 1).
Published detection methods for triterpenes such as
b-amyrin are generally laborious, and are inconvenient
when processing a large number of samples [5,20].
Therefore, we attempted to streamline the process by
eliminating the sample clean-up steps normally per-
formed after cell extraction, or the need for derivatiza-
tion. Cell disruption and saponification was performed
as previously described, using a mixture of EtOH and

KOH [20]. We found that using the nonpolar solvent
dodecane for extraction allowed us to follow this
directly with separation by GC ⁄ MS, using the highest
possible temperature settings for the mass spectrometer
ion source and quadrupole. This proved to be a sensi-
tive and robust method for the detection of b-amyrin
and the cell sterol components squalene and ergo-
sterol.
The coding sequence of the gene, designated AaBAS,
was cloned into the high-copy yeast expression vector
pESC-URA, under control of the GAL10 promoter,
and transformed into S. cerevisiae to create the strain
bamy1. After induction of AaBAS expression with
galactose, sterols were extracted from cells and ana-
lyzed by GC ⁄ MS. A single chromatographic peak was
found in extracts from bamy1 cells that was absent in
cells containing an empty vector. The retention time of
this compound was identical to that of a b-amyrin
standard, and the corresponding mass spectra were
found to match (Fig. 2). An in vitro assay using a
bamy1 cell extract and the triterpene substrate 2,3-
oxidosqualene was also found to result in production
Table 1. Oligonucleotides used. The restriction sites used in clon-
ing are underlined.
Oligonucleotide Sequence (5¢-to3¢)
TriF1 ATGYTNGCNTGYTGGRTNGARGAYCC
PolyT-anchor GAGCTCGAGATCTAAGCTTGCTTTTTTTTTTTTTT
TTTTTT
Anchor GAGCTCGAGATCTAAGCTTGC
TriRaceR1 GATCCTGCTGGTTCCCATGCGGCTA

TricdsF AAC
GAATTCAACAATGTGGAGATTGAAAATAGCAG
AAGGGCGCAATG
TricdsR AAC
GAGCTCCTAGGTGCCTTTGAGCTGTGGCAGCA
CCTGCTTG
ERG7F TAC
CCATGGCAGAATTTTATTCTGACACAATCGGTC
ERG7R CC
ATCGATCCATCAACCGGATGTGCTGTATTGACG
J. Kirby et al. Engineering triterpene production in yeast
FEBS Journal 275 (2008) 1852–1859 ª 2008 The Authors Journal compilation ª 2008 FEBS 1853
of the b-amyrin product. The product was not
observed in the absence of either the substrate or the
AaBAS gene (data not shown).
Production of b-amyrin in engineered strains
of S. cerevisiae
We attempted to increase production of b-amyrin by
modifying flux through the sterol biosynthetic pathway
of S. cerevisiae. The enzyme 3-hydroxy-3-methylgluta-
ryl-CoA reductase (HMGR, represented by two iso-
zymes: HMG1 and HMG2; Fig. 3) is known to act as
a control point in the sterol pathway, with one of
the primary control mechanisms being degradation of
the HMGR protein in response to accumulation of
the squalene precursor farnesyl pyrophosphate [21,22].
Expression of a truncated form of the HMG1
(tHMG1) protein circumvents this feedback, which
occurs via the N-terminal transmembrane domain of
the enzyme [23]. Furthermore, expression of tHMG1

from an independently-regulated promoter will bypass
any transcriptional control of expression. Strain bamy2
contains an integrated copy of tHMG1 under control
of the GAL1 promoter in addition to pESC-AaBAS.
In agreement with previous studies [23,24], bamy2
accumulated significantly higher levels of squalene
compared to bamy1 (Fig. 4A). However, this eight-fold
increase in squalene did not translate into increased
yields of b-amyrin; rather the b-amyrin levels from
bamy2 were one-third of that produced by bamy1
(Fig. 4C). The ergosterol content of the cells remained
essentially unchanged in strain bamy2 (Fig. 4B), which
is consistent with the view that there is a feedback con-
trol mechanism in the pathway between squalene and
ergosterol [23]. bamy2 grew extremely slowly at first
(Fig. 4D), as observed previously [23], where it was
attributed to accumulation of toxic intermediates such
as farnesyl pyrophosphate.
In a separate approach, we tested whether downre-
gulation of lanosterol synthase (ERG7; Fig. 3) would
provide more 2,3-oxidosqualene substrate for AaBAS.
Other studies have shown that triterpene production
can be enhanced by deleting ERG7 completely [20].
However, as erg7 strains require feeding with ergo-
sterol, this approach is economically limited for indus-
trial purposes. To enable the downregulation of ERG7,
we modified strain bamy1 by replacing the native
ERG7 promoter with the methionine-repressible pro-
moter of the MET3 gene [22]. Thus, the strain bamy3
contains a P

MET3
-ERG7 replacement of the native
ERG7 gene in addition to pESC-AaBAS. Following
downregulation of ERG7, strain bamy3 was found to
Fig. 1. Pairwise sequence alignment of AaBAS from A. annua (upper line) with its closest known relative, b-amyrin synthase from A. sedifo-
lius (AAX14716, lower line). The position of the primer TriF1 is indicated by the arrow.
Engineering triterpene production in yeast J. Kirby et al.
1854 FEBS Journal 275 (2008) 1852–1859 ª 2008 The Authors Journal compilation ª 2008 FEBS
accumulate similar levels of squalene to strain bamy1,
whereas b-amyrin levels were slightly higher (Fig. 4). It
is interesting to note that ergosterol levels in the cell
were not reduced in response to ERG7 limitation.
Veen et al. [25] have shown that, when squalene epoxi-
dase (ERG1) is overexpressed, there is no accumula-
tion of 2,3-oxidosqualene, but rather of lanosterol,
indicating that ERG7 is not a flux-limiting enzyme. In
addition, it is likely that regulation of the pathway was
adjusted in response to the reduced ERG7 transcript
levels in order to maintain ergosterol production.
Indeed, it was necessary to optimize the relative timing
of AaBAS induction and ERG7 repression to even
maintain the same b-amyrin production levels as strain
bamy1. When induction and repression were simulta-
neous, b-amyrin production levels were actually lower
in strain bamy3 and, thus, it was necessary to delay
repression of ERG7 until 24–48 h after AaBAS induc-
tion in order to allow AaBAS to first accumulate (data
not shown). The data shown in the present study were
generated by inducing AaBAS at inoculation and
repressing ERG7 43 h later by the addition of 1 mm

methionine.
We next decided to combine the two strategies in
order to test whether the feedback regulation that
appears to take place in the tHMG1 strain bamy2 may
be overcome by downregulating ERG7. Strain bamy4
was therefore constructed from strain bamy2 by
replacing the native ERG7 promoter with the MET3
promoter. Again, it was found that optimal results
were obtained when ERG7 was repressed by the addi-
tion of methionine 24–48 h after induction of AaBAS
expression. bamy4 did not exhibit the same growth lag
phase observed in bamy2, and grew at approximately
the same rate as bamy1 (Fig. 4D). Interestingly, squa-
lene accumulated in b amy4 to even greater levels than
Time (min)
Total ion abundance
A
BY4742 wt strain
AaBAS in vivo product
β-amyrin standard
β-amyrin standard
HO
AaBAS in vivo product
%
%
m/
z
m/
z
B

Fig. 2. Confirmation of b-amyrin production in S. cerevisiae by expression of AaBAS. (A) Overlaid GC ⁄ MS chromatographs of extracts from
strains BY4742 and bamy1 with an authentic b-amyrin standard (with b-amyrin structure shown) (B) Mass spectra extracted from the peaks
shown in (A).
J. Kirby et al. Engineering triterpene production in yeast
FEBS Journal 275 (2008) 1852–1859 ª 2008 The Authors Journal compilation ª 2008 FEBS 1855
those found in bamy2, corresponding to a 12-fold
increase over those in bamy1 (Fig. 4A). In this case,
however, b-amyrin production levels were also signifi-
cantly enhanced, resulting in a 50% increase in yield
over bamy1 (Fig. 4C).
Discussion
We have shown that it is possible to engineer increased
production of tritepenes in S. cerevisiae without the
need for feeding with exogenous sterols. The 50%
increase in b-amyrin levels demonstrated in the present
study should be considered in the light of the fact that
triterpene production may not be as amenable to engi-
neering efforts as the volatile sesquiterpenes and mono-
terpenes that readily diffuse out of the cell. However,
it is apparent that further progress can be made and
there are some clues as to what these next steps may
comprise. We have achieved a 12-fold increase in squa-
lene levels over the initial bamy1 strain, and a logical
course of action would be to find a way to convert this
squalene into b-amyrin.
M’baya et al. [26] demonstrated that ERG1 activity
is reduced in the presence of excess sterols through a
mechanism other than enzyme inhibition, most likely
transcriptional repression. Not a great deal is known
about how the latter half of the sterol pathway is regu-

lated and exactly what role ERG1 plays in this pro-
cess. However, the fact that we observe a further
increase in squalene upon downregulation of ERG7 in
strain bamy4 would indicate that 2,3-oxidosqualene
can act as a repressor of ERG1. Tight regulation at
ERG1 would make sense as it marks the beginning of
the oxygen-dependent reactions in the pathway. If the
feedback regulation is transcriptional in nature, then it
Acetyl-CoA
HMG-CoA
Mevalonate
HMG1,2
Squalene
2,3-oxidosqualene
ERG1
Lanosterol
ERG7
β-amyrin
AaBAS
Ergosterol
Fig. 3. The yeast sterol pathway with the branch point for b-amyrin
synthesis. Multiple steps are indicated by dashed lines.
0
2
4
6
8
10
12
0 50 100 150 200 250

Time (h)
Squalene
(µg·mL
–1
culture)
βamy1
βamy2
βamy3
βamy4
0
5
10
15
20
25
30
0 50 100 150 200 250
Time (h)
Ergosterol
(µg·mL
–1
culture)
0
1
2
3
4
5
6
7

0 50 100 150 200 250
Time (h)
β-amyrin
(µg·mL
–1
culture)
0
0.5
1
1.5
2
2.5
3
3.5
4
4.5
5
0 50 100 150 200 250
Time (h)
Attenuance at 600 nm
AB
CD
Fig. 4. Determination of (A) squalene, (B) ergosterol, (C) b-amyrin, and (D) D
600
for strains bamy1 (BY4742, pESC-AaBAS), bamy2 (BY4742,
pESC-AaBAS,P
GAL1
-tHMG1), b amy3 (BY4742, pESC-AaBAS,P
MET3
-ERG7), and bamy4 (BY4742, pESC-AaBAS,P

GAL1
-tHMG1,P
MET3
-ERG7 ).
Error bars represent the SD for three independent cultures per strain.
Engineering triterpene production in yeast J. Kirby et al.
1856 FEBS Journal 275 (2008) 1852–1859 ª 2008 The Authors Journal compilation ª 2008 FEBS
should be possible to circumvent it by overexpressing
ERG1 under the control of an independent promoter.
Veen et al. [25] overexpressed ERG1 and tHMG1
together and observed a 50% increase in sterol concen-
trations.
We have subsquently tested this hypothesis by trans-
forming the strain bamy4 with a high-copy expression
vector harboring ERG1 under control of the GAL1
promoter (to create strain bamy5). A comparison
between these two strains showed that b-amyrin pro-
duction levels were essentially unchanged whereas
squalene levels actually increased slightly in strain
bamy5 (data not shown). This would indicate that flux
from squalene to b-amyrin is not limited by ERG1
transcription levels, but the possibility remains that
there is regulation of ERG1 at the protein level. It also
is likely that there are other factors contributing to the
lack of flux from squalene to b-amyrin. In particular,
the availability of squalene for conversion by ERG1
may be limited by its biochemical state. In cases where
tHMG1 has been overexpressed in yeast, squalene
accumulates predominantly in an insoluble form that is
not immediately available to the sterol pathway [25,27].

The sterol-acyl transferases ARE1 and ARE2 are
responsible for esterification of excess squalene for
storage in insoluble lipid particles [27]. Thus, it appears
that attenuation of this process would be the next logi-
cal step for further engineering triterpene production in
S. cerevisiae. Additional studies into the possible
regulation of ERG1 by 2,3-oxidosqualene at either
post-translational or enzyme kinetic levels may also be
warranted.
Experimental procedures
Isolation of a triterpene synthase gene from
A. annua
Leaf tissue from A. annua was collected predominantly
from new growth at branch tips and immediately frozen in
liquid nitrogen. The tissue was ground to a fine powder
using a cooled mortar and pestle, and RNA was purified by
the Qiagen Plant RNeasy extraction method using RLC
buffer as supplied (Qiagen, Valencia, CA, USA). RNA was
quantified and checked for integrity using the Bioanalyzer
2100 (Agilent, Foster City, CA, USA). A single triterpene-
specific primer (TriF1; Table 1) was designed from an align-
ment of various plant triterpene synthase protein sequences.
For 3¢ RACE, two primers were used in conjunction with
TriF1: a poly(dT) primer with a 5 ¢ ‘anchor’ sequence that
has a melting temperature matching that of TriF1; and a
primer composed of only the anchor sequence (Table 1).
cDNA was synthesized from 3 lg of leaf total RNA using
the polyT-anchor primer and Superscript II (Invitrogen,
Carlsbad, CA, USA) with reverse transcription at 50 °C,
followed by RNase H treatment. Touchdown PCR was car-

ried out on the cDNA using the TriF1 and anchor primers
by dropping the annealing temperature by 0.4 °C per cycle
from 61 °Cto56°C for the first eight cycles, followed by
30 cycles of amplification with an annealing temperature of
56 °C. A product within the expected size range (1.4 kb,
based on the average length of a triterpene synthase gene
and a plant 3¢ UTR) was cloned into the TOPO TA vector
(Invitrogen) and sequenced to reveal an ORF that appeared
to encode a triterpene-synthase-like protein. The 5¢ end of
the cDNA was recovered using the GeneRacer kit (Invitro-
gen) according to the manufacturer’s guidelines, with the
gene-specific primer TriRaceR1. The complete coding
sequence of the candidate triterpene synthase gene was con-
firmed by cloning and sequencing three PCR products,
amplified using PFU Turbo (Stratagene, La Jolla, CA,
USA) from three independent cDNA preparations. The
sequence has been submitted to Genbank and is available
under accession number EU330197.
Expression of the candidate triterpene-synthase
gene in S. cerevisiae
The full-length coding sequence of the candidate triterpene
synthase gene was amplified using the primers TricdsF and
TricdsR, which contain the 5¢ restriction sites Eco RI
and SacI, respectively. The sequence AACA was included
immediately 5¢ to the start codon in TricdsF to provide a
favorable translation start context [28]. The PCR product
was cloned into the EcoRI and SacI sites of the yeast
expression vector pESC-URA (Stratagene) under control of
the GAL10 promoter and ADH1 terminator to create
pESC-AaBAS. Following sequence verification, the plasmid

was transformed into S. cerevisiae BY4742 by the lithium
acetate method [29], and transformants were selected on
synthetic complete minus uracil agar (SC-URA). Synthetic
complete media were made by adding 6.7 g Æ L
)1
Difco yeast
nitrogen base (Becton, Dickinson & Co., Sparks, MI, USA)
to a complete supplemental mixture (MB Biomedicals,
Solon, OH, USA) of vitamins, minerals and amino acids,
with the appropriate amino acid dropped out. Transformed
yeast strains were maintained on SC medium with 2%
d-glucose as carbon source, and induced by inoculating
into SC + 2% d-galactose at D
600
of 0.02–0.03.
Modification of the sterol biosynthesis pathway
in S. cerevisiae
A strain containing a soluble, truncated form of HMG-
CoA reductase 1 (HMG1) under control of the GAL1 pro-
moter was constructed by transformation of BY4742 with
the integrating plasmid pd-tHMGR and selection for loss
J. Kirby et al. Engineering triterpene production in yeast
FEBS Journal 275 (2008) 1852–1859 ª 2008 The Authors Journal compilation ª 2008 FEBS 1857
of the URA3 selection marker using 5-fluoroorotic acid, as
described previously [17].
The native promoter for the S. cerevisiae lanosterol syn-
thase gene, ERG7, was replaced with the methionine-sup-
pressible promoter P
MET3
to create the strain P

MET3
-ERG7.
The strategy used essentially follows that described by
Gardner and Hampton [21]. Genomic DNA from strain
BY4742 served as a template for amplification of the first
422 bp of the ERG7 cds using the primers ERG7F and
ERG7R (Table 1). The amplified fragment was cloned into
the NcoI and ClaI restriction sites of the vector pRS-ERG9
[17], thus replacing the ERG9 cds fragment with the ERG7
cds fragment, 3¢ to the MET3 promoter. For integration
into S. cerevisiae, the vector was digested at the unique
BbvCI site in the ERG7 cds to facilitate homologous recom-
bination with the native ERG7 gene. Upon transformation
into S. cerevisiae, the successful promoter replacement was
confirmed by PCR using a P
MET3
forward primer and an
ERG7 reverse primer.
Extraction, identification, and quantitation
of b-amyrin and sterols
A single method was developed to extract and quantify
b-amyrin and the native yeast sterols squalene and ergos-
terol. Yeast culture (1 mL) in a microfuge tube was centri-
fuged for 1 min at 17 900 g to pellet cells. The cells were
resuspended in 0.6 mL of a fresh solution of 20% (w ⁄ v)
KOH in 50% ethanol containing 30 lgÆmL
)1
cholesterol as
an internal standard. The cells were boiled for 5 min in this
solution in 2 mL screw-cap tubes. After cooling, the sterols

and b-amyrin were extracted by vortexing with 0.6 mL
dodecane (Sigma, St Louis, MO, USA) for 5 min at room
temperature. The dodecane phase was transferred to a glass
vial and directly subjected to GC ⁄ MS (GC model 6890, MS
model 5973 inert, Agilent). An aliquot of the sample (1 lL)
was injected into a DB5-MS column (Agilent) operating at
a helium flow rate of 1 mLÆmin
)1
. The oven temperature
was held at 80 °C for 1 min after injection, and was then
ramped to 280 °Cat20°CÆmin
)1
, held at 280 °C for
20 min, ramped to 300 °Cat20°CÆmin
)1
and finally held at
300 °C for 2 min. The MS ion source was held at 300 °C
throughout, with the quadrupole at 200 °C and the GC ⁄ MS
transfer line at 280 °C. Full mass spectra were generated for
metabolite identification by scanning within the m ⁄ z range
of 40–440. For quantification of metabolites, samples were
run in selected ion mode, detecting ions 203, 218, and 426.
Standard curves for b-amyrin, squalene and ergosterol were
run at the start and end of each batch of samples.
References
1 Phillips DR, Rasbery JM, Bartel B & Matsuda SP
(2006) Biosynthetic diversity in plant triterpene cycliza-
tion. Curr Opin Plant Biol 9, 305–314.
2 Fujioka S & Yokota T (2003) Biosynthesis and meta-
bolism of brassinosteroids. Annu Rev Plant Biol 54,

137–164.
3 Haralampidis K, Trojanowska M & Osbourn AE
(2002) Biosynthesis of triterpenoid saponins in plants.
Adv Biochem Eng Biotechnol 75, 31–49.
4 Xu R, Fazio GC & Matsuda SP (2004) On the origins
of triterpenoid skeletal diversity. Phytochemistry 65,
261–291.
5 Suzuki H, Achnine L, Xu R, Matsuda SP & Dixon RA
(2002) A genomics approach to the early stages of tri-
terpene saponin biosynthesis in Medicago truncatula.
Plant J 32, 1033–1048.
6 Connolly JD & Hill RA (2007) Triterpenoids. Nat Prod
Rep 24, 465–486.
7 Vincken JP, Heng L, de Groot A & Gruppen H (2007)
Saponins, classification and occurrence in the plant
kingdom. Phytochemistry 68, 275–297.
8 Wallace RJ (2004) Antimicrobial properties of plant
secondary metabolites. Proc Nutr Soc 63, 621–629.
9 Taylor WG, Fields PG & Sutherland DH (2004) Insecti-
cidal components from field pea extracts: soyasaponins
and lysolecithins. J Agric Food Chem 52, 7484–7490.
10 Carr TP & Jesch ED (2006) Food components that
reduce cholesterol absorption. Adv Food Nutr Res 51,
165–204.
11 Wina E, Muetzel S & Becker K (2005) The impact of
saponins or saponin-containing plant materials on rumi-
nant production – a review. J Agric Food Chem 53,
8093–8105.
12 Kerwin SM (2004) Soy saponins and the anticancer
effects of soybeans and soy-based foods. Curr Med

Chem Anticancer Agents 4, 263–272.
13 Ma YX, Fu HZ, Li M, Sun W, Xu B & Cui JR
(2007) An anticancer effect of a new saponin compo-
nent from Gymnocladus chinensis Baillon through
inactivation of nuclear factor-kappaB. Anticancer
Drugs 18 , 41–46.
14 Skene CD & Sutton P (2006) Saponin-adjuvanted par-
ticulate vaccines for clinical use. Methods 40, 53–59.
15 Maury J, Asadollahi MA, Moller K, Clark A & Nielsen
J (2005) Microbial isoprenoid production: an example
of green chemistry through metabolic engineering.
Adv Biochem Eng Biotechnol 100, 19–51.
16 Reiling KK, Yoshikuni Y, Martin VJ, Newman J,
Bohlmann J & Keasling JD (2004) Mono and diterpene
production in Escherichia coli. Biotechnol Bioeng 87,
200–212.
17 Ro DK, Paradise EM, Ouellet M, Fisher KJ, Newman
KL, Ndungu JM, Ho KA, Eachus RA, Ham TS, Kirby
J et al. (2006) Production of the antimalarial drug
precursor artemisinic acid in engineered yeast.
Nature
440, 940–943.
18 Martin VJ, Pitera DJ, Withers ST, Newman JD &
Keasling JD (2003) Engineering a mevalonate pathway
Engineering triterpene production in yeast J. Kirby et al.
1858 FEBS Journal 275 (2008) 1852–1859 ª 2008 The Authors Journal compilation ª 2008 FEBS
in Escherichia coli for production of terpenoids.
Nat Biotechnol 21, 796–802.
19 van Agtmael MA, Eggelte TA & van Boxtel CJ (1999)
Artemisinin drugs in the treatment of malaria: from

medicinal herb to registered medication. Trends Phar-
macol Sci 20, 199–205.
20 Zhang H, Shibuya M, Yokota S & Ebizuka Y (2003)
Oxidosqualene cyclases from cell suspension cultures of
Betula platyphylla var. japonica: molecular evolution of
oxidosqualene cyclases in higher plants. Biol Pharm Bull
26, 642–650.
21 Gardner RG & Hampton RY (1999) A highly con-
served signal controls degradation of 3-hydroxy-3-meth-
ylglutaryl-coenzyme A (HMG-CoA) reductase in
eukaryotes. J Biol Chem 274, 31671–31678.
22 Hampton RY & Rine J (1994) Regulated degradation
of HMG-CoA reductase, an integral membrane protein
of the endoplasmic reticulum, in yeast. J Cell Biol 125,
299–312.
23 Donald KA, Hampton RY & Fritz IB (1997) Effects of
overproduction of the catalytic domain of 3-hydroxy-
3-methylglutaryl coenzyme A reductase on squalene
synthesis in Saccharomyces cerevisiae. Appl Environ
Microbiol 63, 3341–3344.
24 Polakowski T, Stahl U & Lang C (1998) Overexpression
of a cytosolic hydroxymethylglutaryl-CoA reductase
leads to squalene accumulation in yeast. Appl Microbiol
Biotechnol 49, 66–71.
25 Veen M, Stahl U & Lang C (2003) Combined overex-
pression of genes of the ergosterol biosynthetic pathway
leads to accumulation of sterols in Saccharomyces cere-
visiae. FEMS Yeast Res 4, 87–95.
26 M’Baya B, Fegueur M, Servouse M & Karst F (1989)
Regulation of squalene synthetase and squalene epoxi-

dase activities in Saccharomyces cerevisiae. Lipids 24,
1020–1023.
27 Polakowski T, Bastl R, Stahl U & Lang C (1999)
Enhanced sterol-acyl transferase activity promotes sterol
accumulation in Saccharomyces cerevisiae. Appl Micro-
biol Biotechnol 53, 30–35.
28 Yun DF, Laz TM, Clements JM & Sherman F
(1996) mRNA sequences influencing translation and
the selection of AUG initiator codons in the yeast
Saccharomyces cerevisiae. Mol Microbiol 19, 1225–
1239.
29 Gietz RD & Schiestl RH (2007) Quick and easy yeast
transformation using the LiAc ⁄ SS carrier DNA ⁄ PEG
method. Nat Protoc 2, 35–37.
J. Kirby et al. Engineering triterpene production in yeast
FEBS Journal 275 (2008) 1852–1859 ª 2008 The Authors Journal compilation ª 2008 FEBS 1859