Báo cáo khoa học: Stage-specific expression of Caenorhabditis elegans ribonuclease H1 enzymes with different substrate specificities and bivalent cation requirements ppt

Stage-specific expression of Caenorhabditis elegans
ribonuclease H1 enzymes with different substrate
specificities and bivalent cation requirements
Hiromi Kochiwa
1,2
, Mitsuhiro Itaya
1,3
, Masaru Tomita
1,4
and Akio Kanai
1
1 Institute for Advanced Biosciences, Keio University, Tsuruoka, Japan
2 Graduate School of Media and Governance, Keio University, Fujisawa, Japan
3 Mitsubishi Kagaku Institute of Life Sciences, Machida, Japan
4 Department of Environmental Information, Keio University, Fujisawa, Japan
An enzyme that specifically degrades the RNA strand
of RNA–DNA hybrids was first characterized from
extracts of calf thymus tissue [1] and was named ribo-
nuclease H (RNase H; EC 3.1.26.4) [2]. This protein
has also been identified in viruses [3], bacteria [4,5],
and archaea [6,7], indicating the essential nature of its
roles in cellular metabolism. Prokaryotic RNase H
enzymes are divided by sequence similarity into three
groups: HI, HII, and HIII. On the other hand, there
are two types of eukaryotic RNase H: RNase H1 is
homologous to prokaryotic RNase HI, and RNase H2
is homologous to prokaryotic RNase HII. There is a
distinct difference between the two types of eukaryotic
RNase H in terms of the bivalent metal ion cofactor.
Eukaryotic RNase H1 requires Mg
2+

ions as a cofac-
tor, cannot use Mn
2+
ions as a cofactor [8], and is
inhibited by the addition of Mn
2+
ions [9,10]. In con-
trast, Escherichia coli RNase HI requires both Mg
2+
and Mn
2+
ions for its activity [11] and contains one
Mg
2+
-binding site or two Mn
2+
-binding sites [12,13].
Eukaryotic RNase H2 is activated by either Mn
2+
or
Mg
2+
ions, but E. coli RNase HII is activated only in
the presence of Mn
2+
ions [14]. Phylogenetic analysis
suggests that Mn
2+
-dependent RNase H is universally
present from bacteria to eukaryotes [15].

The primary structures of prokaryotic RNase HI
and eukaryotic RNase H1 also differ from each other.
Most eukaryotic RNase H1 enzymes consist of a non-
RNase H domain at the N-terminus and an RNase H
domain at the C-terminus, in contrast with prokaryotic
RNase HI, which contains only the RNase H domain.
This eukaryotic non-RNase H domain was first
Keywords
alternative splicing; C. elegans;
development; metal ion; RNase H1
Correspondence
A. Kanai, Institute for Advanced
Biosciences, Keio University, Tsuruoka 997-
0017, Japan
Fax: +81 235 29 0525
Tel: +81 235 29 0524
E-mail:
(Received 14 October 2005, revised 26
November 2005, accepted 1 December
2005)
doi:10.1111/j.1742-4658.2005.05082.x
Ribonuclease H1 (RNase H1) is a widespread enzyme found in a range of
organisms from viruses to humans. It is capable of degrading the RNA
moiety of DNA–RNA hybrids and requires a bivalent ion for activity. In
contrast with most eukaryotes, which have one gene encoding RNase H1,
the activity of which depends on Mg
2+
ions, Caenorhabditis elegans has four
RNase H1-related genes, and one of them has an isoform produced by alter-
native splicing. However, little is known about the enzymatic features of the

proteins encoded by these genes. To determine the differences between these
enzymes, we compared the expression patterns of each RNase H1-related
gene throughout the development of the nematode and the RNase H activit-
ies of their recombinant proteins. We found gene-specific expression patterns
and different enzymatic features. In particular, besides the enzyme that
displays the highest activity in the presence of Mg
2+
ions, C. elegans has
another enzyme that shows preference for Mn
2+
ion as a cofactor. We char-
acterized this Mn
2+
-dependent RNase H1 for the first time in eukaryotes.
These results suggest that there are at least two types of RNase H1 in C. ele-
gans depending on the developmental stage of the organism.
Abbreviations
dsRHbd, double-stranded RNA and RNA–DNA hybrid-binding domain; Ec-RNHI, Escherichia coli ribonuclease HI; Pf-RNHII, Pyrococcus
furiosus ribonuclease HII; PTC, premature termination codon, RNase H, ribonuclease H.
420 FEBS Journal 273 (2006) 420–429 ª 2005 The Authors Journal compilation ª 2005 FEBS
identified in the N-terminal portion of Crithidia fas-
ciculata RNase H1 in relation to the conserved domain
in caulimovirus ORF VI involved in translational regu-
lation [16]. The non-RNase H domain binds not only
to dsRNA but also to RNA–DNA hybrids in vitro [17]
and has been defined as a dsRNA and RNA–DNA
hybrid-binding domain (dsRHbd) [18]. The function
of the dsRHbd in eukaryotic RNase H1 has also been
discussed. The dsRNA binding and RNase H activity
of Saccharomyces cerevisiae RNase H1 depends on the

concentration of Mg
2+
ions and the existence of
dsRNA, and the activity of mutant enzymes lacking
dsRHbd is not as dependent on these conditions [17].
In contrast, investigation of human RNase H1 by site-
directed mutagenesis has suggested that the dsRHbd is
required not for RNase H activity but to place RN-
ase H in the appropriate position on the RNA primer
during DNA replication [19]. However, because the
dsRHbd in mouse RNase H1 contributes to RNase H
processivity through formation of a dimer complex
[18], there is controversy about whether the dsRHbd is
in fact necessary for RNase H activity.
A single RNase H1-related gene has been identified in
the genomes of most eukaryotes studied, and RNase H1
enzymes of Drosophila and mice are essential for embry-
ogenesis [20,21]. Unlike in other eukaryotes, four
RNase H1-encoding genes have been found in the
Caenorhabditis elegans genome, and cDNA sequencing
analysis has revealed that one of them has an alternative
splicing variant, resulting in a total of five transcripts
[22]. Of these, one gene encodes an RNase H1 protein
that contains both dsRHbd and RNase H domains, and
its alternatively spliced transcript can be translated into
an RNase H1 protein that lacks a dsRHbd at the N-ter-
minus. We analyzed the expression patterns of the five
transcripts, including the pair of alternative splicing
variants, throughout the development of C. elegans.
Furthermore, we successfully prepared and purified

some recombinant C. elegans RNase H1 enzymes in sol-
uble form without using denaturants such as 6 m urea
or guanidine hydrochloride. This enabled us to compare
the enzymatic features of each RNase H by using an
in vitro reconstitution system that recapitulated the
processing of Okazaki-primer RNA.
Results and Discussion
Primary structures of multiple RNase H1 enzymes
in C. elegans
Four RNase H1-related genes have been identified in
C. elegans, and one of them has been found to have
an alternative splicing isoform [22]. We conducted
cDNA cloning of the transcripts that corresponded to
each gene and confirmed their primary structures inde-
pendently. In accordance with their nomenclature [22],
we represented these four genes as rnh-1.0a, rnh-1.1,
rnh-1.2, and rnh-1.3 and the alternative splicing iso-
form of rnh-1.0a as rnh-1.0b. In contrast with rnh-1.0a,
which encodes a 251-amino-acid protein (Ce-RNH1a),
rnh-1.0b contains a premature termination codon
(PTC) in the alternatively spliced exon. Although cis-
acting nonsense-mediated mRNA decay elements in
C. elegans have yet to be characterized [23], in several
experiments the alternatively spliced transcript that
introduces a PTC is degraded by an mRNA surveil-
lance system in C. elegans [24,25]. On the other hand,
despite the fact that the mRNA for mouse glutamic
acid decarboxylase has a PTC inserted by alternative
splicing, the N-terminal truncated protein has been
shown to be produced from the downstream ORF

in vivo and has been shown to exhibit enzyme activity
[26], suggesting that the mRNA escapes degradation
by nonsense-mediated mRNA decay. Therefore, if rnh-
1.0b also evades the mRNA surveillance system, this
mRNA may produce a 41-amino-acid protein encoded
by the upstream ORF and a 198-amino-acid protein
(Ce-RNH1b) encoded by the downstream ORF.
We defined the C. elegans RNase H1 enzymes enco-
ded by rnh-1.0a, rnh-1.0b, rnh-1.1, rnh-1.2, and rnh-1.3
as Ce-RNH1a, Ce-RNH1b, Ce-RNH1A, Ce-RNH1B,
and Ce-RNH1C, respectively. The domain structures
of these proteins are summarized in Fig. 1. Most
eukaryotic RNase H1 enzymes contain one or two
dsRHbds at the N-terminus and an RNase H domain
at the C-terminus. However, only Ce -RNH1a fits the
typical structure, and the other RNase H1 enzymes (Ce-
RNH1b, Ce-RNH1A, Ce-RNH1B, and Ce-RNH1C)
each contained only one RNase H domain.
Ce-RNH1α
(rnh-1.0α)
Ce-RNH1β
(rnh-1.0β)
Ce-RNH1B
(rnh-1.2)
Ce-RNH1A
(rnh-1.1)
Ce-RNH1C
rnh-1.3
RNH
RNH

RNH
RNH
RNH
dsRHbd
1
1
1
1
1 139
251
198
487
192
Fig. 1. Schematic diagrams of RNase H1-related gene family in
C. elegans. Each domain is indicated as a shaded box. dsRHbd,
dsRNA or RNA–DNA hybrid-binding domain; RNH, RNase H
domain. Each gene name is in parentheses below the protein
name. Numbers above boxes indicate positions of amino acids.
H. Kochiwa et al. Enzymatic characterization of C. elegans RNases H1
FEBS Journal 273 (2006) 420–429 ª 2005 The Authors Journal compilation ª 2005 FEBS 421
RNase H gene expression during C. elegans
development
Although eukaryotic RNase H1 enzymes are thought to
be concerned with several regulatory steps, including
DNA replication, DNA repair, and RNA transcription,
C. elegans, unlike other model organisms, may use the
appropriate RNase H1 for a specific situation. To evalu-
ate this hypothesis, we first conducted RT-PCR analysis
during C. elegans development [larval stages 1–2 (L1–
L2), 2–3 (L2–L3), 3–4 (L3–L4), and 4 to adult (L4–

adult)] to compare the expression patterns of each
RNase H1. RNase H1-related gene expression can be
described as one of three patterns (Fig. 2): (a) expressed
constantly throughout development (rnh-1.0a and rnh-
1.0b); (b) expressed from the L3 to adult stages (rnh-1.1
and rnh-1.3); (c) preferentially expressed in the egg and
adult stages (rnh-1.2). These results suggest that multiple
RNase H1-encoding genes may be regulated differently
throughout C. elegans development.
In particular, because both Ce-RNH1a and Ce-
RNH1A have RNase H activity (see below in detail), it
should be noted that the expression pattern of rnh-1.0a
differed considerably from that of rnh-1.1. This result
raises the possibility that these two proteins have dis-
tinctly different functions because of their production at
different developmental stages. These gene-specific
expression patterns also suggest that rnh-1.2 and rnh-1.3
are not pseudogenes, despite the fact that Ce-RNH1B
and Ce-RNH1C were not detected to have RNase H
activity [22], even though it has been reported that 20%
of all annotated C. elegans genes may be pseudogenes
[27].
The question of why rnh-1.0a and rnh-1.0b had the
same expression pattern required further investigation.
The third exon of rnh-1.0a and rnh-1.0b is alternatively
spliced (Fig. 3A). In C. elegans, the highly conserved
consensus sequence UUUUCAG ⁄ R at the 3¢ splice
sites is recognized by subunits of U2AF in the process
of intron removal [28]. We checked the sequences
around the alternatively spliced sites of rnh-1.0a and

rnh-1.0b and found that the sequences were similar
to each other (AUUUAG ⁄ G and UUUUAG ⁄ A)
(Fig. 3B). Hence, rnh-1.0a and rnh-1.0b have the same
expression pattern because these alternatively spliced
sites may be chosen evenly when the splicing reaction
occurs, suggesting that a specific alternative splicing
factor or an exonic enhancer may not regulate this
alternative splicing for each transcript. At this point it
is not certain whether rnh-1.0b is the result of regula-
ted alternative splicing or of aberrant splicing, because
the mRNA contains a PTC in the alternatively spliced
exon.
Cleavage specificity of C. elegans RNase H1
enzymes on RNA–DNA ⁄ DNA hybrid
In light of the results of the gene expression analysis,
we assumed that the multiple RNase H1 enzymes in
C. elegans had distinct enzymatic characteristics.
Although Arudchandran et al . [22] detected RNase H
activity by a renaturation gel assay, we wanted to
make more detailed comparisons by using purified
soluble enzymes. Therefore, we overexpressed the
recombinant RNase H1 enzymes and purified them to
rnh-1.0α
rnh-1.0β
rnh-1.3
rnh-1.1
rnh-1.2
eft-3
Egg
L1-L2

L2-L3
L3-L4
L4-Adult
RNA(-)
Fig. 2. Expression patterns of RNase H1-related genes during the
developmental stages of C. elegans. RT-PCR was carried out using
gene-specific primers (see Experimental procedures). Negative con-
trol without addition of cDNA template is indicated as RNA (–). eft-3
encoding a translation elongation factor 1-alpha homolog was the
positive control. The same results were obtained in at least two inde-
pendent experiments for each gene.
rnh-1.0α
rnh-1.0β
α
β
A
UGAAAAUUUAGGAGUCAAACGUUGUUUUAGAUUCAAGAAA
αβ
B
Fig. 3. Alternative splicing of rnh-1.0a and rnh-1.0b. (A) Schematic
presentation of alternative splicing. Exons are represented as
boxes, and the characters a and b above the third exons indicate
alternatively spliced sites of rnh-1.0a and rnh-1.0b. (B) Premature
mRNA sequences around alternatively spliced sites. The underlined
sequences labeled with a or b correspond to the sequences around
the 3¢ exon–intron junction of rnh-1.0a or rnh-1.0a. AGs enclosed in
squares represent splice acceptor sites. Arrows indicate 3¢ exon–
intron junctions.
Enzymatic characterization of C. elegans RNases H1 H. Kochiwa et al.
422 FEBS Journal 273 (2006) 420–429 ª 2005 The Authors Journal compilation ª 2005 FEBS

near-homogeneity. The molecular masses of the puri-
fied recombinant proteins Ce-RNH1a, Ce-RNH1b,
Ce-RNH1A, Ce-RNH1B, and Ce-RNH1C were esti-
mated to be 33, 28, 62, 25, and 17 kDa, respectively,
by SDS ⁄ PAGE (Fig. 4).
The enzymatic activity of each recombinant C. ele-
gans RNase H1 was analyzed by using two different
30-mer RNA–DNA ⁄ DNA hybrids as substrates so that
the cleavage site of the RNA strand could be
determined. RNase HI from the bacterium E. coli
(Ec-RNHI) and RNase HII from the archaeon Pyro-
coccus furiosus (Pf-RNHII) also were used to compare
cleavage specificity with those of C. elegans RNase H1
enzymes. When the RNase H assay was performed
using 6-carboxyfluorescein (FAM) labeling at the 5¢ end
of the RNA–DNA strand, the degradation patterns of
Ce-RNH1a and Ce-RNH1b were completely the same,
but the other proteins exhibited different patterns
(Fig. 5A). On the other hand, when the RNase H assay
was performed using fluorescein isothiocyanate labeling
at the 3¢ end of the RNA–DNA strand, in contrast with
Ec-RNHI, which cleaved the 5¢ phosphodiester bond of
the third ribonucleotide from the RNA–DNA junction,
C. elegans RNase H1 enzymes and Pf-RNHII cleaved
the 5¢ phosphodiester bond of the last ribonucleotide at
the RNA–DNA junction (Fig. 5B). The cleavage pat-
terns of Ce -RNH1a and Ce-RNH1b were closer to that
of Pf-RNHII than to that of Ec-RNHI, whereas
250
150

100
75
50
37
25
15
kDa
234 516
20
Fig. 4. Purified recombinant RNase H1 enzymes of C. elegans.
Samples were analyzed by SDS ⁄ PAGE on a 10–20% gel and
stained with Coomassie Brilliant Blue. Lane 1, molecular mass
markers; lane 2, Ce-RNH1a; lane 3, Ce-RNH1b; lane 4, Ce-RNH1A;
lane 5, Ce-RNH1B; lane 6, Ce-RNH1C. Dots indicate positions of
each recombinant protein.
Ce-RNH1α Ce-RNH1β
Ce-RNH1A Ec-RNHIPf-RNHII
30 mer
A
G
C
U
G
G
G
A
U
A
G
C

G
U
A
3'
5'
1 2 3 4 5 6 7 8 9 10111213141516
A
5'-GCGAAUUUAGGGCGAgagcaaacttctcta-3'
5'-GCGAAUUUAGGGCGAgagcaaacttctcta-3'
5'-GCGAAUUUAGGGCGAgagcaaacttctcta-3'
5'-GCGAAUUUAGGGCGAgagcaaacttctcta-3'
Ce-RNH1α, Ce-RNH1β
Ce-RNH1A
Ec-RNHI
Pf-RNHII
C
B
3'
5'
Ce-RNH1α Ce-RNH1β
Ce-RNH1A
Ec-RNHIPf-RNHII
30 mer
A
G
C
G
12345678910111213141516
Fig. 5. Cleavage specificity of RNase H enzymes on (A) 5¢ FAM-
labeled or (B) 3¢ fluorescein isothiocyanate-labeled RNA–DNA ⁄ DNA

hybrid. RNase H digestion products were analyzed using denaturing
polyacrylamide gel (see Experimental procedures). Lane 1, no
enzyme control; lanes 2–4, 0.05, 0.25, 1 n
M Ce-RNH1a; lanes 5–7,
20, 100, 400 n
M Ce-RNH1b; lanes 8–10, 10, 50, 200 nM Ce-RNH1A;
lanes 11–13, 0.02, 0.1, 0.4 n
M Pf-RNHII; lanes 14–16, 0.02, 0.1, 0.4
U Ec-RNHI. Metal ion concentrations are: lanes 1–7 and 14–16,
1m
M MgCl
2
; and lanes 8–13, 1 mM MnCl
2
. Positions of nucleo-
tides are indicated on the right. (C) Summary of cleavage sites.
Ribonucleotides are represented as uppercase letters and deoxy-
ribonucleotides as lower case letters. Arrows indicate cleavage
sites.
H. Kochiwa et al. Enzymatic characterization of C. elegans RNases H1
FEBS Journal 273 (2006) 420–429 ª 2005 The Authors Journal compilation ª 2005 FEBS 423
Ce-RNH1A exhibited a unique digestion pattern
(Fig. 5C). Above all, the finding that Ce-RNH1a and
Ce-RNH1b showed the same cleavage patterns is in
contrast with the fact that the dsRHbd deletion mutant
of human RNase H1 exhibits a degradation pattern
different from that of the wild-type [19], because
Ce-RNH1b also lacks a dsRHbd at the N-terminus. We
also checked the activity of a dsRHbd deletion mutant
of Ce-RNH1a: the mutant proteins showed exactly the

same cleavage pattern as Ce-RNH1a and Ce-RNH1b
(data not shown). This result also supports the idea
that the dsRHbd of Ce-RNH1a does not affect the
specificity of the cleavage site.
To compare the enzymatic activities of Ce-RNH1a
and Ce-RNH1b, we determined the kinetic parameters
of both enzymes and calculated the relative K
m
and
k
cat
values as in a previous study [29]. The results are
summarized in Table 1. The K
m
value of Ce-RNH1a
was comparable to that of Ce-RNH1b, whereas the
k
cat
value of the former enzyme was  91 times higher
than that of the latter. Consequently, we can presume
that the N-terminus portion of Ce-RNH1a helps to
enhance the hydrolysis rate but affects neither the clea-
vage site nor the binding affinity for the substrate.
The activities of Ce-RNH1B and Ce-RNH1C were
also examined by the same RNase H assay, but no
activity was detected (data not shown), in agreement
with the results of a previous report describing the
inactivity of Ce-RNH1B and Ce-RNH1C [22]. The
fact that yeast two-hybrid analysis revealed that
Ce-RNH1C formed a complex with several other pro-

teins [30] suggests that other factors may be necessary
for the activation of Ce-RNH1C. The inactivity of
Ce-RNH1B may be due to protein misfolding, because
we used urea as a denaturant to prepare and purify
the recombinant protein.
Metal ion preferences of C. elegans RNase H1
enzymes
We also compared the RNase H1 enzymes in C. ele-
gans in terms of their preferences for bivalent ions.
For this purpose, we performed RNase H assays in the
presence of Mg
2+
or Mn
2+
ions at concentrations ran-
ging from 0.01 to 20 mm. Increased RNase H activity
of Ce-RNH1a was associated with an increase in the
concentration of Mg
2+
ions but not of Mn
2+
ions
(Fig. 6A). On the other hand, although Ce-RNH1b
has an optimum concentration of Mg
2+
ions similar
to that of the mutant human RNase H1 with deleted
dsRHbd at the N-terminus [18], this enzyme was also
Table 1. Kinetic parameters of Ce-RNH1a and Ce-RNH1b. The kin-
etic parameters were determined from two independent experi-

ments. Relative K
m
and k
cat
values were calculated by dividing the
values for Ce-RNH1b by those for Ce-RNH1a.
Enzyme
Relative
K
m
value
Relative
k
cat
value
Ce-RNH1a 1.0 1.0
Ce-RNH1b 0.86 0.011
MgCl2 MnCl2
30 mer
0.01 0.1 0.5 1 5 10(-) 0.01 0.1 0.5 1 5 10 (mM)2020
C
Ce-RNH1A
30 mer
B
MgCl2 MnCl2
0.01 0.1 0.5 1 5 10(-) 0.01 0.1 0.5 1 5 10 (mM)2020
Ce-RNH1β
30 mer
A
MgCl2 MnCl2

0.01 0.1 0.5 1 5 10(-) 0.01 0.1 0.5 1 5 10 (mM)2020
Ce-RNH1α
Fig. 6. Metal ion preferences of C. elegans RNase H1 enzymes.
Reactions were carried out in the presence of 0.01–20 m
M MgCl
2
or MnCl
2
using 5¢ FAM-labeled RNA–DNA ⁄ DNA hybrid. No enzyme
control is indicated as (–). Concentrations of each recombinant pro-
tein were (A) 0.5 n
M Ce-RNH1a,(B)100nM Ce-RNH1b, and (C)
150 n
M Ce-RNH1A.
Enzymatic characterization of C. elegans RNases H1 H. Kochiwa et al.
424 FEBS Journal 273 (2006) 420–429 ª 2005 The Authors Journal compilation ª 2005 FEBS
activated in the presence of Mn
2+
ions (Fig. 6B). To
investigate the dependence of enzymatic activity on
metal ions more precisely, we also determined the spe-
cific activities of Ce-RNH1a and Ce-RNH1b in the
presence of Mg
2+
or Mn
2+
ions, as shown in Table 2.
Although the specific activity of Ce-RNH1a in the
presence of Mg
2+

was higher than in the presence of
Mn
2+
, Ce-RNH1a could use Mn
2+
as a cofactor for
cleavage of Okazaki fragment substrates. This result is
inconsistent with those of previous reports in the calf
thymus [8] and humans [10]; however, Bacillus halodu-
rans RNase HI, which, like eukaryotic RNase H1,
contains a dsRHbd at the N-terminus, is also activated
in the presence of Mn
2+
(Wei Yang, personal commu-
nication). Therefore, this feature of Ce-RNH1a is
thought to be more similar to that of bacterial
RNase HI than to that of mammals. On the other
hand, the specific activity of Ce-RNH1b is only about
one-hundredth that of Ce-RNH1a in the presence
of Mg
2+
and about one-fortieth in the presence of
Mn
2+
. The difference in specific activities between
Ce-RNH1a and Ce-RNH1b suggests that the existence
of the dsRHbd may be related to RNase H activity
and supports the idea that eukaryotic RNase H1
enzymes act processively by interactions through the
dsRHbd, leading to dimerization of the protein [18].

However, Ce-RNH1b function in vivo is still unclear,
because this protein has low RNase H activity. It is
likely that the rnh-1.0b encoding Ce-RNH1b may not
produce a functional protein; instead, aberrant splicing
or alternative splicing may contribute to the regulation
of gene expression in combination with the nonsense-
mediated mRNA decay system [31].
In contrast with the activities of Ce-RNH1a and
Ce-RNH1b, that of Ce-RNH1A was enhanced in the
presence of Mn
2+
ions rather than Mg
2+
ions
(Fig. 6C). We also found that the pattern of digestion
by Ce-RNH1A differed with the metal ion. A previous
report defined eukaryotic RNase H1 as an enzyme that
requires Mg
2+
ions for activity but cannot use Mn
2+
ions as cofactors [8]. However, our study revealed that
this description does not apply to Ce-RNH1A, which
can be classified as a eukaryotic RNase H1 on the
basis of amino-acid sequence similarity. Phylogram
analysis shows that Ce-RNH1a is orthologous to
human RNase H1 and that Ce-RNH1A is out-grouped
with S. cerevisiae and S. pombe RNase H1 enzymes
[22], but that S. cerevisiae RNase H1 prefers Mg
2+

ions as a cofactor, as do other eukaryotic RNase H
enzymes [32]. To our knowledge, Ce-RNH1A is the
only eukaryotic RNase H1 that prefers Mn
2+
ions for
activity. These results suggest that at least two types
of RNase H1, Ce-RNH1a and Ce-RNH1A, occur in
C. elegans.
Comparative analysis of RNase H1-encoding
genes in C. elegans and C. briggsae
C. elegans has multiple RNase H1-related genes, unlike
other eukaryotes, and Ce-RNH1A seems to be the
only exception found so far among eukaryotic RN-
ase H1 enzymes from the perspective of ionic prefer-
ence, as described in the previous section. Are these
features limited to C. elegans? To clarify this, we con-
ducted a comparative analysis of the RNase H1-enco-
ding genes in C. elegans and C. briggsae, which
diverged from a common ancestor 100 million years
ago, because the complete C. briggsae genome was
published recently [33] and its protein database was
useful for this analysis. Comparative analysis showed
that Ce-RNH1a, Ce-RNH1A, and Ce-RNH1C had
independent orthologous proteins in C. briggsae
(Table 3), leading us to conclude that these
RNase H1-related genes were generated before the two
species diverged. On the other hand, the fact that
Ce-RNH1B is more similar to Ce-RNH1C than to any
other eukaryotic RNase H1 enzymes (data not shown)
suggests that these two genes may have been generated

as a result of gene duplication within the C. elegans
genome. In summary, C. elegans RNase H1 enzymes
Table 2. Specific activities of Ce-RNH1a and Ce-RNH1b in the pres-
ence of Mg
2+
or Mn
2+
ions. One unit of enzymatic activity was
defined as the amount of enzyme hydrolyzing 1 lmol substrate per
minute, and the specific activity was defined as the enzymatic
activity per mg protein. The activity derived from Ce-RNH1a in the
presence of MgCl
2
was set as 100. The specific activity values rep-
resent means from two separate experiments.
Enzyme Metal ion
Specific activity
(UÆmg
)1
)
Relative
activity (%)
Ce-RNH1a MgCl
2
7.0 100
MnCl
2
2.1 30
Ce-RNH1b MgCl
2

0.070 1.2
MnCl
2
0.057 0.8
Table 3. Protein conservation among three species. Numerical val-
ues indicate sequence identities (%) between proteins. Ortholo-
gous proteins are underlined. C. elegans enzymes are indicated
along the top, and C. briggsae enzymes down the side.
Ce-RNH1a Ce-RNH1A Ce-RNH1B Ce-RNH1C
CBP16719
82.9 28.4 30.2 38.8
CBP03109 28.4
76.1 29.0 28.0
CBP19944 39.2 26.2 32.1
56.1
CBP07225 37.1 30.8 22.9 32.6
Human RNase H1 45.8 33.1 26.4 34.9
H. Kochiwa et al. Enzymatic characterization of C. elegans RNases H1
FEBS Journal 273 (2006) 420–429 ª 2005 The Authors Journal compilation ª 2005 FEBS 425
can be classified into three groups: (a) Ce-RNH1a may
have functions common to other eukaryotic RNase H1
enzymes; (b) Ce-RNH1A and Ce-RNH1C may provide
a lineage-specific function for C. elegans and C. brigg-
sae; (c) Ce-RNH1B may be specific to C. elegans.
Comparative analysis has shown the possibility that
the N-terminal sequences of C. elegans RNase H1
enzymes serve as localization signals. Alteration of the
N-terminal portion contributes to the subcellular local-
ization of RNase H1 in the mouse [21] and Cr. fascicu-
lata [34], and protein diversity in these cases may be

caused by translation from different start codons. In
C. elegans, phylogenetic profiling of eukaryotic
proteins has also determined that there are 660
nucleus-encoded mitochondrial genes, and C. elegans
RNase H1 enzymes are also predicted to be mitoch-
ondrial [35]. In particular, we found that rnh-1.1 of
C. elegans has two potential start codons at the 5¢ ends
of the ORF, and the 17-amino-acid sequence (MIR-
WFRNFGALFKKPRG) from the first methionine
was conserved in the gene orthologous to rnh-1.1 in
C. briggsae, with high similarity (88%). The amino-
acid sequence of C. briggsae is
MIRWFRNL-
GTLFKKPRG (amino acid residues identical with
those of Ce-RNH1A are underlined). Because the mit-
ochondrial localization signal of mouse RNase H1 is
27 amino-acid residues from the first methionine and is
conserved in several vertebrates [21], the N-terminal
portion of Ce-RNH1A may also serve as some sort of
localization signal. From this result, we propose that
the multiple RNase H1 enzymes in C. elegans are regu-
lated not only at a transcriptional level but also at a
post-transcriptional level. Taking into consideration
the conservation of RNase H1 enzymes between
C. elegans and C. briggsae and the enzymatic features
described in the previous sections, we suggest that
C. elegans may have obtained various types of
RNase H1 in a phased manner and that the roles of
C. elegans RNase H1 enzymes may have diverged in
accordance with their evolution.

Experimental procedures
Strain maintenance
The N2 nematode strain and E. coli strain OP50 used in
this work were provided by the Caenorhabditis Genetics
Center, which is funded by the NIH National Center for
Research Resources (NCRR). To synchronize worm devel-
opmental staging, eggs were collected from adult worms
and incubated on nematode growth medium agar plates
overnight at 25 °C. L1 larval stage worms were collected
from plates with M9 buffer and plated on to nematode
growth medium agar plates inoculated with E. coli strain
OP50. L1 worms were incubated at 25 °C, and worms at
each developmental stage were harvested after the appropri-
ate incubation times [36].
RT-PCR analysis
Total RNAs from eggs and from larval stages 1–2 (L1–L2),
2–3 (L2–L3), 3–4 (L3–L4), and 4 to adult (L4 –adult) were
prepared with TRIzol Reagent (Invitrogen, Carlsbad, CA,
USA). To detect the expression of each gene during C. ele-
gans development, RT-PCR was performed with ReverTra
Dash (Toyobo, Osaka, Japan) using gene-specific primers
(Table S1) to amplify the entire coding sequences of rnh-1.1
(GenBank accession no. ZK1290.6), rnh-1.2 (GenBank
accession no. ZK938.7), and rnh-1.3 (GenBank accession
no. C04F12.9), the partial coding sequences of rnh-1.0a
(GenBank accession no. F59A6.9), the alternative spliced
transcript (defined as rnh-1.0b)ofrnh-1.0a, and eft-3 (Gen-
Bank accession no. F31E3.5). PCRs were performed under
the following conditions: 3 min at 94 °C; 10 s at 98 °C, 2 s
at 60 ° C, and 20 s (rnh-1.0a, rnh-1.0b, rnh-1.2, rnh-1.3, and

eft-3) or 1 min (rnh-1.1)at74°C for 30 cycles; and 5 min
at 74 °C. These conditions were set up to make a linear
dose–response relationship between each RNA and its PCR
product. PCR products were separated by 1.2% agarose gel
electrophoresis and stained with ethidium bromide.
cDNA cloning
To obtain cDNA clones of rnh-1.1, rnh-1.2, and rnh-1.3,
the amplified PCR products described in the previous sec-
tion were used. For cloning of rnh-1.0a and rnh-1.0b alter-
natively spliced from the same transcripts, the coding
sequences were amplified by RT-PCR using H0AB-S
(5¢-CCAGTTACTCAAGATTTTGAACGC-3¢) as a for-
ward primer and H0AB-A (5¢-CGTTTAATGAACAT
TTGGGCTCC-3¢) as a reverse primer. PCR products were
purified with GFX PCR DNA and a Gel Band Purification
Kit (Amersham Biosciences, Piscataway, NJ, USA) and
cloned into pPCR-Script Amp SK(+) vectors (Stratagene,
La Jolla, CA, USA). Plasmid DNAs were transformed into
E. coli strain DH5a competent cells (Toyobo) and purified
with a QIAprep Spin Miniprep Kit (Qiagen GmbH, Hilden,
Germany). The nucleotide sequences of each insert DNA
were determined and confirmed to be identical with those
in the database.
Expression and purification of recombinant
proteins
The ORFs of each gene were PCR-amplified from plasmids
containing each cDNA by using ReverTra Dash (Toyobo)
and gene-specific primers containing NdeI and XhoIor
Enzymatic characterization of C. elegans RNases H1 H. Kochiwa et al.
426 FEBS Journal 273 (2006) 420–429 ª 2005 The Authors Journal compilation ª 2005 FEBS

NotI sites (Table S2). The amplified PCR fragments were
treated with appropriate restriction enzymes and subcloned
into pET-23b expression vector (Novagen, Darmstadt, Ger-
many) and sequenced to confirm their correct nucleotide
sequences. The resulting plasmids were transformed into
E. coli strain BL21(DE3)pLysS (Novagen). The transform-
ants were incubated at 37 °C for  6 h in Luria–Bertani
medium containing 100 lgÆmL
)1
ampicillin and 40 lgÆmL
)1
chloramphenicol and then subjected to induction at 20 °C
overnight with 0.4 mm isopropyl b-d-thiogalactopyrano-
side. The recombinant proteins were extracted by sonica-
tion in buffer A [20 mm sodium phosphate (pH 7.4),
10 mm imidazole, and 500 mm NaCl] and centrifuged at
12 000 g for 10 min. Except for Ce -RNH1B, the superna-
tant of each recombinant protein was loaded on to a
nickel–Sepharose column (Amersham Biosciences) and elut-
ed with buffer B [20 mm sodium phosphate (pH 7.4),
500 mm imidazole, and 500 mm NaCl] by AKTA FPLC
(Amersham Biosciences). The partly purified recombinants
were loaded on to a HiTrap Desalting Column (Amersham
Biosciences) and desalted with buffer C, containing 50 mm
Tris ⁄ HCl (pH 7.5), 0.02 mm EDTA (pH 8.0), 0.05% 2-
mercaptoethanol, 0.02% Tween 20, and 10% glycerol. For
extraction of Ce-RNH1B, after sonication and centrifuga-
tion, the pellet was washed with buffer D [0.5% Triton X-
100, 1 mm EDTA (pH 8.0)] several times and resolved in
buffer A containing 6 m urea, loaded on to a nickel–Seph-

arose column, and eluted with buffer B containing 6 m
urea. The eluted sample was dialyzed against buffer C con-
taining 6 m urea, loaded on to a HiTrap Desalting Col-
umn, and desalted with buffer C. Purified recombinant
proteins were analyzed by SDS ⁄ PAGE on a 10–20% gradi-
ent gel and stained with Quick-CBB (Wako, Osaka,
Japan).
In vitro assay for RNase H activity
RNase H activity was assayed by analyzing the stability of
an RNA–DNA hybrid in the presence of enzymatic sam-
ples. A 5¢ FAM-labeled or 3¢ fluorescein isothiocyanate-
labeled 30-nucleotide-long RNA–DNA oligonucleotide
(5¢-GCGAAUUUAGGGCGAgagcaaacttctcta-3¢) and its
cDNA oligonucleotide (5¢-tagagaagtttgctctcgccctaaattcgc-3¢)
(ribonucleotides denoted by uppercase letters and deoxy-
ribonucleotides by lowercase letters) were chemically syn-
thesized by Hokkaido System Science (Hokkaido, Japan)
and annealed for use as a substrate. RNase H reactions
were performed in 20 lL reaction buffer containing 20 mm
Tris ⁄ HCl (pH 8.0), 1 mm dithiothreitol, 50 mm KCl, 0.01–
20 mm MgCl
2
or MnCl
2
,1mgÆmL
)1
BSA, 100 nm sub-
strate, and 0.05–400 nm purified recombinant C. elegans
RNase H1 or purified recombinant Pf-RNHII (provided by
A. Sato) [37], or Ec-RNHI (purchased from Toyobo,

Osaka, Japan). Samples were incubated for 15 min at room
temperature (C. elegans RNase H1 enzymes) or at 37 °C
(Ec-RNHI) or 50 °C(Pf-RNHII). We then added an equal
volume of stop solution [8 m urea ⁄ 1 m Tris ⁄ HCl, pH 7.2,
and a small amount of blue dextran (Sigma Chemical, St
Louis, MO, USA)] to stop the reactions. The reaction mix-
tures were heated at 70 °C for 3 min, loaded on to a 20%
polyacrylamide gel containing 8 m urea, and run for 20 min
at 2000 V and 50 min at 2200 V. The reaction products
were visualized with a Molecular Imager FX Pro (Bio-Rad
Laboratories, Hercules, CA, USA).
Kinetic analysis
To determine the kinetic parameters, the enzymatic activity
was observed in the presence of 1 mm MgCl
2
using the
RNA–DNA ⁄ DNA hybrid as substrate. The concentrations
of the substrate varied from 0.1 to 1.0 lm and the amount
of enzyme was controlled such that the cleavage rate of the
substrate did not exceed 30% of the total, as previously
described [38]. Hydrolysis of the substrate with the enzyme
followed Michaelis–Menten kinetics, and the kinetic param-
eters were obtained from the Lineweaver–Burk plot. k
cat
was calculated from k
cat
¼ V
max
⁄ [E]. To determine the spe-
cific activity, one unit of enzymatic activity was defined as

the amount of enzyme hydrolyzing 1 lmol substrate per
minute, and the specific activity was defined as the enzy-
matic activity per mg protein. Enzymatic activity was
observed in the presence of 1 mm MgCl
2
or 5 mm MnCl
2
using the RNA–DNA ⁄ DNA hybrid as substrate, and the
substrate concentration was 0.1 lm. Each value given is the
mean from two separate experiments.
Comparative analysis of C. elegans and
C. briggsae
BLAST analysis [39] was conducted against a C. briggsae
protein database provided by WormBase [40], by using the
amino-acid sequence of human RNase H1 (GenBank acces-
sion no. NP_002927) as a query sequence. Four proteins of
C. briggsae (WormBase protein IDs CBP16719, CBP03109,
CBP19944, CBP07225) were detected as similar to human
RNase H1. The RNase H domain of each C. elegans and
C. briggsae RNase H1 was identified by using hmmpfam
[41], and we extracted the amino-acid sequences corres-
ponding to the RNase H domain. fasta analysis [42] was
performed to analyze protein similarity by comparing the
amino-acid sequences of each RNase H domain.
Acknowledgements
We thank Asako Sato (Keio University, Japan) for
technical assistance with the RNase H assay and Dr
Naoto Ohtani, Azusa Kuroki, Koji Numata (Keio
University, Japan), Dr Robert J. Crouch (National
Institutes of Health, Bethesda, MD, USA), Dr Yuji

H. Kochiwa et al. Enzymatic characterization of C. elegans RNases H1
FEBS Journal 273 (2006) 420–429 ª 2005 The Authors Journal compilation ª 2005 FEBS 427
Kohara, and Dr Hideaki Hiraki (National Institute of
Genetics, Japan) for their helpful discussions. We also
appreciate the help of Dr Wei Yang, Dr Marcin Now-
otny, and Dr Sergei A. Gaidamakov (National Insti-
tutes of Health, USA) for providing unpublished data
and suggestions. This research was supported in part
by: a Grant-in-Aid for Scientific Research on Priority
Areas; a Grant-in-Aid from the 21st Century Center of
Excellence (COE) Program, entitled ‘Understanding
and Control of Life’s Function via Systems Biology
(Keio University)’; and grants from the Japan Society
for the Promotion of Science (JSPS) and Keio Univer-
sity.
References
1 Stein H & Hausen P (1969) Enzyme from calf thymus
degrading the RNA moiety of DNA-RNA Hybrids:
effect on DNA-dependent RNA polymerase. Science
166, 393–395.
2 Hausen P & Stein H (1970) Ribonuclease H. An enzyme
degrading the RNA moiety of DNA-RNA hybrids. Eur
J Biochem 14, 278–283.
3 Hansen J, Schulze T, Mellert W & Moelling K (1988)
Identification and characterization of HIV-specific
RNase H by monoclonal antibody. EMBO J 7, 239–243.
4 Itaya M (1990) Isolation and characterization of a sec-
ond RNase H (RNase HII) of Escherichia coli K-12
encoded by the rnhB gene. Proc Natl Acad Sci USA 87,
8587–8591.

5 Henry CM, Ferdinand FJ & Knippers R (1973) A
hydridase from Escherichia coli. Biochem Biophys Res
Commun 50, 603–611.
6 Ohtani N, Yanagawa H, Tomita M & Itaya M (2004)
Identification of the first archaeal Type 1 RNase H gene
from Halobacterium sp. NRC-1: archaeal RNase HI can
cleave an RNA–DNA junction. Biochem J 381, 795–802.
7 Ohtani N, Haruki M, Morikawa M & Kanaya S (1999)
Molecular diversities of RNases H. J Biosci Bioeng 88,
12–19.
8 Vonwirth H, Frank P & Busen W (1989) Serological
analysis and characterization of calf thymus ribonu-
clease H IIb. Eur J Biochem 184, 321–329.
9 Wu H, Lima WF & Crooke ST (1998) Molecular clon-
ing and expression of cDNA for human RNase H.
Antisense Nucleic Acid Drug Dev 8, 53–61.
10 Frank P, Albert S, Cazenave C & Toulme JJ (1994)
Purification and characterization of human ribonuclease
HII. Nucleic Acids Res 22, 5247–5254.
11 Berkower I, Leis J & Hurwitz J (1973) Isolation and
characterization of an endonuclease from Escherichia
coli specific for ribonucleic acid in ribonucleic acid–
deoxyribonucleic acid hybrid structures. J Biol Chem
248, 5914–5921.
12 Katayanagi K, Okumura M & Morikawa K (1993)
Crystal structure of Escherichia coli RNase HI in com-
plex with Mg
2+
at 2.8 A
˚

resolution: proof for a single
Mg(2+)-binding site. Proteins 17, 337–346.
13 Goedken ER & Marqusee S (2001) Co-crystal of
Escherichia coli RNase HI with Mn
2+
ions reveals two
divalent metals bound in the active site. J Biol Chem
276, 7266–7271.
14 Ohtani N, Haruki M, Muroya A, Morikawa M &
Kanaya S (2000) Characterization of ribonuclease HII
from Escherichia coli overproduced in a soluble form.
J Biochem (Tokyo) 127, 895–899.
15 Ohtani N, Haruki M, Morikawa M, Crouch RJ,
Itaya M & Kanaya S (1999) Identification of the
genes encoding Mn
2+
-dependent RNase HII and
Mg
2+
-dependent RNase HIII from Bacillus subtilis:
classification of RNases H into three families. Bio-
chemistry 38, 605–618.
16 Mushegian AR, Edskes HK & Koonin EV (1994)
Eukaryotic RNAse H shares a conserved domain with
caulimovirus proteins that facilitate translation of poly-
cistronic RNA. Nucleic Acids Res 22 , 4163–4166.
17 Cerritelli SM & Crouch RJ (1995) The non-RNase H
domain of Saccharomyces cerevisiae RNase H1 binds
double-stranded RNA: magnesium modulates the switch
between double-stranded RNA binding and RNase H

activity. RNA 1, 246–259.
18 Gaidamakov SA, Gorshkova II, Schuck P, Steinbach
PJ, Yamada H, Crouch RJ & Cerritelli SM (2005)
Eukaryotic RNases H1 act processively by interactions
through the duplex RNA-binding domain. Nucleic Acids
Res 33, 2166–2175.
19 Wu H, Lima WF & Crooke ST (2001) Investigating the
structure of human RNase H1 by site-directed mutagen-
esis. J Biol Chem 276, 23547–23553.
20 Filippov V, Filippov M & Gill SS (2001) Drosophila
RNase H1 is essential for development but not for pro-
liferation. Mol Genet Genomics 265, 771–777.
21 Cerritelli SM, Frolova EG, Feng C, Grinberg A, Love
PE & Crouch RJ (2003) Failure to produce mitochon-
drial DNA results in embryonic lethality in Rnaseh1
null mice. Mol Cell 11, 807–815.
22 Arudchandran A, Cerritelli SM, Bowen NJ, Chen X,
Krause MW & Crouch RJ (2002) Multiple ribonuclease
H-encoding genes in the Caenorhabditis elegans genome
contrasts with the two typical ribonuclease H-encoding
genes in the human genome. Mol Biol Evol 19, 1910–
1919.
23 Lejeune F & Maquat LE (2005) Mechanistic links
between nonsense-mediated mRNA decay and pre-
mRNA splicing in mammalian cells. Curr Opin Cell Biol
17, 309–315.
24 Morrison M, Harris KS & Roth MB (1997) smg
mutants affect the expression of alternatively spliced SR
Enzymatic characterization of C. elegans RNases H1 H. Kochiwa et al.
428 FEBS Journal 273 (2006) 420–429 ª 2005 The Authors Journal compilation ª 2005 FEBS

protein mRNAs in Caenorhabditis elegans. Proc Natl
Acad Sci USA 94, 9782–9785.
25 Mitrovich QM & Anderson P (2000) Unproductively
spliced ribosomal protein mRNAs are natural targets of
mRNA surveillance in C. elegans. Genes Dev 14, 2173–
2184.
26 Szabo G, Katarova Z & Greenspan R (1994) Distinct
protein forms are produced from alternatively spliced
bicistronic glutamic acid decarboxylase mRNAs during
development. Mol Cell Biol 14, 7535–7545.
27 Mounsey A, Bauer P & Hope IA (2002) Evidence
suggesting that a fifth of annotated Caenorhabditis
elegans genes may be pseudogenes. Genome Res 12,
770–775.
28 Zorio DA & Blumenthal T (1999) Both subunits of
U2AF recognize the 3¢ splice site in Caenorhabditis ele-
gans. Nature 402, 835–858.
29 Chai Q, Qiu J, Chapados BR & Shen B (2001) Archaeo-
globus fulgidus RNase HII in DNA replication: enzymo-
logical functions and activity regulation via metal
cofactors. Biochem Biophys Res Commun 286, 1073–1081.
30 Li S, Armstrong CM, Bertin N, Ge H, Milstein S, Boxem
M, Vidalain PO, Han JD, Chesneau A, Hao T, et al.
(2004) A map of the interactome network of the meta-
zoan C. elegans. Science 303, 540–543.
31 Baek D & Green P (2005) Sequence conservation, rela-
tive isoform frequencies, and nonsense-mediated decay
in evolutionarily conserved alternative splicing. Proc
Natl Acad Sci USA 102, 12813–12818.
32 Wintersberger U & Frank P (2001) Ribonucleases H of

the budding yeast, Saccharomyces cerevisiae. Methods
Enzymol 341, 414–429.
33 Stein LD, Bao Z, Blasiar D, Blumenthal T, Brent MR,
Chen N, Chinwalla A, Clarke L, Clee C, Coghlan A,
et al. (2003) The genome sequence of Caenorhabditis
briggsae: a platform for comparative genomics. Plos
Biol 1, 166–192.
34 Engel ML, Hines JC & Ray DS (2001) The Crithidia
fasciculata RNH1 gene encodes both nuclear and mito-
chondrial isoforms of RNase H. Nucleic Acids Res 29,
725–731.
35 Marcotte EM, Xenarios I, van Der Bliek AM & Eisen-
berg D (2000) Localizing proteins in the cell from their
phylogenetic profiles. Proc Natl Acad Sci USA 97,
12115–12120.
36 Lewis JA & Fleming JT (1995) Basic culture methods:
Caenorhabditis elegans. Modern Biological Analysis of an
Organism, pp. 4–9. Academic Press, San Diego, CA.
37 Sato A, Kanai A, Itaya M & Tomita M (2003) Coop-
erative regulation for Okazaki fragment processing by
RNase HII and FEN-1 purified from a hyperthermophi-
lic archaeon, Pyrococcus furiosus. Biochem Biophys Res
Commun 309, 247–252.
38 Haruki M, Tsunaka Y, Morikawa M & Kanaya S
(2002) Cleavage of a DNA-RNA-DNA ⁄ DNA chimeric
substrate containing a single ribonucleotide at the
DNA–RNA junction with prokaryotic RNases HII.
FEBS Lett 531, 204–208.
39 Altschul SF, Gish W, Miller W, Myers EW & Lipman
DJ (1990) Basic local alignment search tool. J Mol Biol

215, 403–410.
40 Chen N, Harris TW, Antoshechkin I, Bastiani C, Bieri
T, Blasiar D, Bradnam K, Canaran P, Chan J, Chen
CK, et al. (2005) WormBase: a comprehensive data
resource for Caenorhabditis biology and genomics.
Nucleic Acids Res 33, 383–389.
41 Eddy SR (1998) Profile hidden Markov models. Bio-
informatics 14, 755–763.
42 Pearson WR (1990) Rapid and sensitive sequence com-
parison with FASTP and FASTA. Methods Enzymol
183, 63–98.
Supplementary material
The following supplementary material is available
online:
Table S1. Oligonucleotides used for RT-PCR analysis.
Table S2. Oligonucleotides used for expression clo-
ning. Restriction sites are underlined.
This material is available as part of the online article
from
H. Kochiwa et al. Enzymatic characterization of C. elegans RNases H1
FEBS Journal 273 (2006) 420–429 ª 2005 The Authors Journal compilation ª 2005 FEBS 429