Báo cáo toán học: "Role of One N-linked Oligosaccharide Chain on Canine Herpesvirus gD in Its Biological Activity" ppt

Role of One N-linked Oligosaccharide Chain on Canine Herpesvirus gD in Its Biological
Activity
Ken MAEDA, Naoaki YOKOYAMA
1)
, Kentaro FUJITA
1)
, Xuenan XUAN
2)
, and Takeshi MIKAMI
1)
*
Department of Veterinary Microbiology, Faculty of Agriculture, Yamaguchi University, 1677–1 Yoshida, Yamaguchi 753,
1)
Department
of Veterinary Microbiology, Faculty of Agriculture, The University of Tokyo, 1–1–1 Yayoi, Bunkyo-ku, Tokyo 113, and
2)
Research Center
for Protozoan Molecular Immunology, Obihiro University of Agriculture and Veterinary Medicine, Inada-cho, Obihiro, Hokkaido 080,
Japan
(Received 4 June 1997/Accepted 7 August 1997)
ABSTRACT. The YP11mu strain of a plaque-selected canine herpesvirus (CHV) encoded a smaller molecular weight (MW) of gD than those
of other strains including YP2 strain (Xuan et al., 1990). When nucleotide sequence of the mutated gD of YP11mu strain (gD(YP11mu))
was compared with that of gDs of other CHV strains, gD(YP11mu) lacked 12 nucleotides encoding 4 amino acids, NKTI, including one
predicted potential N-linked glycosylation site and no other change was found in other regions. When the gD(YP11mu) and gD of YP2
strain (gD(YP2)) expressed in COS-7 and insect (Spodoptera frugiperda; Sf9) cells were compared each other, both gDs reacted with a
panel of monoclonal antibodies (MAbs) against CHV gD by indirect immunofluorescence analysis and the gD(YP11mu) possessed an
MW of approximately 47–51 and 39–44 kDa in COS-7 and Sf9 cells, respectively, which were smaller than the expressed gD(YP2)
(approximately 51–55 and 41–46 kDa, respectively) by immunoblot analysis. After treatment with tunicamycin, the MW of both gDs in
Sf9 cells became approximately 37 kDa. When hemagglutination (HA) test using canine red blood cells (RBC) were carried out, lysates
of Sf9 cells expressing CHV gDs agglutinated canine RBC. Serum from mice inoculated with lysates of Sf9 cells expressing the gDs
possessed a high titer of virus-neutralizing (VN) activities against CHV. These results indicated that the deletion of 4 amino acids

possessing approximately 4 kDa of glyco-chain from gD of CHV in mammalian cells does not affect HA activity and VN antibody-
inducing activity and that this deletion of gD(YP11mu) might be a good selective marker for development of recombinant viruses as a live
vaccine. —
KEY WORDS: canine herpesvirus, glycoprotein D, hemagglutinin, N-glycosylation site, YP11mu strain.
J. Vet. Med. Sci. 59(12): 1123–1128, 1997
in the virus penetration process remains to be further
analyzed.
Xuan et al. [25] reported that one plaque-selected CHV,
YP11mu strain, possessed a smaller molecular weight (MW)
of gD than those of other strains including YP2 strain.
However its HA activity and reactivity with antibodies
against CHV were similar to those of other strains.
Therefore, it seems that mutation in the gD of YP11mu
strain does not affect biological activities of the gD. By
genetical analysis of this mutation, it is expected to obtain
further information on functional region of gD.
In this communication, we identified the mutated region
on the gD of YP11mu strain and expressed the gD in COS-
7 and insect (Spodoptera frugiperda; Sf9) cells. The CHV
gD expressed in COS-7 cells specifically adsorbed canine
RBC and extracts of CHV gD expressed in Sf9 cells
agglutinated canine RBC. Further, antibodies raised in mice
immunized with recombinant CHV gDs neutralized CHV
infection in vitro.
MATERIALS AND METHODS
Viruses and cells: Three isolates from our laboratory,
YP2, YP11, and the plaque-selected YP11 (YP11mu) [25],
two isolates from other laboratories, GCH-1 and Pirene [29],
and two reference strains, F-205V and Glasgow CHV2 of
CHV were used in this study. All CHV strains were grown

in Madin-Darby canine kidney (MDCK) cells for extraction
*CORRESPONDENCE TO: Dr. MIKAMI, T., Department of Veterinary
Microbiology, Faculty of Agriculture, The University of
Tokyo, 1–1–1 Yayoi, Bunkyo-ku, Tokyo 113, Japan.
We reported previously that canine herpesvirus (CHV)
gD agglutinated canine red blood cells (RBC) and that this
hemagglutination (HA) activity was inhibited by monoclonal
antibodies (MAbs) against CHV gD [16, 24, 25]. Similarly,
we reported that gD of feline herpesvirus type 1 (FHV-1)
agglutinated feline RBC and cells expressing the gD
adsorbed the RBC [13, 14]. Further, insect cells expressing
FHV-1 gD on their cell surface were adhered to several cell
lines originating from Felidae but not those from other
animals [15]. Therefore, we speculated that the FHV-1 gD
might restrict receptor(s) of cells from Felidae. One MAb
25C9 against FHV-1 gD recognized CHV gD by indirect
immunofluorescence assay (IFA) and immunoblot analysis,
and inhibited HA activity of CHV [12]. CHV gD
agglutinates only canine RBC [16, 19, 24] while FHV-1
agglutinates only feline RBC [4, 13, 14, 18]. The reason of
these different HA activities has never been studied.
In herpes simplex virus (HSV), gD seems to have specific
receptors on the surface of cells [8, 9]. In particular,
Brunetti et al. reported that gD binds to mannose-6-
phosphate receptors [2] and that this interaction is important
for virus entry into cells and cell-to-cell transmission [1].
The gDs of alphaherpesviruses are also important for virus
penetration to cells [3, 7, 10, 20]. However, the role of gD
1124
K. MAEDA, ET AL.

of viral DNA as described previously [16]. COS-7 cells
were cultured in DMEM supplemented with 10% FCS and
antibiotics. Recombinant Autographa californica nuclear
polyhedrosis viruses (rAcNPVs) were grown in Sf9 cells in
TC100 medium (GIBCO, Grand Island, N. Y.) supplemented
with 10% FCS, 0.3% tryptose phosphate broth (Difco,
Detroit, Mich.), and antibiotics. Two rAcNPVs, AccgD
(YP2) which expressed CHV gD of YP2 strain in insect
cells and AcYM [16], were used.
Construction of plasmids: Using two primers, 5’-
GGGAATTCATGATTAAACTTCTATTTAT-3’ (CGD-UP)
and 5’-TTCTCGAGCTAAACATTTGTTGTTAATT-3'
(CGD-DOWN), the gene encoding CHV gD YP11mu was
ampilified, digested with restriction enzymes EcoRI and
XhoI, and then cloned into EcoRI and XhoI sites of
pBluescript KS-, and designated as pBS-cgD (YP11mu)
[16]. For expression in COS-7 and Sf9 cells, plasmids pME-
cgD (YP11mu) and pAccgD (YP11mu), respectively, were
also constructed from pBS-cgD (YP11mu) into pME18S
[23] and pAcYM1 [17], respectively, as described previously
[15]. As a control, two expression plasmids, pME-cgD
(YP2) which expressed CHV gD (YP2) in COS-7 cells [16]
and pME-fgD which expressed FHV-1 gD in COS-7 cells
[13], were used.
DNA sequencing: To identify the mutated nucleotide
sequences of CHV gD (YP11mu), DNA sequencing of pBS-
cgD (YP11mu) was done with a model 370A Applied
Biosystems autosequencer, as described previously [16].
Polymerase chain reaction (PCR) amplification: To
clarify the deletion of YP11mu, two primers, 5’-

TTACCATCGAGGCCACATAT-3’ (CGD790F) and
5’-GGTGTTGGGGTAGTAGTATC-3’ (CGD902R), were
prepared. The viral DNAs of all CHV strains used were
amplified by 30 cycles of denaturation (94°C, 1 min),
annealing (60°C, 1 min), and polymerization (72°C, 2 min).
The amplified fragments were subjected to electrophoresis
on 12% polyacrylamide gel.
Expression in COS-7 cells: COS-7 cells were transfected
with the constructed plasmids according to the methods
described previously [21] with minor modifications. Briefly,
when COS-7 cells were grown in a 100 mm dish, 7.5
µ
g of
plasmid DNA prepared in 5 ml of DMEM/DEAE-dextran
solution was added to the cells. After incubation for 3 hr at
37°C, the solution was removed. The cells were treated
with 5 ml of 10% dimethyl sulfoxide for 1 min and returned
to DMEM containing 10% FCS. After 72 hr post-
transfection, the transfected cells were scraped off the plates
and analyzed by IFA, immunoblot analysis, and
hemadsorption (HAD) test.
Transfection and selection of recombinant baculovirus:
Sf9 cells were co-transfected with linealized BaculoGold
TM
baculovirus (AcNPV) DNA (PharMingen, San Diego, CA)
and pAccgD (YP11mu) by use of Lipofectin reagent
(GIBCO BRL, Gaithersburg, MD). After three cycles of
plaque purification, the recombinant virus was isolated, and
was designated as AccgD (YP11mu).
MAbs: MAbs 11F7, 09D1, 10C10, and 05B7 against CHV

gD and an MAb 25C9 against FHV-1 gD were previously
produced and characterized [5, 12, 25, 26].
IFA: For detection of CHV gD in IFA, transfected cells
were smeared on glass slides, air-dried and then fixed with
acetone. The fixed cells were incubated for 30 min at 37°C
with MAbs against CHV gD or FHV-1 gD. After
incubation, the slides were washed 3 times with PBS, and
then anti-mouse immunoglobulins (G+M+A) rabbit antibody
conjugated with fluorescein isothiocyanate (FITC) (Cappel,
PA, U.S.A.) was applied. After incubation for 30 min at
37°C, the slides were washed again, mounted in buffered
glycerol, and examined by fluorescence microscopy.
For membrane immunofluorescence, transfected cells
were suspended in ice-cold PBS containing 3% FCS and
0.1% sodium azide, and then reacted with MAbs for 30 min
at 4°C. After washing three times by ice-cold PBS
containing 3% FCS and 0.1% sodium azide, FITC-
conjugated anti-mouse immunoglobulins were added and
the cells were reincubated at 4°C. After further washings
for three times, the cells were resuspended in glycerol and
mounted for immunofluorescence microscopy.
Immunoblot analysis: SDS-polyacrylamide gel
electrophoresis (PAGE) was carried out according to the
discontinuous Laemmli buffer system [12]. All samples
were dissolved in the buffer (62.5 mM Tris-HCl, pH 6.8,
20% glycerol, and 0.001% bromophenol blue), and then
disrupted by heating for 2 min at 100°C. Polypeptides were
separated on an SDS-polyacrylamide gel and
electrophoretically transferred to polyvinylidene difluoride
membrane (Immunobilon, Millipore, MA, U.S.A.). The

blotting papers were incubated for 30 min at 37°C with a
mixture of four MAbs, 11F7, 09D1, 10C10, and 05B7,
against CHV gD, or an MAb 10C10. Afterwards, they
were washed three times, and incubated with anti-mouse
immunoglobulins (G+M+A) peroxidase conjugate (Cappel,
PA, U.S.A.) for 30 min at 37°C. The reaction was visualized
by addition of a diaminobenzidine-hydrogen peroxidase
substrate.
HAD and HA tests: HAD and HA activities of expressed
CHV gDs were tested as described previously [16].
Immunization of mice: Sf9 cells were infected with AccgD
(YP11mu), AccgD (YP2), or AcYM at 10 PFU/cell for 96
hr, washed, suspended in PBS and subjected to three cycles
of freezing and thawing. Lysates prepared from each of the
infected Sf9 cells (1 × 10
6
) cells were separately injected
into a mouse (Balb/c, 8 weeks old) intraperitoneally in
Freund’s complete adjuvant. The same lysate in Freund’s
incomplete adjuvant was injected intraperitoneally into the
mouse on days 14 and 28. Sera from immunized mice were
collected 14 days after the last immunization.
VN assay: Virus neutralizing activity of antisera was
tested in a 50% plaque reduction assay performed on MDCK
cells with or without 5% rabbit serum as a source of
complement. Neutralizing titers against CHV YP11mu
strain were expressed as the reciprocal antibody dilution
giving 50% plaque reduction.
1125
ROLE OF ONE N-LINKED OLIGOSACCHARIDE CHAIN ON CHV GD

RESULTS
Cloning and sequence analysis of the gene encoding CHV
gD (YP11mu): Approximately 1.05 kbp fragment containing
an open reading frame (ORF) encoding gD (YP11mu) was
amplified from viral DNA by PCR method using two
primers, CGD-UP and CGD-DOWN. This amplified
fragment was inserted into pBluescript KS- and was
designated as pBS-cgD (YP11mu). Nucleotide sequence of
the insert fragment of pBS-cgD (YP11mu) was determined
and compared with that of 1,050 bp published for CHV gD
[11]. The result showed that the nucleotide sequence for
the ORF of gD (YP11mu) was 1038 bp and lacked 12
nucleotides, AATAAAACTATT (position at 823–834
nucleotides), which encodes four amino acids, NKTI
(position at 275–278 amino acids) (Fig. 1A). No other
change was found in the ORF of gD (YP11mu).
Further PCR analysis was carried out to confirm the
deletion using two primers, CGD790F and CGD902R. The
113 bp fragment amplified by these primers contains the
region of mutation of gD (YP11mu). Figure 1B showed
that the amplified fragment of only YP11mu strain was 101
bp and was smaller than those (113 bp) of other six CHV
strains. These results indicate that this 12 bp deletion was
specific for YP11mu strain.
Expression of CHV gDs in COS-7 cells: Expression of
CHV gD (YP11mu) in COS-7 cells was examined by IFA
using MAbs. All of the MAbs against CHV gD and one
MAb 25C9 against FHV-1 gD reacted with pME-cgD
(YP11mu)-transfected COS-7 cells as well as with pME-
cgD (YP2)-transfected COS-7 cells (data not shown).

Expression of CHV gD (YP11mu) in COS-7 cells was
further confirmed by immunoblot analysis using a mixture
of four MAbs, 11F7, 09D1, 10C10, and 05B7 against CHV
gD (Fig.2A). The MW of the authentic CHV gD (YP11mu)
was approximately 47–51 kDa with a minor band of
approximately 44 kDa which seems to be a precursor form
of the CHV gD. These bands were smaller than those
(approximately 51–55 and 48 kDa) of pME-cgD (YP2)-
transfected COS-7 cells. In pME-fgD-transfected cells, any
specific band was not detected (Fig. 2A lane3).
Expression of CHV gDs in insect cells: Expression of
CHV gD (YP11mu) in Sf9 cells was examined by IFA using
MAbs. All of the MAbs against CHV gD and one MAb
25C9 against FHV-1 gD reacted with AccgD (YP11mu)-
infected Sf9 cells as well as with AccgD (YP2)-infected Sf9
cells (data not shown).
Expression of CHV gD (YP11mu) was confirmed by
immunoblot analysis using an MAb 10C10 against CHV
gD (Fig. 2B). The MAb 10C10 detected a specific band of
39–44 and 41–46 kDa in AccgD (YP11mu)- and AccgD
(YP2)-infected Sf9 cells, respectively (Fig. 2A). When
AccgD (YP11mu)- and AccgD (YP2)-infected Sf9 cells
were treated with 10
µ
g/ml of tunicamycin (TM), the both
MWs of the TM-treated gD (YP11mu) and gD (YP2) were
approximately 37 kDa (Fig. 2B lanes 3 and 4). Since CHV
gD consists of 345 amino acid residues with a predicted
MW of approximately 38 kDa [10], the estimated MW of
the TM-treated gDs seems to be reasonable.

HAD and HA tests: We examined whether cells expressed
CHV gD (YP11mu) could adsorb canine red blood cells
(RBC) and whether the expressed CHV gD (YP11mu) could
Fig. 1. Differences in the nucleotide and amino acid sequences of gDs among CHV strains. (A) Nucleotide sequence of
heterogeneous region between CHV YP2 and YP11mu strains. Double dots show identical nucleotide sequence. Bars show
gaps. NKT showed by a box indicates potential asparagine-linked glycosylation site. Two primers, CGD790F and antisense of
CGD902R are boxed. (B) Amplification of the heterogeneous region in several CHV strains. Arrows show length of fragments.
1126
K. MAEDA, ET AL.
agglutinate canine RBC. The transfected cells were used
for HAD test using canine RBC. It was shown that both
pME-cgD (YP11mu)- and pME-cgD (YP2)-transfected
COS-7 cells adsorbed canine RBC. These HAD reactions
were inhibited by treatment of the cells with HI MAbs
against CHV gD (data not shown).
Extracts of Sf9 cells infected with recombinant
baculoviruses were used for HA test using canine RBC.
The results showed that extracts of Sf9 cells infected with
AccgD (YP11mu) or AccgD (YP2) agglutinated canine
RBC. In addition, these HA activities were inhibited by HI
MAbs against CHV gD (data not shown).
Immunogenicity of the gD expressed in Sf9 cells against
mice: Mice were inoculated three times with AccgD
(YP11mu)-, AccgD (YP2)- or AcYM-infected Sf9 cell
lysate. As shown in Table 1, pooled serum from mice
immunized with lysates from Sf9 cells (1 × 10
6
) infected
with AccgD (YP11mu) or AccgD (YP2) possessed high
titers of VN activity. No VN activity was detected in serum

from mice immunized with AcYM-infected Sf9 cells.
DISCUSSION
Sequence analysis showed that twelve nucleotides,
AATAAAACTATT, were deleted in the gene of gD
(YP11mu) (Fig. 1A). In addition, two repeat sequences,
ACTATTAATAAAACTATTAA, flanking this mutated
region, existed in the gD gene of YP2 strain and other strains
including the parent strain of YP11mu strain (Fig. 1B).
Therefore, this mutation of gD (YP11mu) might be
accidentally caused by flanking within these repeat
sequences, because this YP11mu strain was highly passaged
in vitro and then plaque-purified.
The gD gene of YP11mu strain lacked twelve nucleotides
sequence encoding four amino acids, NKTI, which
possessed a calculated MW of 474 daltons (Fig. 1A), but
this deletion of 4 amino acids sequence caused reduction of
MWs of approximately 4 kDa in mammalian cells and
approximately 2 kDa in insect cells (Fig. 2), indicating that
this amino acid sequence, NKT, is a N-linked glycosylation
site [6] which possessed approximately 4 kDa of glyco-
chain in mammalian cells and approximately 2 kDa of
glyco-chain in insect cells. Mice immunized with gD
(YP11mu) or gD (YP2) produced a high titer of
complement-dependent and complement-independent VN
antibodies (Table 1), indicating that this deletion region in
CHV gD (YP11mu) might not affect complement-dependent
and complement-independent VN antibodies-inducing
activities. These results showed that this deleted
glycosylation site in the gD (YP11mu) does not affect HAD
activity, HA activity and immunogenicity. Xuan et al. [25]

reported that both YP2 and YP11mu strains grew well in
MDCK cells, and that HA activity of lysates from YP11mu
strain-infected cells were similar to those of other several
CHV strains including YP2 strain. In gDs of HSV-1 and
BHV-1, N-linked oligosaccharides are not essential for viral
pathogenesis in the mouse model, and the antigenic
properties are not altered by carbohydrate removal [22, 28].
These reports support our observation that deletion of N-
linked glycosylation in gD (YP11mu) does not affect
biological activities of CHV gD. Although the role of other
two potential N-linked glycosylation sites of CHV gD
remains to be further analyzed, CHV gDs expressed in insect
cells possessed HA, HAD and VN antibody-inducing
activities in spite of immature glycosylation, indicating that
glycosylation of CHV gDs might not affect these biological
activities.
In conclusion, we identified one N-linked glycosylation
site which does not affect HA and HAD activities and
immunogenicity of CHV gD. Further analysis of essential
Table 1. Immunogenic properties of recombinant gDs
Serum against VN titer
a)
w/o C’ w C’
AccgD (YP11mu) 320 1280
AccgD (YP2) 80 2560
AcYM <40 <40
a) Neutralization titer was expressed as the reciprocal of a
serum dilution giving a 50% reduction in plaque number
compared with the control.
w/o C’: without complement.

w C’: with complement.
Fig. 2. Immunoblot analysis of gDs expressed in COS-7
or Sf9 cells. (A) Immunoblot analysis of gDs expressed
in COS-7 cells with a mixture of MAbs against CHV
gD. Lane 1; pME-cgD (YP2)-transfected COS-7 cells,
lane 2; pME-cgD (YP11mu)-transfected COS-7 cells,
and lane 3; pME-fgD-transfected COS-7 cells. (B)
Immunoblot analysis of gDs expressed in Sf9 cells with
an MAb 10C10 against CHV gD. Lanes 1 and 3; AccgD
(YP2)-infected Sf9 cells, and lanes 2 and 4; AccgD
(YP11mu)-infected Sf9 cells. Lanes 3 and 4;
recombinant baculovirus-infected cells were treated
with 10
µ
g/ml of tunicamycin. Bars show specific
bands. Molecular weight (in kilodaltons) are indicated
at the left.
1127
ROLE OF ONE N-LINKED OLIGOSACCHARIDE CHAIN ON CHV GD
regions for HA and HAD activities and immunogenicity
would be expected to understand the initial stage of
herpesvirus infection. In addition, this deletion of gD
(YP11mu) might be a good selective marker for
development of a live recombinant vaccine. Indeed, Xuan
et al. [27] expressed rabies virus glycoprotein using the
YP11mu strain as a vector and examined the biological and
immunological characteristics of the recombinant virus in
vitro and in vivo.
ACKNOWLEDGEMENTS. This work was supported in
part by grants from the Ministry of Education, Science,

Sports and Culture, from the Ministry of Agriculture,
Forestry and Fisheries and by Research Aid of Inoue
Foundation for Science.
REFERENCES
1. Brunetti, C. R., Burke, R. L., Hoflack, B., Ludwig, T.,
Dingwell, K. S., and Johnson, D. C. 1995. Role of mannose-
6-phosphate receptors in herpes simplex virus entry into cells
and cell-to-cell transmission. J. Virol. 69: 3517–3528.
2. Brunetti, C. R., Burke, R. L., Kornfeld, S., Gregory, W.,
Masiarz, F. R., Dingwell, K. S., and Johnson, D. C. 1994.
Herpes simplex virus glycoprotein D acquires mannose 6-
phosphate residues and binds to mannose 6-receptors. J. Biol.
Chem. 269: 17067–17074.
3. Fuller, A. O. and Spear, P. G. 1987. Anti-glycoprotein D
antibodies that permit adsorption but block infection by her-
pes simplex virus 1 prevent virion-cell fusion at the cell
surface. Proc. Natl. Acad. Sci. U.S.A. 84: 5454–5458.
4. Horimoto, T., Kasaoka, T., Tuchiya, K., and Takahashi, E.
1989. Identification of feline herpesvirus type 1-hemaggluti-
nin. Jpn. J. Vet. Sci. 51: 607–612.
5. Horimoto, T., Limcumpao, J. A., Tohya, Y., Takahashi, E.,
and Mikami, T. 1990. Feline herpesvirus type 1 glycopro-
teins eliciting virus neutralizing and hemag
glutination-inhibiting antibodies. Arch. Virol. 111: 127–132.
6. Hubbard, S. C. and Ivatt, R. J. 1981. Synthesis and process-
ing of asparagine-linked oligosaccharides. Annu. Rev.
Biochem. 50: 555–583.
7. Hughes, G., Babiuk, L. A., and van Drunen Little-van den
Hurk, S. 1988. Functional and topographical analyses of
epitopes on bovine herpesvirus type 1 glycoprotein IV. Arch.

Virol. 103: 47–60.
8. Johnson, D. C., Burke, R. L., and Gregory, T. 1990. Soluble
forms of herpes simplex virus glycoprotein D bind to a lim-
ited number of cell surface receptors and inhibit virus entry
into cells. J. Virol. 64: 2569–2576.
9. Johnson, D. C. and Ligas, M. W. 1988. Herpes simplex vi-
ruses lacking glycoprotein D are unable to inhibit virus
penetration: Quantitative evidence for virus-specific cell sur-
face receptors. J. Virol. 63: 4605–4612.
10. Ligas, M. W. and Johnson, D. C. 1988. A herpes simplex
virus mutant in which gD sequences are replaced by beta-
galactosidase sequences binds to but unable to penetrate into
cells. J. Virol. 62: 1486–1494.
11. Limbach, K. J., Limbach, P., Conte, D., and Paoletti, E. 1994.
Nucleotide sequence of the genes encoding the canine herp-
esvirus gB, gC and gD homologues. J. Gen. Virol. 75:
2029–2039.
12. Limcumpao, J. A., Horimoto, T., Xuan, X., Tohya, Y.,
Azetaka, M., Takahashi, E., and Mikami, T. 1991. Homolo-
gous and heterologous antibody responses of mice immunized
with purified feline herpesvirus type 1 and canine herpesvirus
glycoproteins. J. Vet. Med. Sci. 53: 423–432.
13. Maeda, K., Kawaguchi, Y., Ono, M., Inoshima, Y., Miyazawa,
T., Tohya, Y., Kai, C., and Mikami, T. 1994. A gD homolo-
gous gene of feline herpesvirus type 1 encodes a hemagglutinin
(gp60). Virology 202: 1034–1038.
14. Maeda, K., Ono, M., Kawaguchi, Y., Niikura, M., Okazaki,
K., Yokoyama, N., Tokiyoshi, K., Tohya, Y., and Mikami, T.
1996. Expression and properties of feline herpesvirus type 1
gD (hemagglutinin) by a recombinant baculovirus. Virus Res.

46: 75–80.
15. Maeda, K., Ono, M., Kawaguchi, Y., Okazaki, K., Yokoyama,
N., Tokiyoshi, K., Tohya, Y., and Mikami, T. 1997. Adhe-
sion of insect cells expressing the feline herpesvirus type 1
hemagglutinin (gD) to feline cell lines. J. Vet. Med. Sci. 59:
217–219.
16. Maeda, K., Xuan, X., Kawaguchi, Y., Ono, M., Yokoyama,
N., Fujita, K., Tohya, Y., and Mikami, T. 1997. Characteriza-
tion of canine herpesvirus glycoprotein D (hemagglutinin). J.
Vet. Med. Sci. 59: 1003–1009.
17. Matsuura, Y., Possee, R. D., Overton, H. A., and Bishop, D.
H. L. 1987. Baculovirus expression vectors: the requirements
for high-level expression of proteins, including glycoproteins.
J. Gen. Virol. 68: 1233–1250.
18. Mochizuki, M., Konishi, S., and Ogata, M. 1977. Studies on
cytopathogenic viruses from cats with respiratory infections.
III. Isolation and certain properties of feline herpesviruses.
Jpn. J. Vet. Sci. 39: 27–37.
19. Nemoto, K., Horimoto, T., Xuan, X., Kusanagi, K., Takumi,
A., Tohya, Y., Azetaka, M., Takahashi, E., and Mikami, T.
1990. Demonstration of canine herpesvirus-specific hemag-
glutination. Jpn. J. Vet. Sci. 52: 395–398.
20. Okazaki, K., Honda, E., Minetomo, T., and Kumagai, T. 1986.
Mechanisms of neutralization by monoclonal antibodies to
different antigenic sites on the bovine herpesvirus type 1
glycoproteins. Virology 150: 260–264.
21. Seed, B. and Aruffo, A. 1987. Molecular cloning of the CD2
antigen, the T-cell erythrocyte receptor, by a rapid
immunoselection procedure. Proc. Natl. Acad. Sci. U.S.A. 84:
3365–3369.

22. Sodora, D. L., Cohen, G. H., Muggeridge, M. I., and
Eisenberg, R. J. 1991. Absence of asparagine-linked oligosac-
charides from glycoprotein D of herpes simplex virus type 1
results in a structurally altered but biologically active protein.
J. Virol. 65: 4424–4431.
23. Takebe,Y., Seiki, M., Fujisawa, J., Hoy, P., Yokota, K., Arai,
K., Yoshida, M., and Arai, N. 1988. SRα promoter: an effi-
cient and versatile mammalian cDNA expression system
composed of the simian virus 40 early promoter and the R-
U5 segment of human T-cell leukemia virus type 1 long
terminal repeat. Mol. Cell. Biol. 8: 466–472.
24. Xuan X., Kojima, A., Murata, T., Mikami, T., amd Otsuka,
H. 1997. Analysis of canine herpesvirus gB, gC and gD ex-
pressed by a recombinant vaccinia virus. Arch. Virol. 142:
1003–1010.
25. Xuan, X., Horimoto, T., Limcumpao, J. A., Nemoto, K.,
Tohya, Y., Azetaka, M., Takahashi, E., and Mikami, T. 1990.
Canine herpesvirus 47 kD and mutated 41 kD glycoproteins
are responsible for hemagglutinination. Jpn. J. Vet. Sci. 52:
899–905.
1128
K. MAEDA, ET AL.
26. Xuan, X., Horimoto, T., Limcumpao, J. A., Takumi, A., Tohya,
Y., Takahashi, E., and Mikami, T. 1991. Neutralizing deter-
minants of canine herpesvirus as defined by monoclonal
antibodies. Arch. Virol. 116: 185–195.
27. Xuan, X., Tuchiya, K., Sato I., Nishikawa, Y., Onodera, Y.,
Takashima, Y., Yamamoto, A., Katsumata, A., Iwata, A.,
Ueda, S., Mikami, T., and Otsuka, H. 1997. Biological and
immunogenic properties of rabies virus glycoprotein expressed

by canine herpesvirus vector. Virology (Submitted for publi-
cation).
28. van Drunen Little-van den Hurk, S., Hughes, G., and Babiuk,
L. A. 1990. The role of carbohydrate in the antigenic and
immunogenic structure of bovine herpesvirus type 1 glyco-
protein gI and gIV. J. Gen. Virol. 71: 2053–2063.
29. Yanagisawa, T., Azetaka, M., Midoro, K., Takahashi, R.,
Fujiwara, K., and Sawa, K. 1987. Fatal herpesvirus infection
in a litter of puppies. Jpn. J. Vet. Sci. 49: 519–522.