Báo cáo Y học: Conditionally immortalized adrenocortical cell lines at undifferentiated states exhibit inducible expression of glucocorticoid-synthesizing genes pot

Conditionally immortalized adrenocortical cell lines
at undifferentiated states exhibit inducible expression
of glucocorticoid-synthesizing genes
Kuniaki Mukai
1
, Hideko Nagasawa
1,
*, Reiko Agake-Suzuki
1
, Fumiko Mitani
1
, Keiko Totani
1
,
Nobuaki Yanai
2
, Masuo Obinata
2
, Makoto Suematsu
1
and Yuzuru Ishimura
1
1
Department of Biochemistry and Integrative Medical Biology, School of Medicine, Keio University, Shinjuku-ku, Tokyo, Japan;
2
Institute of Development, Aging and Cancer, Tohoku University, Sendai, Japan
To facilitate studies on dierentiation of adrenocortical cells
and regulation of steroidogenic genes, we established cell
lines from adrenals of adult transgenic mice harboring a
temperature-sensitive large T-antigen gene of s imian virus
40. Adrenal glands of the mice exhibited normal cortical

zonation including a functionally undierentiated c ell-layer
between the aldosterone-synthesizing zona glomerulosa cells
and the corticosterone-synthesizing zona fasciculata cells. At
a permissive temperature (33 °C), established cell lines
AcA201, AcE60 and A cA101 expressed steroidogenic g enes
encoding steroidogenic factor-1, cholesterol side-chain
cleavage P 450scc, and s teroidogenic acute regulatory pro-
tein, which are expressed throughout adrenal cortices and
gonads. Genes encoding 3 b-hydroxysteroid dehydrogenase
and s teroid 21-hydroxylase P450c21, which catalyze the
intermediate steps for syntheses of both aldosterone and
corticosterone, were inducible in the three cell lines in tem-
perature- and/or dibutyryl cAMP-dependent manners.
Notably, these cell lines displayed distinct expression pat-
terns of the steroid 1 1b-hydroxylase P45011b gene respon-
sible f or the zone-speci®c s ynthesis of corticosterone.
AcA201 cells expressed the P45011b gen e at 33 °C, showing
the property of the zona fasciculata cells, while AcE60 cells
expressed it upon a shift to a nonpermissive temperature
(39 °C). On the other hand, AcA101 expressed the P45011b
gene at 39 °C synergistically with exposure to dibutyryl
cAMP. N one of these clones express the z ona glomerulosa-
speci®c aldosterone synthase P450aldo gene under the con-
ditions we tested. These results show that AcE60 and
AcA101 cells display a pattern of the steroidogenic gene
expression similar to that of the undierentiated cell-layer
and are capable of dierentiating into the zona fasciculata-
like cells in vitro.
Keywords: adrenal cortex; s teroid hormone; i mmor-
talization; simian virus 40 large T-antigen.

Adrenal cortices in m ammals are composed o f morpho-
logically and functionally differentiated cell zones [1,2].
The outer zone, the zona glomerulosa, synthesizes aldos-
terone, the most potent mineralocorticoid. The middle
zone, t he zona fasciculata p roduces corticosterone in
rodents and cortisol in humans and other animals. The
inner zone, the zona re ticularis s ecretes adrenal androgens
in humans and in some other animals. In rodents,
aldosterone and corticosterone are produced from a
common substrate, deoxycorticosterone. Deoxycorticoster-
one is synthesized from cholesterol by a successive action
of cholesterol side-chain cleavage enzyme cytochrome
P450scc ( P450scc, or the Cyp11a gene product), 3b-
hydroxysteroid dehydrogenase (3bHSD), and 21-hydroxy-
lase c ytochrome P 450c21 (P450c21, the Cy p21a ge ne
product) [1,3]. These enzymes are present throughout the
adrenal cortex [4±6]. On the other h and, two structurally
related enzymes, aldosterone synthase cytochrome
P450aldo (P450aldo, or the CYP11b-2 gene product) and
11b-hydroxylase cytochrome P45011b (P45011b,orthe
Cyp11b-1 gene product), convert deoxycorticosterone into
aldosterone in the zona glomerulosa and into corticoster-
one in the zona fasciculata, respectively [7±9]. Thus, the
zonal differences in the steroid products are attributable to
localization of the two enzymes responsible for the last
steps in the steroidogenesis [10].
Correspondence to K. Mukai, Department of Biochemistry and Integrative Medical Biology, School of Medicine, Keio University, 35 Shinano-
machi, Shinjuku-ku, Tokyo 160-8582, Japan. Fax: + 81 3 3358 8138, Tel.: + 81 3 5363 3752, E-mail:
Abbreviations: StAR, steroid acute regulatory protein; Bt
2

cAMP, dibutyryl cAMP; GAPDH, glyceraldehyde 3-phosphate dehydrogenase;
3bHSD, 3b-hydroxyl steroid dehydrogenase and isomerase; P450, cytochrome P450; P450scc, cholesterol side-chain cleavage P450; P450c21,
steroid 21-hydrogenase P450; P45011b,steroid11b-hydroxylase P450; P450aldo, aldosterone synthase P450; PDL, population doubling levels;
SF-1, steroidogenic factor-1; SV40, simian virus 40; ts, temperature-sensitive; HBSS, Hank's balanced salt solution.
Enzymes: glyceraldehyde 3-phosphate dehydrogenase (EC 1.2.1.9); 3b-hydroxyl steroid dehydroxylase and isomerase (EC 1.1.1.145);
cytochrome P450 side-chain cleavage (EC 1.14.15.6); cytochrome P450 steroid 21-hydroxylase (EC 1.14.99.10); c ytochrome P450 steroid
11b-hydroxylase (EC 1.14.15.4); cytochrome P450 aldosterone synthase (EC 1.14.15.4).
*Present address: Faculty of Engineering, The University of Tokushima, Tokushima, Japan.
(Received 23 July 2001, revised 22 October 2001, accepted 22 October 2001)
Eur. J. Biochem. 269, 69±81 (2002) Ó FEBS 2002
Recent studies on regulation of adrenocortical s teroi-
dogenesis have focused on mechanisms o f cell-speci®c
transcription of genes encoding the steroid hydroxylases
(reviewed in [ 11]) and ste roid ac ute regulatory p rotein (StAR)
[12]. A mong transcription factors that have been found to
regulate the s teroidogenic genes, it has been demonstrated
that steroidogenic factor-1 (SF-1, also referred to as Ad4BP)
[13,14] is essential for development of steroidogenic organs
such as adrenal cortex and gonad s [15,16]. However,
molecular mechanisms for development of the adrenocor-
tical zonation and its maintenance have not been clarified.
We previously showed the presence of a functionally
undifferentiated cell layer between the aldosterone-produc-
ing zona glomerulosa c ells and the corticosterone-producing
zona fasciculata cells in rats [17±20]. It was immunohisto-
chemically recognized as the region devoid of both
P450aldo and P45011b [17±21]. We also showed that the
cell layer is c omposed of the inner half of the zona
glomerulosa and the transitional zone (also referred t o as
zona intermedia) the latter of which has been described by

previous investigators [22±29]. We have provided further
evidence that the layer locates in the middle o f the region
containing proliferating cells, s uggesting the presence o f
precursor or progenitor cells that could differentiate into the
glomerulosa and/or fasciculata cells [17,30±33]. This view is
consistent with recent observation that adrenocortical cells
radially arranging from the zona glomerulosa to the zona
reticularis share the same clonal origin [34]. However, such
processes for development and differentiation of the adrenal
cortices have not fully been investigated because p recursor
or progenitor cell lines remain ambiguous.
A conditionally immortalizing gene such a s a temperature-
sensitive (ts) large T-antigen gene of simian virus 40 (SV40)
has been utilized for generation of cell lines [35,36]. We have
previously generated transgenic mice [37] carrying a ts SV40
large T-antigen gene tsA58 [38] th at is driven by its own
promoter. These transgenic mice have been used to establish
various cell lines from different tissues [39,40]. In this s tudy,
we have attempted t o establish conditionally immortalized
adrenocortical cell lines suitable for in vitro analyses of cell
differentiation by using the transgenic mice [37].
MATERIALS AND METHODS
Mice and adrenal glands
Adrenal glands used in this study were excised from the
transgenic mice [37] carrying a ts mutant of SV40 large
T-antigen g ene tsA58 [38]. They were maintained on a
standard diet containing 0.3% (w/w) Na and with water ad
libitum in accordance with the institutional animal care
guidelines of Keio University School of Medicine. T he
adrenal g lands apparently developed no t umor and had

normal histology based on examination with hematoxylin/
eosin staining until at least 10 w eeks old.
Immunohistochemistry
Immunohistochemical localization of P45011b and
P450aldo was performed on 6-lm sections of fresh-frozen
adrenal glands from the transgenic mice as previously
described [17,41]. The antibodies used were raised in rabbits
against rat P45011b and P450aldo [21].
Cell culture
Ten adrenal glands from 8-week-old male mice and eight
adrenal glands from 10-week-old female mice were used in
separate experiments. The adrenals were minced and treated
with 1.5 mL of Hank's balanced salt solution (HBSS)
containing 2 m gámL
)1
collagenase type V (Sigma, St Louis,
MO, USA), 0.05 mgámL
)1
DNase I (Sigma), and
5mgámL
)1
bovine serum albumin (Sigma) at 3 7 °Cfor1
h with gentle shaking. After pipetting to disperse cells, they
were collected by centrifugation, and were resuspended with
HBSS. The suspension contained 1.0 ´ 10
6
and 7 ´ 10
5
cells
from 10 and eight adren als, respectively. The cells were

collected by cen trifugation and resuspended at 5 ´ 10
5
cells
per mL with one of two cell culture media: medium A, a
1 : 1 mixture of Dulbecco's modi®ed E agle's medium and
Ham's F12 medium with 15% heat-inactivated horse serum
(Life Technologies, Rockville, MD, USA), 2.5% heat-
inactivated fetal bovine serum (Hyclone, Logan, UT, USA),
200 UámL
)1
penicillin, and 200 lgámL
)1
streptomycin (Life
Technologies); medium E, RITC80-7 medium ([42]; Kyo-
kuto Pharmaceutical I ndustrial, Tokyo, Japan) with the
same additives included in m edium A. The cell suspension
(5 ´ 10
4
cells) was placed on the center of a 9.2-cm
2
well.
The d ishes had been coated with bovine ®bronectin (Life
Technologies) by incubation of multiwell plates o vernight at
37 °C with serum-free medium containing 1 lgámL
)1
®bronectin. After incubation of the cells at 37 °Cfor4h,
2mLofmediumwasaddedgentlyintoeachwell.Gas-
phase used was humidi®ed atmosphere containing 5% CO
2
.

The next day, the temperature was shifted to 33 °Candthe
medium was changed at 3- to 4-day intervals. The cells were
transferred to ®bronectin-coated p lates every week u sing
0.05% trypsin-0.53 m
M
EDTA (Life Technologies). At a
third transfer, 25±100 cells were plated in ®bronectin-coated
60-mm dishes in the same media. Visual inspectio n of the
plates veri®ed the absence of pairs or groups of cells. After
4 w eeks, colonies (3±4 mm in diameter) were isolated using
cloning rings and trypsin-EDTA. Each clone was grown
successively in 1.8-cm
2
wells, 9.2-cm
2
wells, and then larger
dishes by subculturing. So me cells were used for RNA
extraction and others were frozen for subsequent experi-
ments.
The cell lines obtained at the permissive temperature for
the T-antigen were examined for expression of mRNAs for
SF-1, P450scc , P45011b,andP450aldo by RT-PCR anal-
ysis as described below. SF-1 and P450scc mRNAs were
used as ad renocortical cell markers. The reason that w e
adopted SF-1 and P450scc as criteria for adrenocortical cells
was that they w ere detected in the adrenogenital primordi-
um and throughout the c ortex i n a dults [43±46]. P450aldo
and P45011b mRNAs w ere used as the zonal differentiation
markers that were responsible for production of aldosterone
and corticosterone, respectively [21]. We chose three cell

lines AcA101, AcA201 (obtained with medium A), a nd
AcE60 (obtained with medium E ). They showed differ ent
expression patterns of SF-1, P450scc,andP45011b genes
(see Results). Their expression patterns of the steroidogenic
genes, morphological appearance, and growth rates were
unchanged over population doubling levels (PDL) of 200.
To further characterize the cell-lines, cells were treated
with porcine corticotropin (23 mUámL
)1
), human angio-
tensin II (50 n
M
), dibutyryl cAMP (Bt
2
cAMP) (1 m
M
), KCl
70 K. Mukai et al. (Eur. J. Biochem. 269) Ó FEBS 2002
(medium + 15 m
M
), BAY K 6844 (1 l
M
), A23187 (1 l
M
),
ionomycin (1 l
M
), or 12-O-tetredecanoylphorbol 13 acetate
(TPA; 160 n
M

) for 24 h or 4 days under the standard culture
media described above. These reagents were products of
Sigma. During the treatments, the cells were cultured at 33
or 39 °C. Total RNA was extracted and analysed as
described below.
Northern blot analysis
Total RNA was extracted with a modi®ed single-step
isolation method using Trizol reagent (Life T echnologies).
Northern blot analysis was performed as described previ-
ously [47] except that probes were
32
P-labeled DNA. Before
transfer to positively charged nylon membranes (Roche
Diagnostics, Mannheim, Germany) rRNAs were visualized
by ethidium bromide. Densitometric analysis of 28S rRNA
bands veri®ed t hat amounts of RNA loaded were similar
(<  10%) and that degradation of the RNA prepara-
tions was undetectable under the experimental conditions.
DNA fragments were labeled w ith [a-
32
P]dCTP (3000
Ciámmol
)1
, Amersham-Pharmacia Biotech, P iscataway,
NJ, USA) a nd High Prime (Roche Diagnostics) according
to the manufacturer's instructions. H ybridization signals
were dete cted with a Kodak BioMax ®lm with an intensi-
fying screen. DNAs used for labeling each contained a
fragment as follows: SV40 large T-antigen gene, 1.7-kb
PvuII±EcoRI fragment of pMT-1ODtsA [48]; SF -1,

AccI±EcoRI fragment corresponding to the 3¢ untransla-
tedregionofamousecDNA[13];P450scc, a mouse
cDNA fragment corresponding to the rat cDNA
nucleotides 1 018±1361 [ 49]; P45011b, a mouse cDNA
nucleotides 761±950 [8,47]; P450aldo, a mouse
cDNA nucleotides 761±953 [8]. T he plasmids carrying
SV40 large T -antigen gene and mouse SF-1 were generous
gifts from H. Ariga (Hokkaido University) and K. L. Parker
(University o f Texas South-Western Medical Center, TX,
USA), respectively. cDNAs clones encoding P450scc,
P45011b, and P450aldo were obtained by PCR with the
primer pairs described below. Mouse adrenocortical Y-1
and ®broblast NIH3T3 cells were culture d with Dulbecco's
modi®ed Eagle's medium containing penicillin
(100 IUámL
)1
), streptomycin sulfate (100 lgámL
)1
)and
10% heat-inactivated fetal bovine serum at 37 °C under a
humidi®ed atmosphere containing 5% CO
2
.
RT-PCR
Expression of mRNA was a nalyzed with RT-PCR. cDNA
was synthesized from total RNA (2 lg) with an oligo dT
18
primer and Moloney murine leukemia virus reverse
transcriptase using a ® rst-strand cDNA synthesis kit
(Amersham-Pharmacia Biotech) according to the manufac-

turer's instructions. Aliquots (1 lL) of the reaction solution
were used as template for PCR. PCR mixture contained
10 m
M
Tris/HCl, pH 8.3, 50 m
M
KCl, 1.5 m
M
MgCl
2
,
0.2 m
M
each deoxynucleotide triphosphate, 0.5 l
M
deoxy-
oligonucleotide primers, and Taq DNA polymerase
(1.25 U , Takara Shuzo, Shiga, Japan) in a total volume of
25 lL. Ampli®cation conditions were 45 s at 94 °C, 45 s at
the annealing t emperature for each primer pair as described
below, and 2 min at 72 °C f or 35 cycles or appropriate cycle
numbers as indicated f ollowed by 7 min at 72 °C. The
annealing temperatures for each primer pair were: 56 °Cfor
P450scc, P45011b, P450aldo,and3bHSD ;69°Cfor
P450c21;50 °CforStAR;54°C for glyceraldehyde 3-phos-
phate dehydrogenase (GAPDH). PCR products (5 lL)
were analyzed by agarose gel electorphoresis followed by
visualization with ethidium bromide. Nucleotide sequences
of primer pairs used for PCR were a s follows (numbers in
parenthesis were nucleotide positions of the cDNA

sequences):
SCC-F, 5¢-G CACACAACTTGAAGGTACAGGAG-3¢
(1018±1041); SCC-R, 5¢-CAGCC AAAGCCCAAG TACC
GGAAG-3¢ (1348±1361) [50].
m11b-F, 5 ¢-AAGAAAACTTAGAGTCCTGGGATT-3¢
(761±784); m11b-R, 5¢-GTGTCAGTGCTTCCAGCAAT
GAGT-3¢ (927±950) [8].
mAldo-F, 5¢-AAGAACATTTCGATGCCTGGG
ATG-3¢ (761±784); mAldo-R, 5¢-GTGTCAACGCTCC C
AGCGGTGAGC-3¢ (930±953) [8].
mStAR-F, 5¢-AAGAGCTCAACTGGAGAGCAC-3¢
(170±190); mStAR-R, 5¢-TACTTAGCACTTCGTCCC
CGT-3¢ (380±400) [51].
3bHSD-F, 5¢-GC AGACCATCCTAGATGTCAAT
CTG-3¢ (412±436); 3bHSD-R, 5¢-CAAGTGGCTCATAG
CCCAGATCTC-3¢ (1160±1137) [50].
m21-F, 5¢-CTTCACGACTGTGTCCAGGACTTG-3¢
(553±576); m21-R, 5¢-CAGCAGAGTGAAGGCCTGCA
GCAG-3¢ (1309±1332) [52].
GAPDH-F, 5¢-TGAAGGTCGGTGTGAACGGATT
TGGC-3¢ (51±76); GAPDH-R, 5 ¢-CATGTAGGCCATGA
GGTCCACCAC-3¢ (1010±1033) [53].
The forward and reverse primers reside in different exons
of the genes. The PCR p roducts were digested with
appropriate restriction enzymes to ensure the speci®city of
the PCR reactions by comparing of sizes of digests with
those expected f rom published DNA sequences. Total RNA
from Y-1 cells was used as a positive c ontrol for detection of
the mRNAs except that a drenal total RNA from C57BL/6
mice was used as a positive control for detection of P450c21

mRNA.
To estimate relative amounts of mRNA among the cells
cultured under d ifferent conditions (33 or 39 °Cinthe
presence or absence of Bt
2
cAMP), intensities of PCR
products stained with e thidium bromide (see below) were
determined by densitometric analysis. All experiments for
the determination were performed within t he exponential
phase of the ampli®cation reactions to obtain the linear
response concerning the i nitial RNA a mounts. Each
experiment was performed at least twice to assure the
reproducibility. The intensities were normalized with
GAPDH cDNA, and the relative a mounts of mRNA were
expressed in Table 1 as the values of the mRNA level in Y-1
cells or mouse adrenal glands were taken as 1.0.
Analysis of steroids
Cells (1±2 ´ 10
6
cells per 21-cm
2
dish) were cultured at 33 or
39 °C in the presence or absence of 1 m
M
Bt
2
cAMP for
4 days. Water-soluble cholesterol (20 l
M
;Sigma)was

added at 24 h before removal of the mediu m. Steroids in
the medium (2 m L) were extracted with 8 mL of dichlo-
romethane. The extracts were treated with 2 mL of 0.1
M
NaOH and then washed with 2 mL of water. The resulting
extracts were evaporated to dryness and redissolved with
Ó FEBS 2002 Immortalized adrenocortical cell lines (Eur. J. Biochem. 269)71
50 lL of methan ol, and then 50 lL of water was added. An
aliquot (25 lL) of each sample was subjected to HPLC
using a C
18
column (4.6 mm ´ 150 mm; Cosmosil 5C18-
AR, Nacalai Tesque, Kyoto, Japan). Steroids were sepa-
rated by isocratic elution w ith 65% methanol in water a t
0.8 m Lámin
)1
and detected at 254 nm. For detectio n of
corticosterone, 55% methanol was used as the eluent.
Authentic s teroid standards were used for identi®cation of
steroid products by comparing elution times. To convert
pregnenolone, which is hardly detectable at 254 nm, into
progesterone, the steroid products were treated with 0.53 U
of cholesterol oxidase (26.8 Uámg
)1
; Toyo Jozo Co., Ltd,
Shizuoka, Japan) [54] in a reaction mixture of 100 lL
consisting of 20 m
M
potassium phosphate buffer, pH 7.4,
and 0.3% ( v/v) Tween 20. The reaction mixture was

incubated at 37 °C f or 20 min, and extracted with dichlo-
methane. The extracts were analyzed by HPLC un der the
same conditions.
RESULTS
Histology of adrenal glands of transgenic mice
carrying a temperature-sensitive oncogene
Adrenal glands of the transgenic mice harboring SV40 large
T-antigen tsA58 gene appeared quite normal in size and
shape as compared with those of nontransgenic animals,
suggesting that the ts oncogene developed no tumor in the
adrenal g lands at body temperature. As judged by the
haematoxylin/eosin staining, zonation of their cortices
including the zonae glomerulosa, fasciculata, and reticularis
were indistinguishable from those of the normal animals
(data not shown). The medullary tissues also appeared to be
normal.
We then examined imminohistochemically expression of
steroidogenic enzymes that occur in a zone-speci®c manner,
namely, P450 11b and P450aldo.AsshowninFig.1,
Table 1. Expression of genes involved in adrenocortical steroidogenesis in cell lines AcA101, AcA201, and AcE60. Based on the results from RT-PCR,
relative levels of mRNA were normalized using the results of GAPDH mRNA as described in Materials and methods, and are expressed as the
mRNA levels in Y-1 cells or mouse adrenal glands were taken as 1.0. Value 0 indicates that the level was < 0.01 of that of Y-1 cells or mouse
adrenal glands. ND, not determined. Bt
2
cAMP presence or absence is indicated by + and ±, respectively.
mRNA
AcA101 AcA201 AcE60
33 °C39°C33°C39°C33°C39°C
Adrenal
± + ± + ± + ± + ± + ± + Y-1 glands

P450scc 0.04 0.12 0.04 0.30 0.25 0.42 0.71 1.1 0.01 0.06 0.02 0.09 1.0 ND
StAR 0.11 0.55 0.35 1.7 0.16 1.25 0.85 1.5 0.33 0.65 0.31 1.9 1.0 ND
3bHSD 0 0 0 1.4 0 0 0 0.31 0.02 0.13 0.01 0.07 1.0 ND
P450c21 0 0.18 0 0.34 0 0.06 0 0.12 0 0.14 0 0 ND 1.0
P45011b 0 0 0 1.4 0.10 0.15 0.62 1.85 0 0 0.16 0.19 1.0 ND
P450aldo 0000000000001.0ND
Fig. 1. Adrenocortical zonation of transgenic mice harboring a temperature-sensitive SV40 large T-antigen gene. Fresh-frozen sections (6 lm) from
adrenal glands of the transgenic mice harboring a temperature-sensitive (ts) SV40 large T-antigen gene were analyzed immunohistochemically with
an an tibody speci®c to cortico sterone-synth esizing 11b-hydroxylase cytochrome P450 (P45011b)(A)andwithanantibodytoaldosteronesynthase
cytochrome P450 (P450aldo) (B) as described in Materials and methods. Localization of P45011b is shown with a brown color and that of P 450aldo
is shown with a blue color. These i mmunohistochemical re sults obtained with the transgenic mice were indistinguishable from those with
nontransgenic normal mice. Sizes, sh apes and cytology of the adrenal glands (including medulla) of t he transgenic mice also seemed to be normal.
Note that the thickness (marked with a) where P45011b is absent is larger t han the thickness (marked with b) where signals of P450aldo are present,
indicating that there is a cell-layer which neither has P45011b nor P450aldo. Bar  50 lm.
72 K. Mukai et al. (Eur. J. Biochem. 269) Ó FEBS 2002
P45011b was detected in the entire regions of the zonae
fasculata-reticularis (Fig. 1A), while P450aldo was detected
in the outermost cells of the zona glomerulosa (Fig. 1B).
Such distribution was indistinguishable from that observed
with nontransgenic animals (data not shown). Thus, the
distribution of the t wo enzymes was not affected by
introduction of SV40 large T-antigen gene tsA58.These
observations suggest that the transgenic manipulation does
not interfere with development of the adrenal zonation in
the mice.
As indicated in Fig. 1, the region of P45011b-negative
cells (p arenthesis in Fig. 1A) was thicker than the region of
P450aldo-positive cells (parenthesis in Fig. 1B). Evidently,
there was a cell-layer where neither P45011b nor P450aldo
were detectable, suggesting that the cells in this layer w ere

unable to produce either corticosterone or aldosterone. It
was also noted that P450aldo was only detectable in the
outermost area of the zona glomerulosa under dietary
conditions with normal Na contents. Together with our
previous results [17], these results i ndicate that mice exhibit a
functionally undifferentiated cell layer analogous to that
observedinrats.
Establishment of immortalized adrenocortical cell lines
A number of cell lines were derived from primary cells
prepared from whole adrenal glands of the t ransgenic mice.
Thepermissivetemperature(33°C) for the T-antigen
mutant was used t o establish cell lines in which t he
oncoprotein was kept active. To select cell lines exhibiting
properties of adrenocortical cells, RNAs from the cells were
examined by RT-PCR analysis to detect SF-1 and P450scc
mRNAs. The cell lines were further examined for detection
of P45011b and P450aldo mRNAs, the functional markers
for the zone-speci®c differentiation of t he cells. The results
of RT-PCR analyses indicated that the cell lines were
categorized into t hree different groups. The ®rst group
constituted cell lines expressing SF-1, P450scc,andP45011b
mRNAs but not P450aldo mRNA. These cell lines had the
property of the zona fasciculata cells. The second group was
composed of a small number of the cell lines that expressed
SF-1 and P450scc mRNAs but not P45011b or P450aldo
mRNAs, showing the gene expression pattern observed in
the undifferentiated cell layer. The last cell lines were those
that expressed none of the SF-1, P450scc, P45011b,and
P450aldo mRNAs and were characterized by their ®bro-
blast-like appearance. There were no cell lines that expressed

P450aldo mRNA regardless of expression of SF-1, P450scc,
or P45011b mR NAs .
Among these cell lines, AcA101, AcA20 1, and AcE60
were chosen for further detailed c haracterization. When
cultured at 33 °C, AcA201 was one of cell lines that
displayed mRNAs for SF-1, P450scc,andP45011b but not
P450aldo mRNA. On the other hand, AcA101 and AcE60
were two different cell lines that displayed e xpression of
SF-1 and P450scc mRNAs but not P45011b and P450aldo
mRNAs at 33 °C; the latter two exhibited d istinct expres-
sion patterns of steroidogenic genes t hat were different to
each other (see below). Their phenotypes and growth rates
of the t hree cell lines were unchanged over a PDL of 200 at
33 °C. Morphologies of these cells cultured at 33 °Care
shown in Fig. 2. AcA101 and AcA201 cells displayed
retracted appearances. AcE60 cells showed a larger a nd
¯atter appearance and were less retracted than AcA101 and
AcA201 cells. The doubling time of these cells was 24±30 h
at 33 °C.
Fig. 2. Morphology of adrenocortical cell-lines. Phase contrast
Photomicrographs depict morphologies of adrenocortical cell-lines
AcA101 (A), AcA201 (B), and AcE60 (C) wh ich were cultured under
the permissive temperature (33 °C) for the ts SV40 large T-antigen.
The cells were cultured at subcon¯uent stages under the conditions as
describedinMaterialsandmethods.Bar 50 lm.
Ó FEBS 2002 Immortalized adrenocortical cell lines (Eur. J. Biochem. 269)73
Growth of AcA101, AcA201, and AcE60 cells under a
nonpermissive temperature for the T-antigen (39 °C) w as
examined upon shifting the temperature from 33 to 39 °C.
Their rates of growth were re duced within 2 days a fter the

start of the temperature shift. At one week, AcA101 and
AcA201 cells were mostly detached from the culture dish
surface, and completely lost adhesivity until 4 weeks. In
contrast, AcE60 cells were able to attach onto the dishes even
after t he disappearance of cell division (data not shown).
The t hree cell lines cultured at 33 °C were characterized
by Northern blot analysis. As shown in Fig. 3A, Northern
blotting for SV40 T-antigen mRNA indicated that AcA101
(lane 1), AcA201 (lane 2), and AcE60 (lane 3) cells expressed
the transgene mRNA with different signal intensities. As
expected, Y-1 adrenocortical cells (lane 4) and ®broblast
NIH3T3 cells (lane 5) gave no hybridization signal. SF -1
mRNA (Fig. 3B) was detectable in the established cell lines
(lanes 1±3). The electrophoretic mobility of the hybridiza-
tion signal was the same as that of Y-1 cells (lane 4). Signal
intensities of P450scc mRNA varied markedly among the
three cell lines (Fig. 3C). T he P450scc mRNA level in
AcA201 cells was evident, while only a faint signal was
detectable in AcA101 cells. P450scc mRNA in AcE60 cells
was undetectable under the current experimental conditions.
As shown i n Fig. 3B,C, Y-1 cells (lanes 4) produced
hybridization signals of SF-1 and P450scc mRNA, whereas
NIH3T3 cells (lanes 5) did not, indicating that the hybrid-
ization was speci®c. As seen in Fig. 3D, electrophoretic
patterns of ribosomal RNAs indicated t hat amounts of total
RNA s ubjected to the Northern analyses were equivalent
and its degradation was undetectab le. Although attempting
to detect P45011b and P450aldo mRNAs using the same
RNA blot, we could not detect these mRNAs u nder the
current experimental conditions (data not shown).

Figure 4 shows the results from RT-PCR analysis with
greater sensitivity for the detection of P450scc, P45011b,
and P450aldo mRNAs in the three cell lines cultured at
33 °C. In addition to AcA101 (Fig. 4A, lane 1) and AcA201
(lane 2), AcE60 cells (lane 3) exhibited a detectable level of
P450scc mRNA. Differences in intensities of t he ampli®ed
DNA fragments among the three were consistent with the
results from Northern blotting (Fig. 3C). On the other
hand, P45011b mRNA (Fig. 4B) was detectable in AcA201
cells (lane 2), but not in AcA101 (lane 1) or in AcE60 (lane
3) cells. P450aldo mRNA (Fig. 4C) was not detectable in
the three cell lines (lanes 1±3), although it was detected in Y-
1 cells (lane 4). Digestion of the ampli®ed DNA fragments
with restriction enzymes veri®ed s peci®city o f P CR (right
panels of Fig. 4A±C). As judged from the results for
GAPDH mRNA, the ef®ciency o f RT-PCR was compara-
ble among the cell lines (Fig. 4D). These results suggest that,
under conditions wh ere the T-antigen is active, AcA201 cells
have the p roperty of the zona fascicu lata cells, while
AcA101 and AcE60 cells do not display the zone-speci®c
markers of steroidogenesis.
Cyclic AMP-dependent alterations in steroidogenic gene
expression upon inactivation of the T-antigen
To examine effects of inactivation of the T-antigen o n
expression of the genes for steroidogenesis, we cultured
AcA101, AcA201, and AcE60 cells at 39 °C for up to 4 d ays
and analyzed levels of mRNAs for P450scc, StAR, 3bHSD,
P450c21, P45011b,andP450aldo by RT-PCR. At the same
time, the cells were cultured in the presence of regulators of
the steroidogenic gene expression such as Bt

2
cAMP,
ACTH, or angiotensin II, in combination with the temper-
ature shift. As described below, a simple s hift of temperature
for 4 days affected the mRNA levels of some of these
steroidogenic genes. Treatments with either corticotropin or
angiotgensin II did not alter the mRNA levels signi®cantly
at both 33 and 39 °C under the current experimental
conditions (data not shown). On the other hand, treatment
with Bt
2
cAMP for 4 days turned out to alter the mRNA
Fig. 3. Northern analysis for expression of SV40 large T-antigen,
steroidogenic factor-1 (SF-1, or Ad4BP), cholesterol side-chain cleavage
cytochrome P450 (P450scc, or Cyp11a) in cell lines AcA101, AcA201,
and AcE60 at a permissive temperature for the ts T-antigen. Total RNA
was prepared from AcA101, AcA201, and AcE60 cells which were
cultured at 33 °C with standard media as described in Materials and
methods. RNA from mouse adrenoco rtical Y-1 and ®broblast
NIH3T3 cells, neither of which express the T-antigen gene, were used
as positive and negative controls, respectively, for detection of
adrenoco rtic al cell marker mRNAs. Total RNA (10 lgperlane)was
analyzed by Northern blotting with
32
P-labeled cDNA probes enco-
ding (A) SV40 T-antigen (B) SF-1 and (C) P450scc genes as described
in Materials a nd me thods. Riboso mal R NAs (D) v isualized by ethi-
dium bromide show that amounts of total RNAs were comparable to
each other and that d egradatio n of RNA were undetectable under the
experimental conditions.

74 K. Mukai et al. (Eur. J. Biochem. 269) Ó FEBS 2002
levels at both temperatures as described below. These results
were summa rized in T able 1.
P450scc
and
StAR
genes
Figure 5 A shows effects of a temperat ure s hift in the
presence or absence of Bt
2
cAMP on P450scc mRNA levels
in AcA101, AcA201, and AcE60 cells. P450scc mRNA
levels upon a simple shift to 39 °C were almost unchanged
in AcA101 (lanes 1 and 3) and AcE60 (lanes 11 and 13) cells,
while in AcA201 ce lls (lanes 6 and 8), mRNA levels
increased signi®cantly. Responsiveness of AcA101 (lanes 2
and 4) and AcE60 (lanes 12 and 14) cells to Bt
2
cAMP was
evident at both 33 and 39 °C, while in AcA201 cells (lanes 7
and 9) responsiveness was much less. Synergistic effects of a
temperature shift and Bt
2
cAMP were also shown in these
cell lines (lanes 4, 9, and 14).
We next examined the ability of AcA101, AcA201 and
AcE60 cells to express StAR mRNA, a key factor for the
acute induction of adrenocortical steroidogenesis (Fig. 5B).
In the a bsence of the c AMP a nalog at 33 °C, the mRNA
levels were detectable but with only faint bands in the three

Fig. 4. RT-PCR analysis for expression of P450scc, P45011b,andP450aldo genes in the cell lines AcA101, AcA201, and AcE60 cells cultured at
33 °C. cDN A was synthesized with oligo dT primer u sing total RNA (2 lg) from AcA101 (lanes 1 and 5), A cA20 1 (lanes 2 and 6), Ac E6 0 (lanes 3
and 7), or Y-1 (lanes 4 and 8) cells, and the resulting cDNAs were amp li®ed by PCR using speci®c primer pairs for (A) P450scc,(B)P45011b,(C)
P450aldo an d (D) glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as described i n Materials and methods. C ycle numbers in PCR w ere 35 in
(A), (B), and (C), and 25 in (D). Left, PCR products (5 lL) were analyzed through 1% agarose ge ls. Right, P CR products (5 lLexceptforlane7of
panel A where 10 lL was used) were digested with BstXI (A,B) and with SacI (C). The digests were separated on 8% polyacrylamide gels. DNA
fragments were visualized by ethidium bromide. Size marker (lanes M) is HaeIII-digested /X1 74 DNA. Numbers with arrowhea ds indicate sizes o f
PCR products or their digests. ns (C) ind icates a nonspeci®c band. Amplifying conditions except for lanes 2 and 4 o f (A) were within the exponential
phase of the reactions to obtain the linear dose±response concerning the initial RNA amounts.
Ó FEBS 2002 Immortalized adrenocortical cell lines (Eur. J. Biochem. 269)75
cell lines ( lanes 1, 6, and 11). When AcA101 a nd AcA201
cells were cultured either in the presence of Bt
2
cAMP (lanes
2 and 7) or at 39 °C (lanes 3 and 8), the mRNA levels were
increased markedly. In contrast, AcE60 cells displayed only
a small induction of the mRNA level in the presence of
Bt
2
cAMP (lane 12), while showing no notable change upon
a temperature shift (lane 13). Interestingly, however, AcE60
cells exhibited the greatest synergy between the temperature
shift an d Bt
2
cAMP among the three cell lines tested (lanes 4,
9, and 14). On t he other hand, the r esults obtained w ith
GAPDH primers showed similar intensities of the PCR
products among the groups, indicating that ef®ciencies of
reverse transcription and PCR were comparable to one
another (Fig. 5C). These results indicated that P450scc and

StAR genes responsible for the initial steps for synthesis of
both adrenocortical and sex steroid hormones were
expressed c onstitutively and inducible through a cAMP-
dependent pathway in the established cell lines.
3
b
HSD
and
P450c21
genes
3bHSD and P450c21 catalyze the reactions in the middle of
the synthetic pathways for both corticosterone and aldos-
terone. Figure 6A shows mRNA levels of 3bHSD in the
same sets of RNA preparations used for analysis of P450scc
and StAR mRNA levels in Fig. 5. 3bHSD mR NA in
AcA101 cells was detected only in the presence of Bt
2
cAMP
at 39 °C (lanes 1±4). AcA201 cells also expressed 3bHSD
mRNA in a similar manner to that seen in AcA101 cells,
although the level after the treatment was lower (lanes 6±9).
Thus, synergies of inactivation of the T-antigen and
treatment with the cAMP analog were evident in the
induction o f 3bHSD mRNA in AcA101 and AcA201 cells.
The mRNA level in AcE60 cells in the absence of Bt
2
cAMP
at 33 °C was hardly detected (lane 11), while treatment with
the cAMP a nalog at 33 °C induced the mRNA l evel (lane
12). A t emperature shift to 39 °C did not enhance the

3bHSD mRNA level (lane 13), and the induction by the
cAMP analog at 39 °C was smaller than that observed at
33 °C (lane 14). It should be noted that, although being
expressed in adrenal cortex and gonads (as are the P450scc
and StAR genes), the 3bHSD gene of these cell lines is
expressed in a manner (Fig. 6A) distinct f rom those of
P450scc and StAR gene expression (Fig. 5 A,B).
Figure 6B illustrates differences in P450c21 mRNA levels
among the c ell lines. The mRNA level i n AcA101 cells in the
absence of B t
2
cAMP was undetectable at 33 °C(lane1),
whereas t reatment with the cAMP analog induced a weak
signal at 33 °C (lane 2). A simple shift to 39 °C did not
induce the mRNA (lane 3), but the same p rocedure in the
presence of Bt
2
cAMP increased the level signi®cantly (lane
4). The results obtained with AcA201 cells (lanes 6±9) were
similar to those obtained with AcA101 cells except that the
induction in AcA201 was weak. In AcE60 cells, P450c21
mRNA was detectable upon treatment with B t
2
cAMP at
33 °C (lanes 11 and 12). At 39 °C, P450c21 mRNA became
undetectable irrespective of the presence of Bt
2
cAMP (lanes
13 and 14). Thus, AcA101, AcA201 and AcE60 cells were
Fig. 5. Expression of P450scc and steroidogenic acute regulatory p rotein (StAR) genes in AcA101, AcA201, and AcE60 cells upon a temperature shift

and/or treatment w ith dibutyryl cAMP (Bt
2
cAMP). AcA101, AcA201, and AcE60 cells were plated at 33 °C,andallowedtoattachtodishesfor
24 h, and were further cultured at 33 or 39 °C for 4 days in the absence or presence of 1 m
M
Bt
2
cAMP. Total RNA was prepared from the cells and
was subjected to RT-PCR analysis using the primer pairs for (A) P450scc ,(B)StAR and ( C) GAPDH as described in Materials an d methods. RNA
preparation from Y-1 ce lls were used a s positive controls for P450scc and StAR mRNA. P CR products (5 lL) were analyzed through 2 % agarose
gels followed by visualizatio n with ethidium brom ide. Cycle numbers in PCR for P450scc (A) were 32 in AcA101, 28 in AcA201, and 35 in AcE60
cells, and those in PCR for StAR (B) and GAPDH (C) were 35 and 25, respectively, for the three cell line s.
76 K. Mukai et al. (Eur. J. Biochem. 269) Ó FEBS 2002
able to express the P450c21 gene, the marker expressed
exclusively in the entire regions of adrenal cortices but not in
gonads, indicating that the cell lines retain a f eature of
adrenocortical cells.
P45011
b and
P450aldo
genes
Figure 7 shows the levels of P45011b mRNA in the absence
or presence of Bt
2
cAMP at 33 and 39 °C. AcA101 cells did
not have a detectable level of P45011b mRN A in the absence
of the cAMP a nalog at 33 °C (Fig. 7, lane 1; Fig. 4B,
lane 1). Either treatment with the cAMP an alog (Fig. 7, lane
2) or a temperature shift (lane 3) did not induce the mRNA.
Upon the combined treatment with the cAMP analog and a

temperature shift, however, the cells expressed the P45011b
gene (lane 4). A similar synergistic effect in AcA101 cells was
observed on the levels of 3bHS D mRNA (Fig. 6A). The
P45011b mRNA level in AcA201 cells at 33 °Cwas
detectable in the absence of Bt
2
cAMP (Fig. 7, lane 6;
Fig. 4B, lane 2), and was not increased by the Bt
2
cAMP
treatment at 33 °C ( lane 7 of Fig. 7 ). A simple shift to 39 °C
enhanced the mRNA level (lane 8), and the additive effects
of the cAMP analog appeared to be small, if any (lane 9).
AcE60 cells did not exhibit a detectable level of P45011b
mRNA either in the absence (lane 11) or presence (lane 12)
of Bt
2
cAMP at 33 °C. Interestingly, AcE60 cells showed the
ability to induce the mRNA level upon the temperature shift
to 39 °C ( lane 13), although the level after the Bt
2
cAMP
treatment remained almost unchanged at 39 °C(lane14).
These results indicated that the three cell lines are able to
express P45011b gene, which is a determinant for synthesis
of corticosterone in the zona fasciculata cells. Moreover,
these three cell lines responded to distinct stimulatory
conditions to express the P45011b gene.
As mentioned earlier in this article, P450aldo mRNA was
undetectable in AcA101, AcA201, and AcE60 cells at 33 °C

cultured in the absence of Bt
2
cAMP at 33 °C. In addition, a
temperature shift and/or treatment with Bt
2
cAMP failed to
Fig. 6. Expression of 3b-hydroxysteroid dehydrogenase (3bHSD) and 21-hydroxylase P450 (P450c21) upon a temperature shift and/or treatment with
Bt
2
cAMP. PCR w as performed with primer pairs for (A) 3bHSD an d ( B) P450c21 using the cDNAs synthesized in the experiments in Fig. 5. Y-1
cells and mouse adrenal glands we re used as positive controls for de tection of 3bHSD and P450c21 mRNA, respectively. PCR products (5 lL) were
analyzed through 1% agarose gels followed by visua lization with ethidium brom ide. Cycle numbers in PCR for 3bHSD and P450c21 were 35 for
the three cell lines.
Fig. 7. Expression of P45011b gene upon a temperature shift and/or treatment with Bt
2
cAMP. PCR w as perfo rmed w ith th e primer pair for
P45011b using the cDNAs synthesized in the experiments in Fig. 5. Y-1 cells were used as a positive control for detection of P45011b mRNA. PCR
products (5 lL) were analyzed through 2% gels followed by visualization with ethidium bromide. C ycle numbers in PCR w ere 35 for the three cell
lines.
Ó FEBS 2002 Immortalized adrenocortical cell lines (Eur. J. Biochem. 269)77
induce P450aldo mRNA (data not shown). Furthermore, to
induce expression of the P450aldo gene, these cells were
cultured in the presence of either of angiotensin II, KCl, or
reagents that could change i ntracellular concentration o f
calcium ion at 33 or 39 °C (see Materials and methods).
These stimuli, however, could not induce detectable levels of
P450aldo mRNA in the cell lines under current experimen-
tal conditions (data not shown).
Steroidogenesis of the cell lines
The ability of the cell lines to produce steroids w as examined

by using reversed phase HPLC. As s hown in Fig. 8A±D,
when AcA101 cells were cultured in the presence o f
Bt
2
cAMP for 4 days at 39 °C, progesterone and a small
amount of deoxycorticosterone were detected, while corti-
costerone was undetectable. On the other hand, AcA201
cells synthesized only a detectable amount of progesterone
when the cells were stimulated with Bt
2
cAMP at 39 °C
(Fig. 8 E). AcE60 cells secreted progesterone in the presence
of Bt
2
cAMP at both 33 and 39 °C (data not shown). Thus,
the three cell lines showed responsiveness of their steroido-
genesis to activation of protein kinase A. Although pregn-
enolone is a possible intermediate o f the steroidogenesis, it i s
hardly undetectable in the eluate of HPLC by monitoring at
254 n m. To examine amounts of pregnenolone in the
culture medium of the three cell lines, the dic hloromethane
extracts were treated w ith cholesterol oxidase for conversion
into progesterone. After treatment, a remarkable peak of
progesterone was detected in the culture medium of AcA201
(Fig. 8 F), suggesting that AcA201 cells secrete d large
amounts of p regnenolone. Similarly, AcA101 and AcE60
cells synthesized signi®cant amounts of pregnenolone when
they were cultured in the presence of Bt
2
cAMP at 39 °C

(data not shown). These results were consistent with the
results from RT-PCR a nalysis of mRNA levels of t he
steroidogenic genes (Figs 5±7).
DISCUSSION
Previous studies on regulatory mechanisms of adrenocor-
tical s teroidogenesis have often utilized mouse Y-1 [55] and
human NCI-H295 [56] cells. Y-1 cells have been known to
display expression patterns of steroidogenic genes a nalo-
gous to those of the zona fasciculata cells except that the
endogenous P450c21 gene is not expressed, and that the
P450aldo gene is constitutively expressed though its mRNA
level is one-tenth of that of P45011b mRNA [8]. On the
other hand, NCI-H295 cells have been reported to exhibit
the phenotypes of both zona glomerulosa and fasciculata
cells simultaneously. Although these cell lines have been
showntobeusefulin vitro cell c ulture s ystems, the
phenotypes of Y1 and NCI-H295 cells do not precisely
correspond to either of the glomerulosa or fasciculata cells.
Other adrenocortical cell lines were also established by
using the wild-type SV40 T-antigen gene [57,58]. When
compared with the cell lines established previously, ou r cell
lines described in the present study have several d istinct
features suitable for studies on differentiation of adreno-
cortical cells and regulation of the steroidogenic genes.
First, immortalization is c onditional so that activity o f the
oncogene can be removed. Secondly, multiple cell lines with
the identical genetic background exhibit different pheno-
types in steroidogenic gene expression from one ano ther.
Finally, and most importantly, established AcA101 and
AcE60 cell lines have the a bility to convert from an

undifferentiated stage into the differentiated one analogous
to zona fasciculata-like cells.
Because the ts T-antigen transgene did not affect
cytogenesis and zonal differentiation of the adrenocortical
cells of the mice, the adrenocortical cells in vivo were lik ely to
be in a normal pathway of their differentiation. It is
unknown whether the ts T-antigen is active in the adrenals in
vivo. However, we have previously noted that amounts of
the ts T-antigen protein in other cells, which were obtained
by transfection, were decreased markedly at 37 °Cwhen
compared with amounts of wild-type T-antigen at 37 °C. It
is presumable that levels of the ts T-antigen protein are very
low at body temperature. At 33 °C, on the other hand, the
capability of the established cell lines to grow over PDL 200,
appeared to be a result of T -antigen activation. Being
consistent with the v iew, inactivation of the T-antigen by
culturing at the nonpermissive temperature reduced their
growth rates. Thus, the cell lines established under the
permissive conditions for the T-antigen could be returned to
Fig. 8. Analysis of steroid production. Cells were cultured at 33 or
39 °C in the absence or presence of 1 m
M
Bt
2
cAMP for 4 days. A
water-soluble form of cholesterol (20 l
M
) was added at 24 h before
removal of the medium. Dichloromethane extracts of the incubated
medium were prepared and were analyzed by r eversed phase HPLC as

described in Materials and methods. AcA101 cells were cultured at
33 °C in the absence (A) or presence (B) of Bt
2
cAMP and at 39 °Cin
the absence (C) or pre sence (D) of Bt
2
cAMP. Dichloromethane extract
of the medium of A cA201 cells, which were incubated at 39 °Cfor
4 days in the presence of 1 m
M
Bt
2
cAMP (E), was treated with cho-
lesterol oxidase to convert pregneno lone into pro gesterone (F), and
was a nalyzed by H PLC. Peaks o ther than tho se corresponding to
deoxycorticosterone and progesterone are unidenti®ed compounds
which are also extracted from medium without incubation of the cells.
D, deoxycorticosterone. P, progesterone.
78 K. Mukai et al. (Eur. J. Biochem. 269) Ó FEBS 2002
the normal pathway of their differentiation after a temper-
ature shift.
The t hree cell lines characterized i n the present study
retained a common phenotype of steroidogenic cells, i.e.
expression of SF-1, P450scc,andStAR genes. These ge nes
are known to be expressed throughout adrenal cortices a s
well as in the steroidogenic ce lls in gonads [43,46,59].
Although 3bHSD [6] and P4 50c21 [5] genes are a lso
expressed throughout rodent adrenal cortices including the
undifferentiated cell layer, their mRNAs in the three cell
lines were undetectable or at very low levels at 33 °C under

the standard culture conditions. This suggests t hat the cell
lines were dedifferentiated through a generation of cell lines.
Previous studies, however, showed that the 3bHSD gene
was expressed in nonsteroidogenic tissues such as liver and
kidney [60] in addition to the classical steroidogenic tissues
[6], suggesting that regulation of the 3bHSD gene is different
from that of the former three genes. On the o ther hand,
expression of P450c21 gene was undetectable in Y-1 a nd
other mouse adrenocortical cell line [58], implying that the
gene tends to be repressed by unknown mechanisms in vitro.
Nevertheless, the present results that our cell lines showed
inducible expression of 3bHSD and P450c21 genes indicate
that the cell lines have the property of adrenocortical cells.
Especially, expression of the e ndogenous P450c21 gene in
the established cell lines contrasts strikingly with the
characteristics of Y-1 and other mouse adrenocortical cell
lines [58].
Based on the results from analysis for expression of the
zonal markers in the established cell lines, AcA201 cells
displayed the feature of the zona fasciculata cells at 33 °C,
while AcE60 and AcA101 cells were at undifferentiated
stages that have a similar pattern of gene expression to the
undifferentiated cell layer. Furthermore, d ifferences in
induction of P45011b gene between AcE60 and AcA101
were demonstrated and were more evident than the
differences in the other steroidogenic genes; the P45011b
gene in AcE60 cells is expressed after inactivation of the T-
antigen, while the g ene in AcA101 cells requires additional
stimulation by c AMP for expression. It is no ted that the
same procedure for generating cell lines allowed us to

establish the three d ifferent cell lines. As whole adrenal
glands were used as the s ource for the cell culture in the
present study, it was un known whether the cell lines AcE60
and AcA101 were derived from cells in the functionally
undifferentiated cell layer. Nevertheless, several lines of
experimental evidence conceivably support a notion that
AcE60 a nd AcA101 cells were d erived from the undiffer-
entiated cell layer.
Although a number of cell lines were obtained in the
present study, there was no cell line expressing the P450aldo
gene. During initial passages, however, we found that the
cells from the transgenic mice were able to express the
P450aldo gene (data not shown). Being consistent with these
observations, previous studies [61] have also reported that
the zona glomerulosa cells prepared from rat adrenal glands
gradually cease to produce aldosterone in cu lture. These
phenomena may imply that additional factors are required
for expression of the P450aldo gene. In the zona glomerul-
osa cells in vivo, the cells expressing P450aldo were adjacent
to the capsule, as reported previously by other studies [62]
and ours [17,20,30]. I t is possible that the P450aldo-
expressing cells in vivo receive speci®c signals from the
capsule.
The present results showing that the cell lines responded
to Bt
2
cAMP but not to ACTH raise a question whether the
cell lines are able to express the MC2-receptor. Although we
have examined expression of MC2-receptor mRNA by RT-
PCR analysis using two different PCR primer sets [63,64], n o

speci®c signal was obtained from RNA of the three cell lines
under our experimental conditions, while Y-1 cells gave
speci®c signals (not shown). These observations suggested
that the cells were not expressing MC2-receptor mRNA.
Absence of the receptor might be a possible explanation for
the response to cAMP analog but not to ACTH.
The three cell lines were able to synthesize large amounts
of pregnenolone, and detectable levels of progesterone.
AcA101 cells were likely t o p roduce small amounts of
deoxycorticosterone. The ability to produce the steroids
together with enhancement of the synthesis by treatment
with a cAMP analog were c onsistent with the expression
levels of mRNA molecules of the steroidogenic genes, which
were regulated through the protein kinase A pathway.
Accumulation of pregnenolone and low levels of progester-
one, deoxycorticosterone, and corticosterone suggested that
P450scc, including the electron donor system, was active
and that the following synthesizing steps such as that
catalyzed by 3bHSD were not fully functional.
Adrenal cortices in rats have been known to regenerate
in vivo from the capsular portion (capsule and a dherent
cells) o f the glands after enucleation surge ry [1,2]. The
capsular and decapsular portions were found to be
separated by enucleation at the boundary between the zona
glomerulosa and zona fasciculata (F. Mitani, unpublished
observation). In the early days after enucleation, it was
demonstrated that the cells of the capsular portion dedif-
ferentiate into those devoid of both P450aldo and P45011b,
proliferate, and then differentiate into morphologically and
functionally distinct cells, i.e. the glomerulosa cells and

fasciculata cells [62,65]. Thus, the dedifferentiated cells seem
to be a bipotential stem cell population [32,33]. Considering
that the dedifferentiated cells in the regenerating adrenal
cortex express SF-1 and P450scc, but not P45011b nor
P450aldo [65,66 ], such a steroidogenic phenotype was the
same as those of A cA101 and AcE60 cells cultured at 33 °C.
Based on the present results that AcA101 and AcE60 cells
were able to differentiate into the fasciculata-like cells, they
may be referred to as p recursor cell lines for the zona
fasciculata cells. The available evidence does not support the
hypothesis that these cell lines represent bipotential progen-
itor cell lines or stem cell-like lines. Furthe r studies are
obviously necessary to examine whether AcA101 and
AcE60 cells are able to differentiate into cells with the
property of the zona glomerulosa cells.
ACKNOWLEDGEMENTS
We thank Drs K. L. Parker and H. Ariga for generous gifts of plasmids
and Drs T. Ogishima and P. J. Hornsby for helpful suggestions for
analysis of steroids. This work w as supported b y Grants-in-aid for
General Scienti®c Researc h from the Ministry of Education, Science
and Culture of Japan, by National G rants-in-Aid for the Establishment
of High-Tech Research Center in a Private University, and by grants
from Uehara Memorial Foundation, the Ichiro Kane hara Foundation,
and from Keio University School of Medicine.
Ó FEBS 2002 Immortalized adrenocortical cell lines (Eur. J. Biochem. 269)79
REFERENCES
1. Orth, D.N., Kovacs, W.J. & DeBold, C.R. (1992) The adrenal
cortex. I n Williams Textbook of Endocrinology (Wilson, J.D. &
Foster, D.W., eds), p p. 489±619. Sanders, Philadelphia, PA.
2. Hornsby, P.J. (1985) The regulation of adrenocortical function by

control of growth and sturucture. In The Adrenal Cortex
(Anderson, D.C. & Winter, J.S.D., e ds), pp. 1±31. Bu tterworths
Publishers Ltd, London, UK.
3. Miller, W.L. (1988) Molecular biology of steroid hormone syn-
thesis. Endocrinol. Rev. 9, 295±318.
4. Rogler,L.E.&Pintar,J.E.(1993)ExpressionoftheP450side-
chain cleavage and adrenodoxin genes begins during early stages
of adrenal cortex development. Mol. Endocrinol. 7, 453±461.
5. Raschella, G., Smets, G., Claeys, A., Verdood, P., Romeo, A. &
Hooghe-Peters, E.L. (1989) Transcriptional p at tern of 21-
hydroxylase gene ( P-450C21) during embryonic development,
before, and after birth in mice as determined by in situ hybrid-
ization. J. Histochem. Cytochem. 37, 751±756.
6. Engeland, W.C., Levay-Young, B.K., Rogers, L.M. & F itzgerald,
D. (1997) Dierential gene expression of cytochrome P45011b-
hydroxylase in rat adrenal cortex after in vivo activation. Endo-
crinology 138, 2338±2346.
7. Ogishima, T., Mitani, F. & Ishimura, Y. (1989) Isolation of
aldosterone synthase cytochrome P-450 from zona glomerulosa
mitochondria of rat adrenal cortex. J. Biol. Chem. 264, 10935±
10938.
8. Domalik, L.J., Chaplin, D.D., Kirkman, M.S., Wu, R.C., Liu,
W.W., Howard, T.A., Seldin, M.F. & Parker, K.L. (1991) D if-
ferent isozymes of mouse 11b-hydroxylase produce mineralocor-
ticoids and glucocorticoids. Mol. Endocrinol. 5, 1853±1861.
9. Mukai,K.,Imai,M.,Shimada,H.&Ishimura,Y.(1993)Isolation
and characterization of r at CYP11B genes involved in late s teps of
mineralo- and glucocorticoid syntheses. J. Biol. Chem. 268, 9130±
9137.
10. Rainey, W .E. (1999) A drenal zonation: clues from 11b-hydroxylase

and aldosterone synthase. Mol. Cell. Endocrinol. 151, 151±160.
11. Waterman, M.R. (1994) Biochemical diversity of cAMP-depen-
dent transcription o f steroid hydroxylase genes in the adrenal
cortex. J. Biol. Chem. 26 9, 27783±27786.
12. Reinhart, A.J., Williams, S.C. & Stocco, D.M. (1999) Tran-
scriptional regulation of the StAR gene. Mol. Cell. Endocrinol. 151,
161±169.
13. Lala, D .S., Rice, D.A. & Parker, K.L. (1992) Steroidogenic factor
I, a k ey regulator of steroidogenic enzyme expression, is the mouse
homolog of fu shi tarazu-factor I. Mol. Endocrinol. 6, 1249±1258.
14. Morohashi, K., H onda, S., Inomata, Y., Handa, H. & Omura,
T. (1 9 92 ) A common trans-acting factor, Ad4-binding protein, to
the promoters of steroidogenic P-450s. J. Biol. Chem. 267, 17913±
17919.
15. Luo, X., Ikeda, Y. & Parker, K.L. (1994) A cell-speci®c nuclear
receptor is essential for adre nal and gonadal development and
sexual dierentiation. Cell 77, 481±490.
16. Parker, K.L. & Schimmer, B.P. (1997) Steroidogenic factor 1: a
key determinant of endocrine development and funct ion. Endo-
crinol. Rev. 18, 361±377.
17. Mitani, F., Suzuki, H., Hata, J., Ogishima, T., Shimada, H. &
Ishimura, Y. (1994) A novel cell layer without corticosteroid-
synthesizing enzymes in rat adrenal cortex: histoch emical detec-
tion and possible p hysiological role. Endocrinology 135, 431±438.
18. Mitani, F., Ogishima, T., Miyamoto, H. & Ishimura, Y. (1995)
Localization of P450aldo and P45011b in normal and regenerating
rat adrenal cortex. Endocrinol. Res. 21, 413±423.
19. Mitani, F., Miyamoto, H ., Mukai, K. & Ishimura, Y. (1996)
Eects of long term stimulation of ACTH and angiotensin II-
secretions on the rat adren al corte x. Endocrinol. Res. 22, 421±431.

20. Mitani, F., Mukai, K., Ogawa, T., Miyamoto, H. & Ishimura, Y.
(1997) Expression of cytochromes P 450aldo and P45011b in rat
adrenal gland during late gestational and neonatal stages. Steroids
62, 57±61.
21. Ogishima, T., Suzuki, H., Hata, J., Mitani, F. & Ishimura, Y.
(1992) Zone-speci®c expression of aldosterone synthase cyto-
chrome P-450 and cytochrome P-45011b in rat adrenal co rtex:
histochemical basis for the functional zo nation. Endocrinology
130, 2971±2977.
22. Cain, A.J. & Harrison, R.G. (1950) Cytological and histochemical
variations in the adrenal cortex of the albino rat. J. Anat. 84,196±
226.
23. Cater,D.B. & L ever,J.D. (1954) The zona intermedia of the adrenal
cortex. A correlation of possible functio nal s igni®cance with
development, m orphology andhistochemistry. J. Anat. 88, 437±454.
24. Deane, H.W. & Greep, R.O. (1946) A morphological and histo-
chemical study of the rat's adrenal cortex after hypoph ysectomy,
with comments on the liver. Am.J.Anat.79, 117±145.
25. Hall, K. & Korenchevsky, V. (1937) Histological changes pro-
duced by castration and by sex hormones in th e adrenals of nor-
mal and of castrated male rats. Nature 140, 318.
26. Hartroft, P.M. & Eisenstein, A.B. (1957) Alterations in the adrenal
cortex of the rat induced by s odium de®ciency: correlation of
histologic changes with steroid hormone secretion. Endocrinology
60, 641±651.
27. Mitchell, R.M. (1948) Histological changes and mitotic activity in
the r at adrenal during postnatal development. Anat. Rec. 10 1,
161±185.
28. Nicander, L. (1952) Histological and histochemical studies on the
adrenal cortex of domestic and laboratory a nimals. Acta Anat. 14

(Supplement), 16.
29. Reiss, M., Balint, J., Oestreicher, F. & Aronson, V. (1936±7) Zur
morphogenetische n Wirkung und b iologishen Eichung der
kortikotropen Wirkstoes. Endokrinologie 18, 1±10.
30. Mitani, F., Mukai, K., Miyamoto, H. & I shimura, Y. (1998)
Localization of replicating cells in rat adrenal cortex during the
late gestational and early postnatal stages. Endocrinol. Res. 24,
983±986.
31. Mitan i, F., Mukai, K., Miyamoto, H., Suematsu, M. & Ishimura,
Y. (1999) Development of fu nctional zonation in the rat adrenal
cortex. Endocrinology 140, 3342±3353.
32. Miyamo to, H ., M itani, F., Mukai, K., Suematsu, M. & Ishimura,
Y. (1999) Studies on cytogenesis in adult rat adrenal cortex: cir-
cadian and zonal variations and their modulatio n by adrenocor-
ticotropic hormone. J. Biochem. 12 6, 1175±1183.
33. Miyamo to, H ., M itani, F., Mukai, K., Suematsu, M. & Ishimura,
Y. (2000) Daily regeneration of rat adrenocortical cells: circadian
and zonal variations in cytogenesis. Endocrinol. Res. 26, 899±904.
34. Morley,S.D.,Viard,I.,Chung,B.C.,Ikeda,Y.,Parker,K.L.&
Mullins, J.J. (1996) Variegated expression of a mouse steroid
21-hydrox ylase/b-galactosidase transgene suggests c en tripetal
migration of a drenocortical cells. Mol. Endocrinol. 10, 585±598.
35. Frederiksen, K., Jat, P.S., Valtz, N., Levy, D. & McKay, R. (1988)
Immortalization of precursor cells from the mammalian CNS.
Neuron 1, 439±448.
36. Renfranz, P.J., Cunningham, M.G. & McKay, R.D. (1991) Re-
gion-speci®c dierentiation of the hippocampal stem cell line HiB5
upon implantation into the developin g mamm alian brain. Cell 66,
713±729.
37. Yanai, N., Suzuki, M. & Obinata, M. (1991) Hepat ocyte cell lines

established from transgenic mice harboring te mperature-sensitive
simian virus 40 large T-antigen gene. Exp. Cell Res. 197, 50±56.
38. Jat, P.S. & Sharp, P.A. ( 1989) Cell lines established by a temper-
ature-sensitive simian virus 40 large-T-antigen gene are growth
restricted at the nonpermissive temperature. Mol. Cell. Biol. 9,
1672±1681.
80 K. Mukai et al. (Eur. J. Biochem. 269) Ó FEBS 2002
39. Obinata, M. (1997) Conditionally immortalized cell lines with
dierentiated functions established from temperature-sensitive
T-antigen transgenic mice. Genes Cells 2, 235±244.
40. Noble, M., Groves, A.K., Ataliotis, P., Ikram, Z. & Jat, P.S.
(1995) The H-2KbtsA58 transgenic mouse: a new tool for
the rapid generation of novel cell lines. Transgenic Res. 4, 215±
225.
41. Mukai, K., Mitani, F., Shim ada, H. & Ishimura, Y. (1995)
Involvement of an A P-1 complex in zone-speci®c expression of
the CYP11B1 gene in the rat adrenal cortex. Mol. Cell. Biol. 15,
6003±6012.
42. Yamane, I., Kan, M., Hoshi, H. & Minamoto, Y. (1981) Primary
culture of human diploid ce lls and its long-term transfe r in a
serum-free medium. Exp. Cell. Res. 134, 470±474.
43. I keda, Y., Lala, D.S., Luo, X., Kim, E., Moisan, M.P. & Parker,
K.L. (1993) Characterization of the mouse FTZ-F1 gene, which
encodes a ke y regulator of ste roid hydroxylase gene expression .
Mol. Endocrinol. 7, 852±860.
44. Hatano, O., Takayama, K., Imai, T., Waterman, M.R., Taka-
kusu, A., Omura, T. & Morohashi, K. (1994) Sex-dependent
expression of a transcription factor, Ad4BP, regulating steroido-
genic P-450 genes in the gonads during prenatal and postnatal rat
development. Development 120, 2787±2797.

45. Ikeda, Y., Shen, W.H., Ingraham, H.A. & Parker, K.L. (1994)
Developmental expression of mouse steroidogenic factor-1, an
essential regulator of the steroid h ydroxylases. Mol. Endocrinol. 8,
654±662.
46. C lark, B.J., Soo, S.C., Caron, K.M., Ikeda, Y., Parker, K.L. &
Stocco, D.M. (1995) H ormonal and deve lopmen tal regulation of
the s teroidogenic acute regulatory protein. Mol. Endocrinol. 9,
1346±1355.
47. Mukai, K., Mitani, F., Agake, R. & Ishimura, Y. (1998)
Adrenocorticotropic hormone stimulates CYP11B1 gene tran-
scription through a mechanism involving AP-1 fact ors. Eur. J.
Biochem. 256, 190±200.
48. T suyama, N., Miura, M., K itahira, M., Ishibashi, S. & Ide, T.
(1991) SV40 T- antigen is required for mainte nance of immortal
growth in SV40-transformed human ®broblasts. Cell Struct.
Funct. 16, 55±62.
49. O onk, R.B., Krasnow, J .S., Beattie, W.G. & Richa rds, J.S.
(1989) Cyclic AMP-dependent and -independent regulation of
cholesterol side chain cleavage cytochrome P-450 (P-450scc) in rat
ovarian granu losa c ells and corpora l utea. c DNA and deduced
amino acid sequence of rat P-450scc. J. Biol. Chem. 264, 21934±
21942.
50. Keeney, D.S., Ikeda, Y., Waterman, M.R. & Parker, K.L. (1995)
Cholesterol side-chain cleavage cytochrome P450 gene expression
in the primitive gu t of the mouse embryo does not require
steroidogenic factor 1. Mol. Endocrinol. 9, 1091±1098.
51. H asegawa, T., Zhao, L., Caron, K.M., Majdic, G., Suzuk i, T.,
Shizawa, S., Sasano, H. & Parker, K.L. (2000) Developmental
roles of the steroidogenic acute regulatory protein (StAR) as
revealed by StAR knockout mice. Mol. Endocrinol. 14, 1 462±

1471.
52. Stromstedt, M. & W.Aterman, M.R. (1995) Me ssenger RNAs
encoding steroidogenic enzymes are expressed in rodent brain.
Mol. Brain Res. 34, 75±88.
53. Sabath, D.E., Broome, H.E. & Prystowsky, M.B. (1990) Glycer-
aldehyde-3-phosphate deh ydrogen ase mRNA is a major inter-
leukin 2 -induced transcript in a cloned T-helper lymphocyte. Gene
91, 185±191.
54. Sugano, S., Morishima, N., Ikeda, H. & Horie, S. (1989) Sensitive
assay of cytochrome P450scc activity by high-performance liquid
chromatography. Anal. Biochem. 182, 327±333.
55. Schimmer, B.P. (1979) Adrenocortical Y1 cells. Methods Enzymol.
58, 570±574.
56. Rainey, W.E., Bird, I.M. & Mason, J.I. (1994) The NCI-H295 cell
line: a pluripotent model for human adre noco rtical studies. Mol.
Cell. Endocrinol. 100, 45±50.
57. Cheng, C.Y., Ryan, R., Vo, T.P. & Hornsby, P.J. (1989) Cellular
senescence involves stochastic processes causing loss of expression
of dierentiated function genes: transfection with SV40 as a means
for dissociating eects of senescence on growth and on dieren-
tiated function gene expression. Exp. Cell Res. 180, 49±62.
58. Mellon, S.H., M iller, W.L., B air, S.R., Moore, C.C., Vigne, J.L. &
Weiner, R.I. (1994) Steroidogenic adrenocortical cell lines pro-
duced by genetically targeted tumorig enesis in transgenic mice.
Mol. Endocrinol. 8, 97±108.
59. M orohashi, K., Iida, H., Nomura, M., Hatano, O., Honda, S.,
Tsukiyama, T., Niwa, O., H ara, T., T akakusu, A., Shibata, Y. e t a l.
(1994) Functional dierence between Ad4 BP and ELP, and their
distributions in steroidogenic tissues. Mol. Endocrinol. 8, 643±653.
60. Mason, J.I., Keeney, D.S., Bird, I.M., Rainey, W.E., Morohashi,

K., Leers-Sucheta, S. & Melner, M.H. (1997) The regulation of 3b-
hydroxysteroid dehydrogenase expression. Steroids 62, 164±168.
61. Hornsby, P.J., O'Hare, M.J. & Neville, A.M. (1974) Functional
and morphological observations on rat adrenal zona glomerulosa
cells in monolayer culture. Endocrinology 95, 1240±1251.
62. Engeland, W.C., Levay-Young, B.K., Paul, J.A. & Fitzgerald,
D.A. (1995) Expression of cytochrome P450 aldosterone synthase
and 11b-hydroxylase mRNA during adrenal regeneration. Endo-
crinol. Res. 21, 449±454.
63. Cammas, F.M., Pullinger, G.D., Barker, S. & Clark, A.J. (1997)
The mouse adrenocorticotropin receptor gene: cloning and char-
acterization of its promoter and evidence for a ro le for the
orphan nuclear receptor steroidogenic factor 1. Mol. Endocrinol.
11, 867±876.
64. Q iu, R., Frigeri, C. & Schimmer, B.P. (1998) A role for guanyl
nucleotide-binding regulatory protein b-andc-subunits in the
expression of th e adre nocorticotropin rec eptor. Mol. Endocrinol.
12, 1879±1887.
65. Halder,S.K.,Takemori,H.,Hatano,O.,Nonaka,Y.,Wada,A.&
Okamoto, M. (1998) Cloning of a membrane-spanning protein
with epidermal growth factor-like repeat motifs from adrenal
glomerulosa cells. Endocrinology 139, 3316±3328.
66. Engeland, W.C. & Levay-Young, B.K. (1999) Changes in the
glomerulosa cell p henotype during adrenal regeneration in rats.
Am.J.Physiol.276, R1374±R1382.
Ó FEBS 2002 Immortalized adrenocortical cell lines (Eur. J. Biochem. 269)81