Báo cáo khoa học: Homologous expression of a bacterial phytochrome The cyanobacterium Fremyella diplosiphon incorporates biliverdin as a genuine, functional chromophore doc

Homologous expression of a bacterial phytochrome
The cyanobacterium Fremyella diplosiphon incorporates biliverdin
as a genuine, functional chromophore
Benjamin Quest
1,
*, Thomas Hu
¨
bschmann
2
, Shivani Sharda
1
, Nicole Tandeau de Marsac
3
and
Wolfgang Ga
¨
rtner
1
1 Max-Planck-Institute for Bioinorganic Chemistry, Mu
¨
lheim, Germany
2 Institute for Biology, Humboldt-University, Berlin, Germany
3 Unite
´
des Cyanobacteries, De
´
partement de Microbiologie, Institut Pasteur (URA-CNRS 2172), Paris, France
Keywords
bacteriophytochrome; biliverdin IXa;
photoreceptor; phycocyanobilin; two-
component signal transduction

Correspondence
W. Ga
¨
rtner, Max-Planck-Institute for
Bioinorganic Chemistry, Stiftstr. 34–36,
D-45470 Mu
¨
lheim, Germany
Fax: +49 208306 3951
Tel: +49 208306 3693
E-mail:
*Present address
Institut de Biologie Structurale, Jean Pierre
Ebel (UMR5075 CNRS-CEA-UJF), Grenoble,
France
(Received 5 October 2006, revised 17
January 2007, accepted 20 February 2007)
doi:10.1111/j.1742-4658.2007.05751.x
Bacteriophytochromes constitute a light-sensing subgroup of sensory kin-
ases with a chromophore-binding motif in the N-terminal half and a C-ter-
minally located histidine kinase activity. The cyanobacterium Fremyella
diplosiphon (also designated Calothrix sp.) expresses two sequentially very
similar bacteriophytochromes, cyanobacterial phytochrome A (CphA) and
cyanobacterial phytochrome B (CphB). Cyanobacterial phytochrome A
has the canonical cysteine residue, by which covalent chromophore attach-
ment is accomplished in the same manner as in plant phytochromes; how-
ever, its paralog cyanobacterial phytochrome B carries a leucine residue at
that position. On the basis of in vitro experiments that showed, for both
cyanobacterial phytochrome A and cyanobacterial phytochrome B, light-
induced autophosphorylation and phosphate transfer to their cognate

response regulator proteins RcpA and RcpB [Hu
¨
bschmann T, Jorissen
HJMM, Bo
¨
rner T, Ga
¨
rtner W & deMarsac NT (2001) Eur J Biochem 268,
3383–3389], we aimed at the identification of a chromophore that is incor-
porated in vivo into cyanobacterial phytochrome B within the cyanobacte-
rial cell. The approach was based on the introduction of a copy of cphB
into the cyanobacterium via triparental conjugation. The His-tagged puri-
fied, recombinant protein (CphBcy) showed photoreversible absorption
bands similar to those of plant and bacterial phytochromes, but with
remarkably red-shifted maxima [k
max
700 and 748 nm, red-absorbing (P
r
)
and far red-absorbing (P
fr
) forms of phytochrome, respectively]. A com-
parison of the absorption maxima with those of the heterologously gener-
ated apoprotein, assembled with phycocyanobilin (k
max
686 and 734 nm)
or with biliverdin IXa (k
max
700 and 750 ± 2 nm), shows biliverdin IXa
to be a genuine chromophore. The kinase activity of CphB cy and phos-

photransfer to its cognate response regulator was found to be strictly
P
r
-dependent. As an N-terminally located cysteine was found as an
alternative covalent binding site for several bacteriophytochrome photore-
ceptors that bind biliverdin and lack the canonical cysteine residue (e.g.
Agrobacterium tumefaciens and Deinococcus radiodurans), this correspond-
ing residue in heterologously expressed cyanobacterial phytochrome B was
mutated into a serine (C24S); however, there was no change in its spectral
Abbreviations
BphP, bacteriophytochrome photoreceptor; BV, biliverdin; Cph, cyanobacterial phytochrome; CphBcy, CphB from homologous expression in
Fremyella diplosiphon SF 33; PCB, phycocyanobilin; PEB, phycoerythrobilin; PFB, phytochromobilin.
2088 FEBS Journal 274 (2007) 2088–2098 ª 2007 The Authors Journal compilation ª 2007 FEBS
Sensing of light quality is of paramount importance
for all photosynthetic organisms. Higher and lower
plants employ phytochromes [1] for determining the
quality, quantity and direction of light in the long-
wavelength range. The recent finding of phytochrome-
like chromoproteins in phototrophic [2] and even
heterotrophic [3,4] bacteria has extended the occur-
rence and utilization of this efficient photoreceptor sys-
tem into the prokaryotic phylum. Besides the sequence
similarities to plant phytochromes in the N-terminal
half, many of the bacteriophytochrome photoreceptors
(BphPs) so far identified exhibit a histidine kinase
activity in their C-terminal half. Typically, the BphP-
encoding genes form an operon together with genes
encoding their cognate response regulators, thus add-
ing light as a trigger to the bacterial two-component
signal transduction [5,6]. However, the finding of pro-

karyotic phytochromes has not only extended the vari-
ation in protein sequences, but has also shown a
greater variety in the chromophores employed in these
photoreceptors, and also in the type of chromophore
binding. The first BphP identified, cyanobacterial phyto-
chrome (Cph) 1 from Synechocystis PCC6803, is fur-
nished in vivo with phycocyanobilin (PCB), and in vitro
is able to bind the open-chain tetrapyrroles phytochro-
mobilin (PFB), PCB and phycoerythrobilin (PEB) in a
covalent manner via a thioether linkage to a cysteine
residue, identical to that found in plant phytochromes.
Also, it undergoes light-induced reactions similar to
those undergone by the phytochromes [7,8]. Homologs
of Cph1 have been found in a number of other cyano-
bacteria [9], e.g. Calothrix PCC7601 [10] and Anabaena
PCC7120, and also in proteobacteria s uch a s Deinococcus
radiodurans, Pseudomonas aeruginosa [3,11] and Agro-
bacterium tumefaciens [12–14]. Interestingly, these
proteobacterial BphPs all lack the plant phytochrome-
specific cysteine in the chromophore-binding domain,
and make use of another cysteine residue, located at
the N-terminal end within the first 30 amino acids, to
bind covalently biliverdin (BV) IXa as chromophore.
This unusual type of binding was confirmed by a
recently presented three-dimensional structure of the
GAF-PHY domain of D. radiodurans [15].
Evidence for a light-modulated phosphorelay
between histidine kinase and a response regulator was
first found for Cph1 [16], and this was also demonstra-
ted for heterologously expressed CphA and CphB, after

they had been assembled with tetrapyrrole chromo-
phores. They undergo red ⁄ far-red light-modulated auto-
phosphorylation in a similar fashion to Cph1, and
perform remarkably selective transphosphorylation to
their cognate response regulators, RcpA and RcpB [17].
The finding of two bacteriophytochromes in one
organism, Calothrix PCC7601 [9,10], caused some con-
fusion in our understanding of this novel group of
prokaryotic photoreceptors, in particular because only
CphA carries the canonical cysteine residue that, ana-
logously to plant phytochromes, accomplishes covalent
binding of the tetrapyrrole chromophore by formation
of a thioether linkage. CphB, instead, has a leucine at
that position (Fig. 1C). This exchange (leucine instead
of cysteine) apparently prevents CphB from covalently
binding the chromophore (in the phytochrome-typical
fashion; Fig. 1A); however, incubation of CphB with
tetrapyrrole chromophores, e.g. PCB, generated photo-
chemically active chromoproteins reminiscent of the
plant phytochromes, but with slightly red-shifted
absorption maxima [10]. Even more surprisingly, the
replacement of only that particular leucine residue of
CphB by a cysteine yielded a covalently binding BphP
with spectral properties very similar to those of its
paralog, CphA [10].
Like the above-mentioned BphPs, CphB also has
a cysteine at position 24, which would be able to
bind BV. However, we showed recently that in
chromophore competition experiments, heterologously
expressed apo-CphB binds BV very tightly and with

preference over PCB, but could be expelled from the
binding site upon extended incubation with PCB [18].
The various chromophores that have been identified in
prokaryote phytochromes and the different types of
binding or incorporation led us to investigate which
chromophore is incorporated in vivo. The homologous
expression of Cph1 [19] has revealed that Synechocystis
furnishes this protein with PCB, and this most prob-
ably also holds true for the closely related CphA from
Calothrix. Up to now, however, no BphP lacking the
canonical cysteine as the chromophore attachment site
has been homologously expressed in its genuine host
organism. Here, we describe the first expression and
isolation of such a bacteriophytochrome, CphB, in
Calothrix PCC7601, its photochemistry, and its light-
induced kinase activity. The homologous expression
was of particular interest, as Calothrix synthesizes large
properties. On the other hand, the mutation of His267, which is located
directly after the canonical cysteine, into alanine (H267A), caused com-
plete loss of the capability of cyanobacterial phytochrome B to form a
chromoprotein.
B. Quest et al. Homologously expressed bacteriophytochrome
FEBS Journal 274 (2007) 2088–2098 ª 2007 The Authors Journal compilation ª 2007 FEBS 2089
amounts of PCB (and PEB) for its light-harvesting
complexes, in which process BV appears as only a
transient intermediate at much lower concentrations.
Results
Homologous expression of cphB
The cyanobacterium Calothrix PCC7601 expresses two
bacteriophytochromes, CphA and CphB [9]. Whereas

CphA binds bilin chromophores (PCB and P FB) in a
covalent, phytochrome-typical manner via a thioether
linkage with a cysteine residue of the protein, this
essential amino acid is replaced in CphB by a leucine.
In vitro, heterologously expressed apo-CphB is able to
form photochemically active complexes with PCB and
also with BV IXa [28]. As both of these tetrapyrroles,
and also PEB, are present in the cyanobacterium, it
was of interest to determine which chromophore is
added to the apoprotein by the cyanobacterial cell.
The cphB gene was furnished with an oligonucleotide
providing a His6-tag at its 5¢-end, and was cloned
under the control of the tac promoter (plasmid pPL9b;
see Experimental procedures). The plasmid pPL9b was
transferred to Fremyella diplosiphon SF33, by triparen-
tal conjugation. The cyanobacteria were grown in a
12 L fermenter, and yielded, after 5 days, 15 g of cell
pellet (wet weight), from which  3 mg of CphBcy
could be purified via affinity chromatography, followed
by a gel filtration step.
When purified, CphBcy was subjected to Zn-gel elec-
trophoresis. The protein showed a strong fluorescence
in the molecular mass range of the holoprotein
(molecular mass  87 kDa; Fig. 2, right panel). The
comigration of the chromophore-induced fluorescence
is evidence for a covalently bound tetrapyrrole. The
heterologously expressed apo-CphB, assembled with
PCB, does not show the Zn-induced fluorescence after
the purification (data not shown). The lower affinity of
apo-CphB for PCB has been formerly observed during

affinity purification of CphB–PCB adducts [28] and
recently confirmed by competition experiments [18].
The purified holoprotein showed an absorption band
at 700 nm that could be converted by irradiation into
an even further red-shifted absorption band at 748 nm
(Fig. 2). This photochemistry could be repeated several
times without any loss of absorption. A comparison of
Fig. 2. Absorption and absorption difference spectra (P
r
) P
fr
)of
CphBcy from homologous expression in F. diplosiphon SF33. Inset:
Comparison of CphBcy with CphB from heterologous expression,
assembled with BV. Coomassie-stained Scha
¨
gger-PAGE and Zn-gel
of CphBcy are also shown.
A
B
C
Fig. 1. (A) Covalent attachment of PCB to a cysteine residue of an
apophytochrome. The photochemistry of phytochromes (Z fi E
photoisomerization of the methine bridge between rings C and D) is
also indicated. The protonated state of the chromophore in the pro-
tein-bound form has been demonstrated by resonance Raman
spectroscopy [33]. (B) Structures of tetrapyrrole compounds
(in nonprotein-bound form) serving as chromophores in phyto-
chromes (PFB, phytochromobilin; BV, biliverdin IXa). Note that
(a) BV has one additional double bond in the A-ring as compared

to the other chromophores, and (b) one double bond ) of the
3¢-ethylidene substituent ) is lost upon covalent attachment to the
protein via thioether linkage formation in PCB and PFB. (C)
Sequence comparison of representative bacteriophytochromes in
the region of the chromophore-binding site (Cph1 from Synechocys-
tis PCC6803; CphA and CphB from Calothrix PCC7601; AphA ⁄ B
from Anabaena PCC7120; Bph1 from Deinococcus radiodurans; and
BphP from Pseudomonas aeruginosa). Sequences of Arabidopsis
thaliana PhyA and PhyB have been added to demonstrate the simi-
larity to plant phytochromes. The arrowhead indicates the position
of covalent binding in the case of a cysteine residue being present.
Homologously expressed bacteriophytochrome B. Quest et al.
2090 FEBS Journal 274 (2007) 2088–2098 ª 2007 The Authors Journal compilation ª 2007 FEBS
these absorption maxima with heterologously exp-
ressed apo-CphB, incubated with either PCB or
BV IXa, gave practically complete agreement with the
absorption of the BV IXa adduct [BV IXa adduct,
k
max
¼ 702 nm and 754 nm, red-absorbing (P
r
) and far
red-absorbing (P
fr
) form of phytochrome, respectively;
PCB adduct: k
max
¼ 686 nm and 734 nm, P
r
and P

fr
].
As also seen for heterologously expressed CphB [18],
the photochemically generated P
fr
form of CphBcy
exhibited remarkable thermal stability when kept in
darkness at ambient temperature. A fraction of only
25% of CphBcy-P
fr
converted back to P
r
within
2 days. Excess PCB added to CphBcy–BV adduct did
not alter its spectroscopic properties (data not shown).
Identification of CphBcy by HPLC and MS
CphBcy was unambiguously identified by MALDI-TOF
MS after SDS ⁄ PAGE, excision of the band from the
gel, and tryptic digestion. The peptide mixture of a
tryptic digest of purified CphBcy represented 95% of
all theoretically predicted peptides. Among these, the
peptide spanning the putative chromophore-binding
site (positions 262–277 with the conserved histidine at
position 267) could also be identified in the MS
analysis; however, no peptide with a bound chromo-
phore was detected. When the tryptic digestion mixture
was subjected to LC-MS analysis, the inspection of the
LC trace (chromatographic separation precedes MS
identification) revealed three peaks with similarly strong
absorptions at k

max
¼ 370 and 680 nm (elution times
17.03 min and, for the double peak, 17.72 min), indicat-
ive of the presence of a peptide with a bound chromo-
phore (Fig. 3). None of these peaks matched the
retention time of a free chromophore control sample.
Subsequently, one of these peaks was identified by
MS analysis as the above-mentioned putative chromo-
peptide, although without its chromophore. We fur-
thermore observed that the free chromophore is
not detected by MS analysis; thus, we conclude that
the bound ⁄ incorporated BV IXa molecule remains
attached to the peptide during the tryptic digest and the
LC, but is apparently lost during the conditions of MS
analysis.
Light-induced autophosphorylation and
transphosphorylation of CphBcy
As previously reported for the heterologously expressed
CphB [17], the homologously expressed CphBcy was
280 nm
17.03
17.72
19.13
100
%
0
100
%
0
250 300 350 400 450 500 550 600 650 700 750 800

nm
15.00
CphBcy peptide at 17.750 min
diode array spectrum
280
375
688
15.50 16.00 16.50 17.00 17.50 18.00 18.50 19.00 19.50 20.00 20.50 21.00
Time (min)
680 nm
Fig. 3. MS identification of chromopeptide
from CphBcy after tryptic digestion and
HPLC separation.
B. Quest et al. Homologously expressed bacteriophytochrome
FEBS Journal 274 (2007) 2088–2098 ª 2007 The Authors Journal compilation ª 2007 FEBS 2091
subjected to light-induced autophosphorylation and
phosphotransfer to its cognate response regulator
RcpB. Phosphorylation of CphBcy, after it had been
converted into the P
r
or the P
fr
form and then incuba-
ted in the dark with ATP, took place relatively slowly
and was complete after 40–60 min, when the auto-
phosphorylation reached a plateau (Fig. 4, left). The
kinase activity of the P
r
form of CphBcy was clearly
stronger than the activity of the P

fr
form, which
reached, maximally, 20% of that of the P
r
form. Tak-
ing into account the maximal conversion of P
r
into P
fr
of  70%, due to the partial overlap of their absorp-
tion spectra, it is concluded that the P
r
form is selec-
tively active in CphBcy, and that the residual kinase
activity of the P
fr
form can be ascribed to the amount
of P
r
left in the irradiation mixture. When the response
regulator RcpB was added to the maximally phosphory-
lated CphBcy, a nearly immediate phosphate transfer
took place (Fig. 4, right). The transphosphorylation
reaction driven from the P
r
form of CphBcy was twice
as high as the transphosphorylation driven from the
P
fr
form of CphBcy, indicating that both the autophos-

phorylation and the transphosphorylation reactions
are P
r
-dependent processes.
Heterologously expressed mutated CphB
The recently identified BphPs from A. tumefaciens,
Agp1 [4,7] and from D. radiodurans, DrBphP [3,11],
were reported to carry BV as chromophore, covalently
bound to an N-terminally located cysteine (position 20
in Agp1, and position 24 in DrBphP). We investigated
a putative role of this amino acid in the chromophore-
binding capacity of CphB, which also carries an N-ter-
minally located cysteine mutated into a serine (C24S).
This in vitro expressed mutated protein, when incuba-
ted with BV, showed identical absorption properties to
the wild-type CphBm (spectra not shown), indicating
that this position is of no importance for the forma-
tion of the CphB chromoprotein.
Inspection of phytochrome sequences reveals,
besides the presence of a chromophore-binding cys-
teine residue in the GAF domain, a highly conserved
histidine, directly after the canonical chromophore-
binding position. This residue, H267 in CphB, was
mutated into alanine (H267A). After the addition of
PCB to the heterologously expressed, purified apopro-
tein CphB-H267A, no photochemically active bacterio-
phytochrome was obtained (Fig. 5). However, a
slightly visible shoulder at around 700 nm indicates a
very weak interaction of PCB with CphBm-H267A
(Fig. 5, inset). Upon assembly with BV in the dark,

the broad unstructured absorption band of free chro-
mophore (BV and t
0
in Fig. 6) slowly converted into
a structured P
r
-like absorption band around 700 nm
within 36 min. This absorption was lost upon red
light illumination (Fig. 6), and could not be restored
either by illumination with far-red light or by pro-
longed incubation in the dark (data not shown).
Thus, we conclude that the histidine residue is of
utmost importance for chromophore incorporation
and the maintenance of the spectral properties of
CphB.
Fig. 5. CphBm H267A assembled with a 2.5 molar excess of PCB
and PCB control sample. Inset: Zoom of the region 625–775 nm.
The arrow highlights the observed shoulder of the initial dark-
assembled PCB adduct.
A
B
Fig. 4. Autophosphorylation of CphBcy and transphosphorylation to
its cognate response regulator RcpB. (A) Kinetics of autophosphory-
lation (left) and the corresponding blot (right). The arrow indicates
the addition of RcpB to the autophosphorylation reaction. (B) Kinet-
ics of transphosphorylation from CphBcy to RcpB (left) and the cor-
responding blot (right).
Homologously expressed bacteriophytochrome B. Quest et al.
2092 FEBS Journal 274 (2007) 2088–2098 ª 2007 The Authors Journal compilation ª 2007 FEBS
Discussion

The identification of phytochrome-like photoreceptors
(BphPs) in many bacterial and cyanobacterial species
has not only extended the occurrence of bilin-based
light perception into the prokaryote kingdom, but
has also shed light on the many stimuli of the two-
component signal transduction pathways. The finding
of genes encoding BphPs with strong sequence simi-
larities to phytochromes, but without the covalently
binding cysteine in the GAF domain [3], raised the
question of whether a different type of chromophore
and ⁄ or a different binding mechanism occurred in
these proteins. Whereas for D. radiodurans and
A. tumefaciens, covalent attachment of BV via its
3¢-position has been confirmed, CphB from Calothrix
appears to be an exception to all other phytochromes
described so far. Although it shows all the features
of an interaction with BV, i.e. the lack of the canon-
ical cysteine and the presence of an alternative cys-
teine residue within the first 30 amino acids at its
N-terminus, noncovalent binding was proposed on
the basis of competition between PCB and BV [18].
In fact, the data on the C24S mutant, presented here,
demonstrate that the overall shape of the protein
cavity is already sufficient to incorporate a tetrapyrrole
and to allow photochemistry. Because, for heterolo-
gously expressed CphB, binding of both PCB and
BV IXa has been reported [10], the nature of the
native chromophore incorporated by the cyanobacte-
rial cell was addressed in this work. Up to now,
BphPs employing BV IXa as a chromophore have

been exclusively found in bacteria with a heme oxyg-
enase gene as the only enzyme of chromophore syn-
thesis, as reported for Bph1 from D. radiodurans
[11] and Agp1 from A. tumefaciens [12]. Thus, the
identification of the native CphB chromophore was
of particular interest, as Calothrix generates PCB (as
a reduction product of BV IXa) in large quantities to
equip cells with their light antennae, the phycobili-
somes.
The expression ⁄ purification of CphB from F. diplo-
siphon SF33 yielded a chromoprotein (CphBcy) with
spectral properties virtually indistinguishable from
those of the heterologously expressed, BV IXa-assem-
bled protein. Although the peptide covering the chro-
mophore-binding region lost the chromophore during
the MS analysis, the assignment of BV IXa as a
chromophore is straightforward. The first line of evi-
dence arises from the detection of a chromopeptide
in the HPLC separation that matches the spectral
properties of a peptide-attached tetrapyrrole (in addi-
tion, the MS analysis of this peak revealed the expec-
ted molecular mass for the peptide containing the
putative chromophore-binding site; the finding of
more than one peptide with chromophore absorption
might be due to incomplete digestion or mechanical
cleavage of peptide bonds). The second line of evi-
dence arises from the high affinity of CphB for BV.
In contrast to the CphBm–PCB adduct, which relea-
ses the chromophore during purification, no loss of
chromophore was detected for CphBcy; however,

chromophore exchange (BV versus PCB and vice
versa) has been shown to be possible [18]. Further-
more, the tight interaction between BV IXa and apo-
CphBcy, allowing Zn-mediated fluorescence (which is
not seen with the CphB–PCB adduct), and the stabil-
ity of the BV adduct against an excess of PCB, are
both indicative of the fact that PCB cannot be the
chromophore of CphBcy. Accordingly, we recently
showed that BV is able to actively replace PCB in
the binding pocket of CphB [18]. As an additional
argument, the absorption properties of CphBcy match
the spectra of the heterologously expressed protein
assembled with BV, not only in the position of
the absorption maxima, but also in the shape of
the P
r
and P
fr
forms. Slight differences in the
positions of the absorption maxima of homologously
versus heterologously expressed BphPs like those
observed with CphBcy (maximum variations of 2 nm
were observed) were also reported for Cph1 from
Synechocystis [19].
In particular, the positions of the absorption max-
ima provide a clear indication of the type of chromo-
phore–protein interaction, when we take into account
that covalent binding of a 3-ethylidene-substituted
tetrapyrrole (such as PCB) leads to the loss of one
double bond (3–3¢) due to the formation of a thio-

ether linkage to the protein. This effect has recently
Fig. 6. Assembly kinetics and subsequent red light illumination of
CphBm H267A assembled with a 2.5 molar excess of BV and BV
control sample.
B. Quest et al. Homologously expressed bacteriophytochrome
FEBS Journal 274 (2007) 2088–2098 ª 2007 The Authors Journal compilation ª 2007 FEBS 2093
been demonstrated by comparing the absorption max-
ima of the noncovalently bound PCB adduct of CphB
(k
max
: 686 and 734 nm for P
r
and P
fr
, respectively
[10]) with those of the L266C mutant of CphB that
binds PCB covalently (k
max
: 656 and 702 nm), and
with those of the BV IXa adduct of CphB (702 and
754 nm). This mutation (L266C), which enables cova-
lent binding of PCB with removal of the 3–3¢ double
bond in the chromophore, is sufficient to convert the
binding mode of CphB into that of Cph1 or CphA
(cf. k
max
of CphA: 663 and 710 nm for P
r
and P
fr

,
respectively). Moreover, the spectral shift of the
L266C mutant is only observed when PCB is used
for the in vitro assembly, and not in the case of BV,
which retains practically unchanged absorption max-
ima, irrespective of whether the wild-type or the
mutated apo-protein is used [18]. Also, in BV-binding
proteins a double bond (3¢)3¢ of the vinyl group) is
lost during covalent bond formation, and this should
also lead to a less red-shifted absorption than
observed. This unexpected result, however, is pro-
posed to be due to a rearrangement of double bonds
in BV upon covalent binding, in accordance with a
more detailed inspection of the D. radiodurans BphP
crystal structure (K. Forest, personal communication).
Such a rearrangement (Fig. 7) changes the hybridiza-
tion of C
2
into sp
3
in accordance with the electron
density of the crystal structure, and converts the
A-ring of bound BV into a PCB-like structure, now
with an ethylidene substituent. In addition, this type
of binding is reversible, explaining the observation
that a bound BV can be expelled from the binding
site by an excess of PCB [18].
The ability of CphB to incorporate BV noncovalently
(C24S mutant) places it between these two classes of
phytochromes, and the mutation demonstrates that

C24 is not necessary for the formation of the photo-
receptor complex, as has been shown by us for other
phytochromes [28]. An inspection of the three-dimen-
sional structure of D. radiodurans does not reveal any
other appropriately located cysteine that would allow a
similar conformation of a bound chromophore. The
observed preferred binding of BV to CphB, although
PCB is synthesized in the cyanobacterial cell in large
quantities, is an interesting ability of Calothrix that
allows adjustment of the spectral sensitivity through
the use of two related photoreceptors. This selection,
of course, can only be employed on the basis of an
additional photoreceptor (CphB) that binds BV and
provides a bathochromically shifted absorption. It
should be noted that although the demonstration of
light-induced phosphorylation of both phytochromes
from Calothrix, which differ in their absorption max-
ima by  50 nm, represents a simple color discrimin-
ation system, there is, as yet, no evidence for a
physiologic role.
The loss of chromophore incorporation upon muta-
tion of H267 reveals a very important role for this
residue for both PCB-binding and BV-binding
phytochromes. Inspection of the crystal structure of
D. radiodurans phytochrome indicates interactions with
the chromophore (via hydrogen bonding to the pro-
pionate group of ring C), which can be assumed to have
a stabilizing effect on the extended conformation that
the chromophore adopts in the binding site (in contrast
to the helically coiled conformation in organic solvents

[29]). This mutation has been reported to prevent chro-
mophore binding in Bph1 [3], in oat phytochrome [30],
and in CphB (this study) and CphA (B. Quest, unpub-
lished results). In addition, this histidine might also be
important for the assembly process itself, as has been
demonstrated by addition of imidazole to the incuba-
tion mixture [18]. On the other hand, recent studies
have shown that in Cph1 also, a glutamine residue at
that position is sufficient for the spectral properties of
this cyanobacterial phytochrome [31]; these authors
demonstrate, moreover, that a major contribution of
this histidine (260 in Cph1) is the stabilization of the
protonated state of the chromophore (H260Q shows
strong pH dependence in its absorption properties).
The homologously expressed protein showed an even
more pronounced phosphorylation capability origin-
ating from the P
r
form than the heterologously
expressed protein, and reacted in a precise manner
with its cognate response regulator, as shown by the
crystal structures of the response regulators RcpA and
RcpB [32]. The physiologic relevance of this signal
transduction pathway, which leads to phosphorylation
of the response regulator under conditions of either
continuous far-red light irradiation or continuous
Fig. 7. Proposed double bond rearrange-
ment during covalent binding of BV. Note
that this binding is reversible.
Homologously expressed bacteriophytochrome B. Quest et al.

2094 FEBS Journal 274 (2007) 2088–2098 ª 2007 The Authors Journal compilation ª 2007 FEBS
darkness after assembly of CphB in the dark, will be
the subject of future work.
Experimental procedures
Cyanobacterial strains and culture media
Fremyella diplosiphon strain SF33 is a hormogonium-defici-
ent mutant of F. diplosiphon UTEX 481 (also designated
Calothrix PCC7601) [20,21] that grows as short filaments
and is easier to use for genetic studies than the wild-type
strain. Cyanobacteria were routinely maintained in liquid
medium BG-11 [20] or on solid medium GN (BG-11 med-
ium containing 0.38 mm Na
2
CO
3
), at 30 °C under a photo-
synthetic photon flux density of 6–7 lEÆm
)2
Æs
)1
for
conditions without a gas supply, and 20–35 lEÆm
)2
Æs
)1
for
growth with a gas supply provided by Sylvania (Osram,
Munich, Germany) GRO-Lux 18 W fluorescent lamps.
Cloning
cphB was amplified from previously described constructs [10]

using the following primers: oBQ35, 5¢-
CATATGACGAA
TTGCCATCGCGAACC-3¢; and oBQ36, 5¢-
GGATCCTTA
TTTGACCTCCTGCAATGTGAAATAG-3¢ (restriction sites
are underlined, and start and stop codons are given in bold).
The PCR product was then cloned in vector pET28a(+)
(Novagen ⁄ Merck, Darmstadt, Germany) between the NdeI
and BamHI sites located downstream of the nucleotide
sequence providing the N-terminal His-tag sequence. The T7
promoter, present in the vector, was replaced by a tac pro-
moter that was amplified from vector pGEX-4T-1 (Pharma-
cia Biotech ⁄ GE Freiburg, Germany) using the following
primers: oBQ60, 5¢-
GGGCCCTGCACGGTGCACCAA
TGC-3¢; and oBQ61, 5¢-
CCATGGATACTGTTTCCTGTG
TGA-3¢. The resulting PCR fragment was cloned between
the ApaI and NcoI sites, thereby removing half of the 5¢ nuc-
leotide sequence of the lacI repressor gene of pET28a(+).
After removal of the BamHI site of this construct by diges-
tion, Klenow fill-in and religation, the DNA fragment carry-
ing the tac promoter, the cloned gene and the T7 terminator
was subcloned into the single BamHI site of the vector
pPL2.8 using the following primers: oBQ88, 5¢-CG
GGA
TCCTGCACGGTGCACCAATGCTTC-3¢; and oBQ89,
5¢-AC
GGATCCAAAAAACCCCTCAAGACCCG-3¢. pPL2.8
is a derivative of pPL2.7 [22], generated by EcoRI digestion,

Klenow fill-in, and religation. The resulting construct was
termed pPL9b. CphBm was amplified from genomic DNA
from PCC7601 using primers oBQ146 (5¢-TATA
CCATGG
GCTTAAGTCCTGAAAATTCTCCAG-3¢) and oBQ147
(5¢-AAA
CTCGAGCCGGCCCTCAATTTTGACCTCCTGC
AATGTGAAATAGAACG-3¢), and cloned between the
NcoI and XhoI sites into pET28a(+), providing a His-tag in
the C-terminus of the recombinant protein.
Generation of site-directed mutations
The C24S and H267A mutations were generated with the
QuickChange site-directed mutagenesis kit (Stratagene-
Europe, Amsterdam, the Netherlands), according to the
instructions of the manufacturer. Generation of the C24S
mutant was performed with the following primers: CphBm
C24S-sen, 5¢-GAGGTGGACTTGACGAAT
TCAGATCGCG
AACCAATTCA C-3¢, and CphBm C24S-antisense 5¢-GTGAA
TTGGTTCGCGATC
TGAATTCGTCAAGTCCACCTC-3¢.
The primers used for H267A were: oBQ144-2, 5¢-CACT
CGGTACTCCGCAGCGTTTCGCCGTTA
RCCATTGAA
TATTTGCACAATATGG-3¢ (R ¼ purine); and oBQ145-2,
5¢-CCATATTGTGCAAATATTCAATG
GYTAACGGCG
AAACGCTGCGGAGTACCGAGTG-3¢ (Y ¼ pyrimidine).
The differences from the wild-type sequence are indicated.
The mutations were identified and verified by sequencing.

Conjugal transfer of DNA to cyanobacteria
DNA was transferred to F. diplosiphon cells by means of a
triparental conjugation system as previously described [23],
with minor changes. The cargo strain containing the plasmid
of interest was Epicurian coli XL1 blue MR (Stratagene-
Europe); the conjugal strain, bearing the RP4 plasmid [24]
necessary for conjugal transfer, was Escherichia coli J53. Mil-
lipore HATF nitrocellulose filters were used for conjugation,
and the cell mixtures were spotted in different cyanobac-
teria ⁄ conjugal strain ⁄ cargo strain ratios. The filters were
incubated under a photosynthetic photon flux density of
6–7 lEÆm
)2
Æs
)1
for 48 h on GN plates supplemented with
5% (v ⁄ v) LB medium, and subsequently transferred to GN
plates containing 25 lgÆmL
)1
neomycin.
Homologous expression
Cyanobacterial cells carrying plasmid pPL9b were grown
in BG-11 medium [20] supplemented with 25 lgÆmL
)1
neo-
mycin. Phosphate buffer (5 mm, pH 7.4) was added to the
fermenter cultivation (Braun, Melsungen, Germany,
880 137 ⁄ 1, culture volume of 12 L). All cyanobacterial cul-
tures were incubated at 30 °C under a photosynthetic pho-
ton flux density between 20 and 35 lEÆm

)2
Æs
)1
(GROLUX
F18W ⁄ GRO fluorescent white light tubes, Osram). For the
homologous expression of CphB in F. diplosiphon
(CphBcy), the fermenter was inoculated with a 1 L precul-
ture (D
750
 0.8). The doubling time was approximately
20 h. Cells were harvested at a D
750
of around 0.8 by cen-
trifugation (6000 g, 10 min, 4 °C, Avanti centrifuge with
JA10 rotor, Beckman-Coulter, Fullerton, CA, USA). Prior
to cell breakage by a French Pressure Cell (Aminco,
1100 lbÆin
)2
) in NaCl ⁄ Tris buffer (supplied with protease
inhibitor cocktail, EDTA-free, Boehringer, Mannheim,
Germany), the cyanobacterial cells were washed several
B. Quest et al. Homologously expressed bacteriophytochrome
FEBS Journal 274 (2007) 2088–2098 ª 2007 The Authors Journal compilation ª 2007 FEBS 2095
times with BG-11 to remove residual E. coli cells from the
conjugation mixture.
Heterologous expression
The heterologous expression of CphBm and RcpB in
BL21DE3 RIL (Stratagene-Europe) was carried out as pre-
viously described [18]. In brief, the expression was carried
out in TB medium at 18–20 °C for 16–20 h after induction

with 0.4 mm isopropyl-thio-b-d-galactoside. The amount of
soluble photoactive CphBm was thereby increased 30-fold
in comparison to the expression system described previously
[10]. Typical yields reached approximately 6 mg of purified
protein per liter of culture.
Protein purification
After cell breakage, cellular debris was removed by ultracen-
trifugation (150 000 g, 1 h, 4 °C, LX80 XP centrifuge with
Ti60 rotor, Beckman-Coulter). For cyanobacterial prepara-
tions, one spatula of streptomycin sulfate was added to the
supernatant prior to the centrifugation to remove chloro-
phyll-containing microvesicles. Centrifugation with strepto-
mycin sulfate was repeated up to three times. Holo-CphBcy
and Apo-CphBm were purified with Ni–nitrilotriacetic acid
superflow affinity resin (Qiagen, Hilden, Germany) and sub-
sequent gel filtration on a 16 ⁄ 60 Superdex 200 preparative
grade column (Pharmacia ⁄ GE, Freiburg, Germany), using
A
¨
kta FPLC systems. RcpB was purified to homogeneity by
affinity purification on Ni-nitrilotriacetic acid superflow
resins and gel filtration on a 26 ⁄ 60 Superdex 75 preparative
grade column. Proteins were analyzed by SDS ⁄ PAGE fol-
lowing the protocol of Scha
¨
gger & Jagow [25], and stored at
4 °C in NaCl ⁄ Tris buffer (50 mm Tris ⁄ HCl, pH 8.0, 150 mm
NaCl), including 1 mm dithiothreitol, until further use.
Visualization of chromoproteins via
Zn-fluorescence

Zn-gel electrophoresis was performed as previously des-
cribed [26]. In brief, 1 mm Zn acetate was added to all solu-
tions of a standard SDS ⁄ PAGE. The gels were placed on a
UV-transilluminator, and images were recorded with integ-
ration times between 2 and 4 s.
Assembly of recombinant chromoproteins,
determination of absorption and difference
absorption spectra, and measurement of P
fr
stability
For the assembly of heterologously expressed CphBm in
the wild-type, mutated or truncated form, with BV or
PCB, the apoprotein was incubated in the dark with a
2.5-fold molar excess of BV or PCB, respectively. The
molar extinction coefficients of the chromophores in
NaCl ⁄ Tris buffer (BV e
674
¼ 13 000 m
)1
Æcm
)1
, PCB e
610
¼
16 000 m
)1
Æcm
)1
) were taken from Lindner et al. [27]. The
fully assembled chromoproteins were subjected to repeated

red ⁄ far-red illumination. Interference filters at 636 ± 9 nm
and 730 ± 12 nm were used to generate the P
fr
and the P
r
forms of the PCB adducts, respectively, and for the BV
adducts and for CphBcy, filters at 680 ± 8 nm and
788 ± 11 nm were used. The probes were illuminated with
the stated light qualities, until no further absorption chan-
ges occurred. Absorption spectra were recorded with a
Shimadzu (Duisburg, Germany) UV-2401 PC spectropho-
tometer. All samples were measured at 15 °C. For the
determination of the thermal stability of the P
fr
form of
CphBcy, the samples were irradiated with a saturating red
light pulse, and the conversion back to P
r
was followed by
UV-visible spectroscopy. Between the successive recordings
of absorption spectra (from 260 to 820 nm), the samples
were protected against the measuring light of the spectro-
photometer. The absence of secondary photochemistry was
confirmed by several consecutive measurements.
Phosphorylation of CphBcy and
transphosphorylation to RcpB
Autophosphorylation and phosphotransfer were carried out
as previously described [17]. In brief, a single reaction con-
tained 3 lg of CphBcy for the autophosphorylation, or
3 lg of CphBcy and 0.75 lg of RcpB for the phosphotrans-

fer reactions. The reactions were carried out in phospho-
transfer buffer containing 50 mm Tris ⁄ HCl (pH 7.8),
50 mm KCl, 1 mm dithiothreitol, 0.5 mm MgCl
2
,10lm
unlabeled ATP, and 0.2 lm [
32
P]ATP[cP] (110 TBqÆmmol
)1
)
(Hartmann Analytik, Braunschweig, Germany). The reac-
tion volume was 15 lL. Reactions were started by the addi-
tion of [
32
P]ATP[cP], and terminated at given time points
by adding 5 lL of SDS stop buffer (250 mm Tris ⁄ HCl,
pH 6.8, 15 mm EDTA, 30% v ⁄ v glycerol, 11% w ⁄ v SDS,
10% v ⁄ v 2-mercaptoethanol, 0.02% w ⁄ v bromophenol
blue) and incubating for 5 min at 50 °C. Phosphotransfer
was initiated by adding 15 lL of the autophosphorylation
reaction mixture to 0.75 lg of RcpB, dissolved in 3 lLof
phosphotransfer buffer without ATP. All reactions were
performed at room temperature. The
32
P-labeled products
were separated by SDS ⁄ PAGE (12.5%, La
¨
mmli) and trans-
ferred to poly(vinylidene difluoride) membranes (Pharma-
cia). The membranes were dried and quantified using a

GS-525 PhosphorImager (Bio-Rad, Munich, Germany).
MALDI-TOF MS
Samples were excised from a Coomassie-stained gel and
washed three times alternately in 50% acetonitrile and
50 mm ammonium bicarbonate. Destained samples were
Homologously expressed bacteriophytochrome B. Quest et al.
2096 FEBS Journal 274 (2007) 2088–2098 ª 2007 The Authors Journal compilation ª 2007 FEBS
processed by incubation at 56 °C in ammonium bicarbon-
ate+10mm dithiothreitol for 45 min followed by incuba-
tion in ammonium bicarbonate + 55 mm iodoacetamide
for 30 min and an initial washing cycle. For tryptic digests
of CphBcy, protein ⁄ protease mixtures (40 : 1, w ⁄ w) were
incubated in NaCl ⁄ Tris + 1 mm CaCl
2
at 37 °C overnight.
Digested samples were analyzed on a Maldi Reflex III
(Bruker-Daltonik, Bremen, Germany).
LC-MS
Digested samples were separated with a Waters (Milford,
MA, USA) Symmetry C18 column (5 lm; 0.32 · 150 mm)
on a Waters CAP-LC, supplied with a photodiode array
detector (eluent A, 0.025% v ⁄ v trifluoroacetic acid in H
2
O;
eluent B, 0.02% v ⁄ v trifluoroacetic acid in acetonitrile; gra-
dients, 5 min 5% v ⁄ v B, from 5% to 45% v ⁄ v B in 25 min,
from 45% to 90% v ⁄ v B in 3 min, 7 min 90% B). The sam-
ples were transferred online for ESI-MS-MS analysis.
Acknowledgements
We thank Dr Frank Siedler and Bea Scheffer (MPI

Biochemie, Martinsried) for technical assistance in the
MS experiments. This work was partially supported by
the SFB533 and by a grant of the Fonds der Chemis-
chen Industrie to B. Quest.
References
1 Scha
¨
fer E & Nagy F, eds. (2006) Photomorphogenesis in
Plants and Bacteria, 3rd edn. Springer, Dordrecht.
2 Hughes J, Mittmann F, Wilde A, Ga
¨
rtner W, Bo
¨
rner T,
Hartmann E & Lamparter T (1997) A prokaryotic
phytochrome. Nature 386, 663.
3 Davis SJ, Vener AV & Vierstra RD (1999) Bacteriophy-
tochromes: phytochrome-like photoreceptors from non-
photosynthetic eubacteria. Science 286, 2517–2520.
4 Lamparter T, Michael N, Caspani O, Miyata T, Shirai
K & Inomata K (2003) Biliverdin binds covalently to
Agrobacterium phytochrome Agp1 via its ring a vinyl
side chain. J Biol Chem 278, 33786–33792.
5 Wurgler-Murphy SM & Saito H (1997) Two-component
signal transducers and MAPK cascades. Trends Biochem
Sci 22, 172–176.
6 Montgomery BL & Lagarias JC (2002) Phytochrome
ancestry: sensors of bilins and light. Trends Plant Sci 7,
357–366.
7 Lamparter T, Mittmann F, Ga

¨
rtner W, Bo
¨
rner T,
Hartmann E & Hughes J (1997) Characterization of
recombinant phytochrome from the cyanobacterium
Synechocystis. Proc Natl Acad Sci USA 94, 11792–11797.
8 Remberg A, Lindner I, Lamparter T, Hughes J, Kneip
C, Hildebrandt P, Braslavsky SE, Ga
¨
rtner W &
Schaffner K (1997) Raman spectroscopic and light-
induced kinetic characterization of a recombinant
phytochrome of the cyanobacterium Synechocystis.
Biochemistry 36, 13389–13395.
9 Herdman M, Coursin T, Rippka R, Houmard J &
Tandeau de Marsac N (2000) A new appraisal of the
prokaryotic origin of eukaryotic phytochromes. J Mol
Evol 51, 205–213.
10 Jorissen HJMM, Quest B, Remberg A, Coursin T,
Braslavsky SE, Schaffner K, de Marsac N & Ga
¨
rtner W
(2002) Two independent, light-sensing two-component
systems in a filamentous cyanobacterium. Eur J Biochem
269, 2662–2671.
11 Bhoo SH, Davis SJ, Walker JM, Karniol B & Vierstra
RD (2001) Bacteriophytochromes are photochromic his-
tidine kinases using a biliverdin chromophore. Nature
414, 776–779.

12 Lamparter T, Michael N, Mittmann F & Esteban B
(2002) Phytochrome from Agrobacterium tumefaciens
has unusual spectral properties and reveals an N-ter-
minal chromophore attachment site. Proc Natl Acad Sci
USA 99, 11628–11633.
13 Karniol B & Vierstra RD (2003) The pair of bacterio-
phytochromes from Agrobacterium tumefaciens are his-
tidine kinases with opposing photobiological properties.
Proc Natl Acad Sci USA 100, 2807–2812.
14 Karniol B, Wagner JR, Walker JM & Vierstra RD
(2005) Phylogenetic analysis of the phytochrome super-
family reveals distinct microbial subfamilies of photore-
ceptors. Biochem J
392, 103–116.
15 Wagner JR, Brunzelle JS, Forest KT & Vierstra RD
(2005) A light-sensing knot revealed by the structure of
the chromophore-binding domain of phytochrome.
Nature 438, 325–331.
16 Yeh K-C, Wu S-H, Murphy JT & Lagarias JC (1997) A
cyanobacterial phytochrome two-component light sen-
sory system. Science 277, 1505–1508.
17 Hu
¨
bschmann T, Jorissen HJMM, Bo
¨
rner T, Ga
¨
rtner W
& de Marsac N (2001) Phosphorylation of proteins in
the light-dependent signalling pathway of a filamentous

cyanobacterium. Eur J Biochem 268, 3383–3389.
18 Quest B & Ga
¨
rtner W (2004) Chromophore selectivity in
bacterial phytochromes ) dissecting the process of chro-
mophore attachment. Eur J Biochem 271, 1117–1126.
19 Hu
¨
bschmann T, Bo
¨
rner T, Hartmann E & Lamparter T
(2001) Characterization of the Cph1 holo-phytochrome
from Synechocystis sp PCC 6803. Eur J Biochem 268,
2055–2063.
20 Rippka R, Deruelles J, Waterbury JB, Herdman M &
Stanier RY (1979) Generic assignments, strain histories
and properties of pure cultures of cyanobacteria. J Gen
Microbiol 111, 1–61.
21 Cobley JG, Zerweck E, Reyes R, Mody A, Seludo-Unson
JR, Jaeger H, Weerasuriya S & Navankasattusas S (1993)
B. Quest et al. Homologously expressed bacteriophytochrome
FEBS Journal 274 (2007) 2088–2098 ª 2007 The Authors Journal compilation ª 2007 FEBS 2097
Construction of shuttle plasmids which can be effectively
mobilized from Escherichia coli into the chromatically
adapting cyanobacterium, Fremyella diplosiphon.
Plasmid 30, 90–105.
22 Kehoe DM & Grossman AR (1998) Use of molecular
genetics to investigate complementary chromatic adap-
tation: advances in transformation and complementa-
tion. Methods Enzymol 297, 279–290.

23 Ehai J & Wolk CP (1988) Conjugal transfer of DNA to
cyanobacteria. Methods Enzymol 167, 747–754.
24 Thomas CM & Smith CA (1987) Incompatibility group
P plasmids: genetics, evolution, and use in genetic
manipulation. Annu Rev Microbiol 41, 77–101.
25 Scha
¨
gger H & von Jagow G (1987) Tricine-sodium
dodecyl sulfate-polyacrylamide gel electrophoresis for
the separation of proteins in the range from 1 to 100
kDa. Anal Biochem 166 , 368–379.
26 Berkelman TR & Lagarias JC (1986) Visualization of
bilin-linked peptides and proteins in polyacrylamide
gels. Anal Biochem 156, 194–201.
27 Lindner I, Knipp B, Braslavsky SE, Ga
¨
rtner W &
Schaffner K (1998) A novel chromophore selectively
modifies the spectral properties of one of the two stable
states of the plant photoreceptor phytochrome. Angew
Chem Int Ed Engl 37, 1843–1846.
28 Jorissen HJMM, Quest B, Lindner I, de Marsac N &
Ga
¨
rtner W (2002) Phytochromes with noncovalently
bound chromophores: the ability of apophytochromes
to direct tetrapyrrole photoisomerization. Photochem
Photobiol 75, 554–559.
29 Knipp B, Mu
¨

ller M, Metzler-Nolte N, Balaban TS,
Braslavsky SE & Schaffner K (1998) NMR verification
of helical conformations of phycocyanobilin in organic
solvents. Helv Chim Acta 81, 881–888.
30 Remberg A, Schmidt P, Braslavsky SE, Ga
¨
rtner W &
Schaffner K (1999) Differential effects of mutations in
the chromophore pocket of recombinant phytochrome
on chromoprotein assembly and P
r
-to-P
fr
photoconver-
sion. Eur J Biochem 266, 201–208.
31 Hahn J, Strauss HM, Landgraf FT, Gimenez HF,
Lochnit G, Schmieder P & Hughes J (2006) Probing
protein–chromophore interactions in Cph1 phytochrome
by mutagenesis. FEBS J 273, 1415–1429.
32 Benda C, Scheufler C, de Marsac N & Ga
¨
rtner W
(2004) Crystal structures of two cyanobacterial
response regulators in apo- and phosphorylated form
reveal a novel dimerization motif of phytochrome-
associated response regulators. Biophys J 87, 476–
487.
33 Matysik J, Hildebrandt P, Schlamann W, Braslavsky SE
& Schaffner K (1995) Fourier-transform resonance
Raman spectroscopy of intermediates of the phyto-

chrome photocycle. Biochemistry 34, 10497–10507.
Homologously expressed bacteriophytochrome B. Quest et al.
2098 FEBS Journal 274 (2007) 2088–2098 ª 2007 The Authors Journal compilation ª 2007 FEBS