Functional analysis of the nuage, a unique germline organelle, in drosophila melanogaster 2

34

2 Materials and Methods
2.1 Molecular work
2.1.1 Recombinant DNA methods
2.1.1.1 Strains and culture conditions
Escherichia coli strains DH5α or XL1-Blue was used for all recombinant DNA
procedures unless otherwise stated. For the use of restriction endonucleases that are
sensitive to dam methylation, a dam negative strain JM110 was used. For pENTR/D-
TOPO cloning, TOP10 E. coli (Invitrogen) was used. For protein expression in E. coli,
BL21(DE3) was employed. All bacterial strains were cultured in Luria-Bertani [LB; 1%
(w/v) bacto-tryptone, 0.5% (w/v) yeast extract, 1% (w/v) sodium chloride (NaCl)] broth
or grown on agar plates at 37°C. For drug resistance selection, the culture media was
supplemented with the antibiotics ampicillin (100 μg/ml), kanamycin (50 μg/ml), or
chloroamphenicol (37 μg/ml).

2.1.1.2 Bacterial glycerol stocks
A fresh colony was cultured in LB, supplemented with the respective antibiotics, by
shaking at 250 revolutions per min (rpm) at 37°C until the optical density (OD
600
)
reached 0.8. Glycerol was added to a final concentration of 12% (v/v) on ice and the
glycerol stock was stored at -80°C.

35

2.1.1.3 Plasmid DNA preparation
For small-scale and large-scale plasmid DNA preparation, Geneaid High Speed Mini Kit
and Geneaid Plasmid Maxi Kit were used in accordance to the manufacturer’s
instructions, respectively. DNA concentration was determined using NanoDrop ND-1000
Spectrophotometer (BioFrontier Technology).

2.1.1.4 Polymerase Chain Reaction (PCR)
Standard PCR and colony PCR were performed in the presence of 50 ng template DNA,
200 μM deoxynucleotide triphosphate (dNTP), 500 μM of each primer (forward and
reverse), and 0.4 units (U) Taq polymerase (iDNA Biotechnology) with the cycling
conditions: 1 cycle of 94°C for 2 min, 25-33 cycles of 94°C for 30 sec/55-62°C for 30
sec/72°C for 1 min per kb, 72°C for 10 min. For high fidelity amplification, either
PfuUltra (Stratagene) or Pfx (Invitrogen) polymerase was used in accordance to the
manufacturers’ instructions. All primer sequences can be found in Table IV.

2.1.1.5 Restriction digestion
Digestion of plasmid DNA or dsDNA fragments was carried out using restriction
endonucleases (Roche) in accordance to the manufacturer’s instructions.

2.1.1.6 Sequencing
Standard cycling reaction was performed using BigDye Terminator v3.1Cycle
Sequencing kit (Applied Biosystems) in the presence of 50-100 ng template DNA and
200 μM of each primer (forward or reverse) with the following conditions: 25 cycles of
36

94°C for 2 min/50°C for 30 sec/60°C for 4 min, 60°C for 10min. The reactions were then
analysed on 3730x1 DNA Analyser (Applied Biosystems).

2.1.2 Bacterial transformation
2.1.2.1 Preparation of heat-shock competent cells
E. coli cells were cultured in SOB [2% (w/v) bacto-tryptone, 0.5% (w/v) yeast extract, 10
mM NaCl, 2.5 mM potassium chloride (KCl), 10 mM magnesium chloride (MgCl
2
), 10
mM magnesium sulphate (MgSO

4
)] at 37°C until the OD
600
reached 0.6. The cells were
then chilled on ice for 10 min and harvested by spinning at 3000 rpm at 4°C. The pellet
was resuspended in TB media [10 mM 1,4-Piperazinediethanesulfonic acid, Piperazine-
1,4-bis(2-ethanesulfonic acid), Piperazine-N,N′-bis(2-ethanesulfonic acid (PIPES), 55
mM manganese chloride (MnCl
2
), 15 mM calcium chloride (CaCl
2
), 250 mM KCl] and
incubated on ice for 10 min. The cell suspension was centrifuged and fresh TB was added
to the bacterial pellet. The cells were used directly for transformation or alternatively,
stored for long-term in 7% (v/v) dimethyl sulfoxide (DMSO) at -80°C.

2.1.2.2 Preparation of electrocompetent cells
E. coli cells were cultured in LB broth at 37°C until the OD
600
reached 0.5-0.7. The cells
were then chilled on ice for 10-15 min and harvested by spinning at 4200 rpm at 4°C.
Following two resuspensions in ice-cold water, the cells were ready for electroporation.
Electrocompetent cells were stored for long-term in 10% (v/v) glycerol at -80°C.

37

2.1.2.3 Transformation
For heat-shock transformation, competent cells were mixed with an appropriate volume
of DNA and incubated on ice for 30 min. The DNA/cell mixture was then heat-shocked
at 42°C for 60 sec and immediately placed on ice. For electroporation, competent cells

were mixed with an appropriate volume of DNA and transferred to a pre-chilled
electrocuvette on ice. The DNA/cell mix was pulsed once at 2.5 kilovolts (kV) and 25
microfarad (μF), and immediately placed on ice. Following either transformation, 1 ml of
LB was added to each mixture and mixed gently before incubating the culture at 37°C,
with shaking at 250 rpm for 1 hr to allow for plasmid expression. The cells were then
plated on LB agar supplemented with the respective antibiotics, depending on the
plasmids.

2.1.3 Cloning strategies and constructs
2.1.3.1 Conventional cloning
Restriction digests of vector DNA and PCR fragments were performed in accordance to
the manufacturers’ instructions. To dephosphorylate the 5’- end of the digested vector
DNA, 1 U of calf intestinal phosphatase (Roche) was added to the restriction digest and
incubated at 37°C for 60 min. To fill the 3’- end of staggered DNA, 1 U of Klenow
enzyme (Roche) and 1 U of polynucleotide kinase (Roche) was added to the digested
DNA and incubated at 37°C for 20 min, in the presence of 20 pmol adenosine
triphosphate (ATP) and 250 μM dNTP. Ligation was set up with a vector:insert molar
ratio of 3:1, in the presence of 3 U T4 DNA ligase (Roche). Sticky-end and blunt-end
38

ligations were incubated at 16°C and room temperature, respectively for up to 16 hr. Half
the ligation volume was then used for bacterial transformation.

2.1.3.2 Gateway® cloning
Gateway® cloning is a two-step procedure, which comprises of a directional TOPO
cloning of the gene-of-interest or DNA fragment into pENTR™/D-TOPO® (Appendix
II, Invitrogen), followed by a site-specific recombination step to swap the DNA from
pENTR™/D-TOPO® into the destination vectors (Appendix III, The Drosophila
Gateway™ Vector Collection, .

For TOPO cloning, PCR product with a flanking CACC sequence at the 5’- end and a
blunt 3’- end was mixed with pENTR™/D-TOPO® in a molar ratio of 2:1, and incubated
at room temperature for 30 min. Half the ligation mixture was then transformed into
OneShot® TOP10 chemically competent E. coli (Invitrogen) in accordance to the
manufacturer’s instructions.

For site-specific recombination, equal volumes of pENTR™/D-TOPO® harbouring the
gene-of-interest or DNA fragment and the Gateway® destination vectors were mixed, in
the presence of LR Clonase™ II enzyme mix (Invitrogen). The DNA/enzyme mix was
incubated at 25°C for 2 hr to promote recombination. The reaction was subsequently
terminated by adding Proteinase K and incubating at 37°C for 20 min. One-half of the
reaction mix was used for transformation.

39

2.1.3.3 TA cloning
PCR products that were amplified using Taq polymerase were used directly for TA
cloning. For blunt-ended PCR products, A-tailing was performed by incubating the
purified DNA duplex with 0.2 mM dATP and 5 U Taq polymerase at 70°C for 30 min.

For TA cloning, pGEM®-T Easy vector (Promega) and insert DNA were mixed in the
molar ratio 1:3 and incubated for 60 min at room temperature or overnight at 4°C (up to
16 hr). One-half of the ligation mix was then used for transformation. Recombinant
clones were identified using the blue-white selection, where the presence of an insert in
pGEM®-T Easy vector disrupts the ß-galactosidase gene and produces white bacterial
colonies. 5-bromo-4-chloro-3-indolyl-β-D-galactoside (X-Gal) and isopropyl β-D-1-
thiogalactopyranoside (IPTG) were added as substrates, and to a final concentration of
0.5 mM and 80 μg/ml, respectively.

2.1.4 Single-fly PCR

2.1.4.1 Preparation of fly genomic DNA
D. melanogaster genomic DNA was prepared by mashing a single fly in 50 μl squishing
buffer [10 mM Tris-Cl pH 8.2, 1 mM ethylenediaminetetraacetic acid (EDTA), 25 mM
NaCl, and 200 pg/ml freshly diluted Proteinase K (Sigma)] with a pipette tip (Gloor and
Engels, 1992; Gloor et al., 1993). The squished fly was subsequently incubated at 37°C
for 20-30 min, followed by a heat-inactivation step at 65°C for 10 min. Single fly
genomic DNA preps were stored at 4°C or -20°C.

40

2.1.4.2 Genomic DNA PCR
Genomic DNA PCR was performed as described in 2.1.1.4. 1 μl of genomic DNA was
used per PCR.

2.1.5 Total RNA extraction
Ovaries were dissected in cold Grace’s medium and transferred to TRIzol reagent
(Invitrogen) on ice. Total RNA was extracted from the ovaries in accordance to the
manufacturer’s instructions. Extracted total RNA was reconstituted to a final
concentration of approximately 2-3 μg/μl and stored at -80°C.

2.1.6 Poly A
+
RNA purification
Total RNA extracted from at least 50 ovaries was used for poly A
+
RNA purification
using the Oligotex mRNA kit (QIAgen) in accordance to the manufacturer’s instructions.

2.1.7 DNase treatment
DNase treatment was performed by incubating total RNA with DNaseI (Roche) at room

temperature for up to 15 min. 1 U of DNaseI was used per μg total RNA. Following
treatment, DNaseI was heat-inactivated by adding EDTA pH 8.0 to a final concentration
of 2.5 mM and incubating the samples at 65°C for 10 min.

2.1.8 Reverse transcription (RT)
1 µg of DNase-treated total RNA was reverse-transcribed using oligo(dT)
15
and
Superscript III reverse transcriptase (Invitrogen). A mock reaction without reverse
41

transcriptase was also prepared for each RNA sample. The newly-synthesized
complementary DNAs (cDNAs), following treatment with RNaseH (Stratagene), were
first normalised and checked for genomic DNA contamination by performing PCR with
actin5C (act5C) or alcohol dehydrogenase (adh) primers.

2.1.9 Semi-quantitative and quantitative PCR
Semi-quantitative PCR was performed as described in 2.1.1.4 using 1 µl per cDNA
sample/reaction. Quantitative PCR was similarly carried out, except with a change to the
use of Bio-Rad MyQ™ Single-Colour Real-Time PCR Detection System, in the presence
of iQ™ SYBR® Green Supermix (Bio-Rad). Control experiments measuring the change
in C
T
with template dilution were performed on the target genes and the control act5C.
All the results were normalised with respect to act5C. P-values were measured using one-
tailed student T-test. All primer sequences can be found in Table IV.

2.1.10 Poly(A) tail test (PAT)
2.1.10.1 Rapid Amplification of cDNA Ends-PAT (RACE-PAT)
1-3 µg of DNase-treated ovarian total RNA was reverse-transcribed using oligo(dT)

anchor

and Avian myeloblastosis virus (AMV) Reverse Transcriptase (Promega, (Salles et al.,
1999). A mock reaction without reverse transcriptase was prepared for each RNA sample.
The newly synthesized cDNAs were checked for genomic DNA contamination by PCR
with act5C primers. PCR was subsequently performed using 1 µl diluted or neat cDNA
sample/reaction as described in 2.1.1.4. For analyses of retroelement de-repression,
primer sets corresponding to act5C and HeT-A untranslated regions (UTRs), coding
42

sequence (CDS), and poly(A) regions were used. All primer sequences can be found in
Table IV.

2.1.10.2 Ligation-mediated PAT (LM-PAT)
3 µg of total RNA from ovaries from each sample was treated with DNaseI as described
in 2.1.7. LM-PAT assay was performed as described in (Salles et al., 1999). Amplified
products were visualised on 3% (w/v) agarose/1x Tris Boric EDTA gel. All primer
sequences can be found in 2.6.

2.1.11 Decapping assay
Total RNA from ovaries (100 ng) was incubated with Terminator™ 5’-phosphate-
dependent exonuclease (1 U, Epicentre) in a 10 μl-reaction at 30°C for 3 hrs. Reactions
were terminated by adding 0.5 μl of 100 mM EDTA pH 8.0. To check levels of cyclin B
(cycB) and U1 expression, one-step RT-PCR was performed using diluted or neat total
RNA according to manufacturer’s instructions (Invitrogen). All primer sequences can be
found in Table IV.

2.2 Fly genetics
2.2.1 Fly husbandry and stocks
D. melanogaster were cultured on standard cornmeal-agar medium at 25°C. For ovary

staining, y w was used as a wild-type control unless otherwise stated. FM6, sco/CyO and
TM3/TM6B were used as first, second, and third chromosome balancers, respectively.
Mutant alleles and allelic combinations used were vas
PH165
(Styhler et al., 1998),
43

krimp
f06583
(Bloomington Drosophila Stock Center), krimp
f06583
/Df(2R)Exel6063
(Bloomington Drosophila Stock Center), aub
N11/HN2
(Schupbach and Wieschaus, 1991;
Wilson et al., 1996), mael
M391
/Df(3L)79E-F (Clegg et al., 1997; Hartenstein and Jan,
1992), spn-E
616/hls3987
(Gillespie and Berg, 1995; Gonzalez-Reyes et al., 1997), dcr-
2
L811fsX
(Hatfield et al., 2005), armi
KG04664
(Bloomington Drosophila Stock Center), b53;
T3 (an insertion mutant for dcp1 that harbours a rescue transgene for a neighbouring
gene, CG5602; (Lin et al., 2006), twin
KG00877
/Df(3R)crb-F89-4 (Bloomington Drosophila

Stock Center), ski3
f03251
/Df(2R)Np5 (Bloomington Drosophila Stock Center), and pcm
∆1

(Appendix I). As homozygous dcr-1
Q1147x
is lethal, mitotic clones were generated by
subjecting 2-day old female flies [hsFLP/eyFLP;FRT82BUbi- green fluorescence protein
(GFP)/FRT82Bdcr-1
Q1147x
] to heat-shock at 37°C for 1.5 hr. The treated flies were then
aged for 7 to 10 days prior to immunostaining. Me31B-GFP and Protein disulfide
isomerase (PDI)-GFP fly lines were obtained from Carnegie Protein Trap Library
(Buszczak et al., 2007). Flies carrying the transgene, UASp-aub-GFP (Harris and
Macdonald, 2001), UASp-dcp1-Haemagglutinin (HA) (Lin et al., 2006), UASp-krimp-
Venus[Yellow fluorescence protein (YFP)] or UASp-krimp(variants)-MYC were crossed
to flies harbouring the nosgal4VP16 transgene to drive the expression of tagged proteins
in the female germline (Van Doren et al., 1998). For ms2/MS2 Coat Protein (MCP)
labeling of the retroelement transcripts, flies carrying UASp-hs-HeT-A-(ms2)
6
, UASp-hs-
I-element-(ms2)
6
or the control UASp-hs-nanos(nos)-(ms2)
6
were crossed to those
expressing MCP-GFP (Forrest and Gavis, 2003) and the F
1
progenies were subjected to a

heat-shock treatment to induce gene expression (see 2.5).

44

2.2.2 Generation and clean-up of mutant alleles
pcm loss-of-function allele was generated by standard imprecise excision (Bachmann and
Knust, 2008; O'Connor and Chia, 2002) of the P-element insertion EP1526 (Bloomington
Stock Center), a homozygous viable DNA element that was inserted 584 nt downstream
of the polyadenylation site. EP1526 was mobilised by crossing virgin females that carried
this insertion to males that possessed the ∆2-3 transposae (Bloomington Stock Center).
More than 100 independent excision lines were screened for the deletion of pcm CDS
using single-fly PCR (described in 2.1.4.2 and Appendix I).

The original krimp
f06583
and ski3
f03251
mutant lines from the Stock Center exhibited male
sterility and lethality, respectively due to background mutations. Both fly stocks were
cleaned up by backcrossing to y w prior to the use of these alleles for all the experiments
described.

2.2.3 Generation of transgenic flies by microinjection
1 hr old y w embryos were collected on cornmeal-agar plates and dechlorionated in 50%
(v/v) chlorox for 2 min. Dechlorionated embryos were washed extensively with deionised
water, aligned on a nitrocellulose membrane and then adhered onto a coverslip. The
embryos were dried in silica gel for approximately 12-15 min and covered with a thin
layer of halocarbon oil. Plasmid DNA and helper DNA were injected manually under the
microscope at a concentration of 100 ng/μl and the embryos were allowed to hatch in a
wet chamber. The emerged flies were crossed to sco/CyO or TM3/TM6B balancer flies.

Transgenic flies were identified by the orange eye colour in the F
1
progenies.
45


Transgenes that were microinjected include UASp-krimp full length (FL)-Venus, UASp-
krimp N-terminus (NT)-MYC, UASp-krimp C-terminus (CT)-MYC, UASp-ago3FL-HA,
pCaSpeR-hs-HeT-A-(ms2)
6
, and pCaSpeR-hs-I-element-(ms2)
6
. For the construction of
UASp-krimp(variants)-Venus/MYC and UASp-ago3FL-HA, expressed sequence tag
(EST) clones RE66405 and LD17152 were used as templates, respectively. The PCR
products were cloned into pENTR™/D-TOPO® (Invitrogen) and recombined into the
destination vectors pPVW, pPMW, and pPHW using Gateway® technology (see 2.1.3.2).
The construction of pCaSpeR-hs-HeT-A-(ms2)
6
and pCaSpeR-hs-I-element-(ms2)
6
are
described in 2.5.1. All primer sequences can be found in Table IV.

2.3 Immunohistochemistry and Microscopy
2.3.1 Antibody staining of fixed ovaries
Ovaries were dissected in Grace’s medium (BioWhittaker) and immediately fixed for 5
min at room temperature in the fixative solution (2 parts of Grace’s medium to 1 part of
16% paraformaldehyde, electron microscopy grade). After several washes with PBX
{PBS [10 mM sodium phosphate monobasic (NaH

2
PO
4
)/sodium phosphate dibasic
(Na
2
HPO
4
) pH 7.4, 175 mM NaCl] containing 0.1% Triton X-100}, the fixed ovaries
were pre-absorbed in PBX containing 5% normal goat serum (The Jackson Laboratory)
for at least 30 min at room temperature. The ovaries were then rinsed twice with PBX
and incubated with the primary antibodies diluted in PBX containing 0.5% (w/v) bovine
serum albumin (BSA, Sigma) for 4 hr at room temperature or overnight at 4°C. After
several washes in PBX, the ovaries were incubated in secondary antibodies diluted in
46

PBX containing 0.5% (w/v) BSA for 4 hr at room temperature. The ovaries were further
washed in PBX and stained with 4’,6-diamidino-2-phenylindole (DAPI). Following two
rinses with PBS, the ovaries were mounted in Vectashield (Vector Laboratories).

Antibodies that were used for immunostaining are summarised in Table II. Alexa Fluor
(488, 555 or 633) conjugated goat anti-mouse, anti-rat, anti-rabbit, and anti-guinea pig
(1:400, Molecular Probes Invitrogen) were used as secondary antibodies.

Table II Antibodies for immunohistochemistry
Protein Animal origin Working dilution Source(s)
AGO3 mouse 1:200 inhouse
ARF6 mouse (3A-1) 1:50 Santa Cruz Biotechnology
AUB rabbit 1:1000
A gift from Hong Han, McGill

University, Montreal, Quebec,
Canada
C(3)G guinea pig 1:500 (Page and Hawley, 2001)
CD63 mouse 1:5 ID Laboroatory
GRK mouse (1D12) 1:10 (Queenan et al., 1999)
dDCP1 rabbit 1:20
(Lin et al., 2006)
dDCP2 rabbit 1:200
GFP
mouse (3E6) 1:200 Invitrogen
rabbit 1:1000
Torrey Pines Biolabs, Houston,
TX
HA mouse 1:1000 BEAM-ETC
KRIMP
rat 1:200
inhouse
rabbit 1:10 000
LAMP2
mouse
(GL2A7)
1:5 Cayman Chemical
MAEL rabbit 1:200 (Findley et al., 2003)
Me31B mouse 1:500
A gift from Akira Nakamura,
RIKEN Center for Developmental
Biology, Kobe, Osaka, Japan
MYC mouse (9E10) 1:1000 Sigma
OSK rat 1:100
A gift from Paul Lasko, McGill

University, Montreal, Quebec,
47

Canada
PCM rabbit 1:600 (Barbee et al., 2006)
TER94 mouse 1:50
A gift from JimWilhelm,
University of California, San
Diego, La Jolla, CA
VAS
rat 1:200
A gift from Paul Lasko
rabbit 1:500

2.3.2 piRNA Fluorescence in situ Hybridisation (FISH)
2.3.2.1 In vitro transcription of RNA probes
Digoxygenin (DIG)-labeled RNA probes were transcribed using double-stranded DNA
harbouring a T7 promoter and the antisense HeT-A piRNA or 2S ribosomal RNA (rRNA)
sequence (Table IV) at 37°C for 2 hr. The reaction was terminated by incubating at 65°C
for 10 min following the addition of EDTA pH 8.0 to a final concentration of 2.5 mM.
Synthesized RNA probes were stored at -20°C for up to a week.

2.3.2.2 FISH
Ovaries were dissected and fixed as described in 2.3.1. Fixed ovaries were washed in
PBS containing 0.1% (v/v) Tween-20 and hybridised at 42°C overnight in Hyb buffer
[0.5 μg/μl yeast transfer RNA, 50% (w/v) dextran sulphate, 100 mM PIPES pH 8.0, 10
mM EDTA pH 8.0, 3 M NaCl; (Pontes et al., 2006)] containing 2 μg of denatured RNA
probes. Ovaries were washed sequentially in 2x SSC (150 mM NaCl, 150mM sodium
citrate)/50% (v/v) formamide, 1x SSC/50% (v/v) formamide, 1x SSC and PBX for 10
min each. DIG-labeled RNA probes were detected using anti-DIG horseradish peroxidase

(POD) antibody (1:100, Roche) with fluorescence amplification for 1-1.5 hr at room
temperature (Tyramide Signal Amplification kit, Perkin Elmer).
48

2.3.3 Microscopy and image processing
Images were captured at room temperature with a 3-Photomultiplier Tube detector using
a 40x or 63x 1.3 NA Plan-Apochromat oil objective in an upright confocal microscope
(EXCITER or LSM510; Carl Zeiss, Inc.) controlled by LSM 5 program software. For
quantification of cytoplasmic nuage and P-body overlaps in Figure 3.3.3a, single confocal
sections of stage 5-7 egg chambers were counted manually. At least 3 egg chambers from
different ovarioles were scored for each nuage/P-body combination. For AUB, which
exhibited fewer cytoplasmic foci, 5-8 egg chambers were scored. All images were
processed with Adobe Photoshop CS3.

2.4 Biochemistry
2.4.1 Recombinant protein expression and purification
krimp (163
rd
to 306
th
and 461
st
to 540
th
amino acids ), ski3 (1131
st
to 1233
rd
amino acids),
and ago3 (78

th
to 252
nd
amino acids) antigen sequences were amplified with EST clones
RE66405, LP07472, and LD17152, respectively. All primer sequences can be found in
Table IV. Antigen sequences were cloned into pENTR™/D-TOPO (Invitrogen) and
recombined into pDEST
15
GST and/or pDEST
17
HIS (Invitrogen) in accordance to the
manufacturer’s instruction manual (2.1.3.2).

For protein expression, each construct was transformed into the bacterial strain
BL21(DE3). A fresh colony was then picked and cultured in LB in the absence of
antibiotics at 37°C, shaking at 250 rpm until the OD
600
reached 0.6. The expression of
each fusion protein was induced by adding IPTG to a final concentration of 0.4 mM and
49

the cells were cultured for another 3-4 hr. The cells were then harvested by centrifugation
at 2000 rpm for 20 min at 4°C.

To prepare the cell lysate, the cell pellet was resuspended on ice with 4 ml lysis buffer
(20 mM sodium phosphate pH 7.4, 0.5 M NaCl, 1 mg/ml lysozyme), supplemented with
400 pmol phenylmethylsulphonyl fluoride (PMSF) per gram of cell pellet. The
resuspended cells were lysed by subjecting the cell suspension to four times of 1 min-
sonication/1 min-interval at an output of 20-30 watts on ice. The cell debris was removed
by centrifugation at 10 000xg for 30 min at 4°C.

GST- and HIS-tagged fusion proteins were purified from the supernatant using
Glutathione Sepharose High Performance and Ni Sepharose High Performance
(Amersham Biosciences), respectively in accordance to the manufacturer’s instructions.
Purified recombinant proteins were stored at -20°C.


2.4.2 Antibody generation and affinity purification
The GST fusion proteins were used for antibody generation in mice for AGO3 and in rats
for KRIMP antigen (Ag) 461 and SKI3. KRIMP Ag163 was sent to Zymed Laboratories
Inc. (South San Francisco, USA) for antibody generation in rabbits. For immunisation,
antigens were mixed with complete or incomplete Freund’s adjuvant (Pierce) and
vortexed vigorously for 60 min at 4°C to form emulsions. For each injection, 0.1 mg, 0.2
mg, and 0.25 mg of antigen/adjuvant emulsions were respectively administered
intramuscularly and/or intraperitoneally to mice, rats, and rabbits. Six rounds of
50

immunisation were usually performed per antigen. The animals were bled in accordance
to standard animal handling procedures.

To prepare the anti-serum, the bleeds were first left at room temperature for 30 min to
deactivate the complement and subsequently, overnight at 4°C to allow clotting. To
separate the serum, the bleeds were centrifuged at maximum speed for 30 min at 4°C.
Glycerol and sodium azide were added to final concentrations of 50% (v/v) and 0.1%
(w/v), respectively and the anti-serum was kept at -20°C or -80°C.

KRIMP Ag163 rabbit polyclonal antibodies were affinity purified using HIS-tagged
KRIMP fusion protein conjugated to a HiTrap NHS-activated HP affinity column
(Amersham Biosciences) and Bio-Rad Low Pressure Chromatography System in
accordance to the manufacturer’s instructions. KRIMP Ag163 rabbit polyclonal

antibodies were collected in fractions eluted with 0.2 M glycine-hydrochloric acid (HCl).
Eluted antibodies were concentrated by dialysing in 50% (v/v) glycerol/PBS overnight at
4°C. Sodium azide was added to a final concentration of 0.1% (w/v) and the anti-serum
was stored in aliquots at -80°C.

2.4.3 Immunological detection of proteins
Bacterial cells were lysed in 2x sample buffer [4% (w/v) sodium dodecyl sulphate (SDS),
200 mM dithiothreithol (DTT), 300 mM Tris-HCl pH 6.8, 20% (v/v) glygerol, 0.04%
(w/v) bromophenol blue] by vortexing at high speed for 1-2 min and then boiling for 5
min. Ovary lysates were prepared as described in (Drummond-Barbosa and Spradling,
51

2004). For both bacterial and ovary cell lysates, the cell debris was removed by
centrifugation at maximum speed for 20 min at 4°C. The supernatants were stored at -
20°C or -80°C.

Proteins were separated on 8-12% (v/v) polyacrylamide gels [8-12% (v/v)
acrylamide/bis-acrylamide (29:1, Bio-Rad), 375 mM Tris-HCl pH 8.8, 0.1% (v/v) SDS,
0.1% (w/v) ammonium persulphate (APS), 0.4% (v/v) N,N,N',N'-
Tetramethylethylenediamine (TEMED)] using a Bio-Rad gel electrophoresis system at
100 V. For direct visualisation of proteins on the gels, the gels were stained with
coomassie brilliant blue staining buffer [0.0025% (w/v) coomassie brilliant blue R250 in
1 part glacial acetic acid: 9 parts of 50% (v/v) methanol]. For immunological detection,
the proteins were first transferred by electrophoretic blotting onto nitrocellulose or
polyvinylidene fluoride (PVDF) membrane (Bio-Rad) in the transfer buffer [3.03 g/L
Tris-base, 14.4 g/L glycine, 20% (v/v) methanol] at 100 V for 60 min. Blocking was
performed in 5% (w/v) skimmed milk in Tris buffered saline (20 mM Tris, 150 mM
NaCl, pH 7.5) containing 0.05% (v/v) Tween-20 (TBST) for at least 30 min at room
temperature. The membrane was subsequently incubated in the primary antibody solution
[5% (w/v) BSA in TBST] at 4°C overnight or for 60 min at room temperature, followed

by six vigorous washes with TBST for 10 min each. The secondary antibody step was
performed in TBST for 45 min at room temperature and washes were similarly carried
out. Detection was performed with SuperSignal® West Pico Chemiluminenscence
substrate (Thermo Scientific) and the signals were visualised on Kodak BioMax MS film.

52

Antibodies that were used for immunoblotting are summarised in Table III. Detection
was performed using rabbit-, rat-, and mouse-conjugated HRP (1:6000-1:10 000, Bio-
Rad).

Table III Antibodies for immunoblotting
Protein Animal origin Working dilution Source(s)
ACT
mouse
(JLA20)
1:500
Developmental Studies
Hybridoma Bank, The University
of Iowa
dDCP1 rabbit 1:1000 (Lin et al., 2006)
GFP rabbit 1:2500 BD Biosciences
HA mouse 1:1500 BEAM-ETC
Me31B mouse 1:2500
A gift from Akira Nakamura,
RIKEN Center for Developmental
Biology, Kobe, Osaka, Japan
MYC mouse (9E10) 1:5000 Sigma
PCM rabbit 1:2000 (Barbee et al., 2006)
SKI3 rat 1:500 inhouse

2.4.4 Co-immunoprecipitation (co-IP) of protein complexes
2.4.4.1 In vivo co-IP
For one co-IP, 150-200 ovaries were dissected in ice-cold Grace’s medium. The dissected
ovaries were homogenised in 250 μl lysis buffer [150 mM NaCl, 50 mM Tris pH 8.0,
0.05% (v/v) Nonidet P-40 (NP-40), 100 U RNase inhibitor, Complete® EDTA-free
protease inhibitor (Roche)] on ice. The cell debris was removed by centrifuging at 14 000
rpm for 20 min at 4°C. The supernatant was then pre-absorbed with equilibrated Protein
A/G beads (Calbiochem) and immunoglobulin G (IgG)-coupled beads for 60 min each at
4°C. Co-IP was performed overnight at 4°C with guinea pig anti-GFP (1:200, gift from
Mohan Balasubramanian, Temasek Life Sciences Laboratory, Singapore)- or mouse anti-
53

HA (BEAM-ETC)- coupled Protein A/G beads. Following co-IP, the beads were rinsed
five times with the wash buffer [150 mM NaCl, 50 mM Tris pH 8.0, 0.05% (v/v) NP-40]
to remove unbound proteins. To minimise the elution of IgG, 24 μl of 2x sample buffer
lacking DTT was first added to each sample, followed by an incubation at 70°C for 5
min. The beads were then collected by spinning at 12 000 rpm for 1 min at 4°C. 6 μl of 1
M DTT was added to the eluate, mixed, and boiled for 5 min before loading onto the
polyacrylamide gel. Immunological detection was subsequently performed as described
in 2.4.3.

2.4.4.2 In vitro co-IP
Full-length krimp, aub, cuff, ago3, and mael were amplified using the EST clones
RE64405, LD23107, IP10749, LD17152, and LD20229 as templates, respectively, and
cloned into pGBKT7-MYC or pGADT7-HA (Invitrogen). All primer sequences can be
found in Table IV. 3-4 μg template DNA was in vitro transcribed and translated using
T
NT® rabbit reticulocyte lysate system (Promega) by incubating at 25°C for 2 hr. The
lysate containing the translated fusion proteins were used directly for co-IP. Pre-

absorption and co-IP were performed as described in 2.4.4.1.

2.4.5 Northern analyses of transcripts and piRNAs
Total RNA was used directly for polyacrylamide gel electrophoresis (PAGE) northern of
piRNAs, northern analysis of retroelement transcripts, RT-PCR, decapping, and PAT
assays. For northern analysis of krimp transcript, polyA
+
RNA purified from ovaries were
used.
54


For northern analysis of transcripts, DIG DNA probes were synthesized by PCR in the
presence of 1x DIG DNA labeling mix (Roche) or by random priming with the High
Prime DNA Labeling Kit (Roche). The EST clone RE66405, pBluescript rp49, amplified
full-length gapdh, pGEM-T Easy ms2, pCaSpeR-hs-HeT-A-(ms2)
6
, and pCaSpeR-hs-I-
element-(ms2)
6
were used as templates to synthesize probes for detecting krimp, rp49,
gapdh, ms2, HeT-A, and I-element, respectively. All primer sequences can be found in
Table IV. 200 ng polyA
+
RNA or 5 μg total RNA were loaded and separated in a
formaldehyde/MOPS 1% (w/v) agarose gel, transferred onto a Hybond N+ nylon
membrane (Amersham Biosciences) and then cross-linked. Hybridisation was performed
at 45°C in DIG Easy Hyb buffer and detection was carried out according to the
manufacturer’s instructions (Roche). The signals were visualised on Kodak BioMax MS
film. For stripping, the blots were incubated with boiling 0.5% (v/v) SDS. rRNA was

visualised using 0.02% (w/v) methylene blue in 0.3 M sodium acetate pH 5.2.

For radioactive PAGE northern analysis of the piRNAs, RNA probes were synthesized
from the linearised templates by in vitro transcription using either T7 or SP6 RNA
polymerase (Roche), in the presence of [γ-
32
P] UTP (3000 Ci/mmol, 10 mCi/ml).
Templates were pGEM-T harboring PCR product amplified with primer sets
corresponding to roo, I-element, and HeT-A (Table IV). 10 µg or 20 µg of total RNA
from the ovaries were separated on a 15% polyacrylamide/8 M urea denaturing gel,
transferred onto a Hybond N+ Nylon membrane (Amersham Biosciences) and cross-
linked. Hybridisation was performed at 62°C in Church buffer [0.25 M sodium phosphate
55

pH 7.2, 1 mM EDTA pH 8.0, 7% (w/v) SDS, 1% (w/v) BSA], containing radio-labeled
sense roo, I-element or HeT-A RNA probes. The membranes were analysed by Typhoon
9200 (Amersham Biosciences). For non-radioactive PAGE northern analysis of piRNAs,
all steps were similarly performed with changes to the use of 1x DIG RNA labeling mix
for probe synthesis, DIG Easy Hyb buffer for hybridisation, and anti-DIG alkaline
phosphatase for detection.

2.5 ms2/MCP-GFP labeling system of mRNAs
2.5.1 ms2/MCP-GFP labeling of retroelement transcripts
HeT-A or I-element genomic sequences and six tandem stem-loop binding sites for MCP
were amplified using y w genomic DNA and pSL-ms2-6 (Bertrand et al., 1998) as
templates, respectively. All primer sequences are provided in Table IV. Amplified HeT-A
was digested with XbaI and BglII and cloned into pCaSpeR-hs. Amplified I-element was
cloned into pGEM-T Easy, digested with NotI, and recloned into pCaSpeR-hs. pGEM-T
Easy harbouring six copies of MCP binding sites was digested with EcoRI, blunted with
Klenow fragment, and ligated into the StuI site of pCaSpeR-hs HeT-A and the blunted

XbaI site of pCaSpeR-hs I-element, respectively. These plasmids were microinjected into
y w embryos as described in 2.2.3.

2.5.2 Visualisation of artificial retroelement transcripts
The transgenes HeT-A-(ms2)
6
, I-element-(ms2)
6
or the control nos-(ms2)
6
, and MCP-GFP
(Forrest and Gavis, 2003) were co-expressed in aub or krimp control and mutants by
56

subjecting female flies to a heat-shock regimen of 1.5hr at 36°C every 12 hrs for a
duration of 1.5 days. Immunostaining was performed 2 days after heat-shock.

2.5.3 Timecourse (pulse-chase) of artificial HeT-A transcript
aub control and mutant flies harbouring HeT-A-(ms2)
6
were subjected to 2 hr of heat-
shock at 36°C. Ovaries were dissected in cold Grace’s medium at 0, 20, 40, 60, 80, 100,
120 min, 6 hr and 12 hr post heat-shock termination and immediately frozen in TRIzol
reagent (Invitrogen) at -80°C until RNA extraction. Northern blotting was performed as
described in 2.4.5. For mRNA abundance measurement, band intensities corresponding to
HeT-A ms2 were quantified using ImageJ and normalised to gapdh transcript.

2.6 Primers

Table IV Primer sequences

Primer names Primer sequences
Transgenes for microinjection
krimp FL FW caccatgaatctggaggacatt
krimp FL RV ttggctaacctgagcgta
ms2 FW cgaattctaaggtacctaattgcctag
ms2 RV cgaattcatcgatcgcgcgcagatcta
HeT-A BglII FW ccagatctatgtccatgtccgacaaccttt
HeT-A XbaI RV ccctctagatccgggtgcgtttaggtgagtg
I-element BglII FW ccagatctatgacagacccaccaaacattt
I-element XbaI RV ccctctagaaactaattgctggcttgttatg
Antibody generation
ago3 Antigen (Ag) FW caccaaaacagatgaccatacatc
ago3 Ag RV ttattttggacgcgaaggatcaa
ski3 Ag FW cacccgaatgtttcccaattcccga
57

ski3 Ag RV tgaatttgcaataatagcgga
krimp Ag163 FW cacctcagaagagagagacgct
krimp Ag163 RV ttagatttgattgtagatatc
krimp Ag461 FW caccgccaatatgcattgctttgtt
krimp Ag461 RV aatgcgttgctcgtccttggg
Probes for northern
krimp FW actgccattgcaggagttgg
krimp RV gtcccacaccaacggcggag
T7 taatacgactcactataggg
T3 aattaaccctcactaaaggg
SP6 catacgatttaggtgacactatatag
ms2 FW cgaattctaaggtacctaattgcctag
ms2 RV cgaattcatcgatcgcgcgcagatcta
gapdh FW atgtcgaagatcggaattaac

gapdh RV ttagtccttgctctgcatatactt
piRNA FISH
antisense HeT-A piRNA probe FW taatacgactcactataggctcattaacgagtatagggg
gtgct
antisense HeT-A piRNA probe RV agcaccccctatactcgttaatgagcctatagtgagtcgt
atta
antisense 2S rRNA probe FW taatacgactcactataggctgcttggactacatatggtt
gagggttgta
antisense 2S rRNA probe RV tacaaccctcaaccatatgtagtccaagcagcctatagt
gagtcgtatta
LM-PAT, RACE-PAT, RT-PCR and single-fly PCR
cycB PAT FW accactaagcaacgattaaaacacg
cycB PAT RV caggattgataagaatgcaggacaaaa
HeT-A PAT FW ttgcaatatgttaatgttaccagtccatg
HeT-A 3’UTR RV actttgctggtggaggtacggagacagagtaaattctgt
t
HeT-A 5’UTR FW cataatactccacgcgcaaa
HeT-A 5’UTR RV cgtcttttggcttcttctcc
HeT-A 5’CDS FW attgccctcaaatcaagcag
HeT-A 5’CDS RV gtggacggaggagaagacaa
HeT-A 3’CDS FW tcattgacgataccagcgcatc
HeT-A 3’CDS RV tccgggtgcgtttaggtgag
act5C FW tgcccatctacgagggttat
act5C RV agtacttgcgctctggcgg
pcm-Ex FW cgcttttgttttggttttggt
pcm-Ex RV gggactatctgagcaccttcc
pcm-1 FW ttcccaagttctttcgctaca
58

pcm-2 RV ggaatatctgctcctcctcca

pcm-3 FW tcctcaacgtggagcactact
pcm-4 RV gacgtgccgcatttactttc
pcm-5 FW agtttacaaggtgcccgaaat
pcm-6 RV tcacatagcgactgctggtc
pcm-7 FW cgaatctgatggggtctcaac
pcm-8 RV gtcgggcagtatgtattccaa
nat1 FW cactacgactacatgcgcgata
nat1 RV gaacttggcgcagatctcc
gapdh FW atgtcgaagatcggaattaac
gapdh RV ttagtccttgctctgcatatactt
ski3-1 FW aaatgtggctcctttctgctt
ski3-2 RV cttgcactgggttcagagttc
ski3-3 FW aggacattcgggagaccataa
ski3-4 RV atttcaggcagttcgttgct
ski3-5 FW aggaaattggacaggaaaacg
ski3-6 RV agatcatccaagggcaaatct
roo FW tcctttaagcatcttacagctaaagg
roo RV tttagctgtaagatgcttaaaggagct
I-element FW gaccaaataaaaataatacgacttc
I-element-RV aactaattgctggcttgttatg
HeT-A FW tcattgacgataccagcgcatc
HeT-A RV tccgggtgcgtttaggtgag
TART FW ttctatcaacaggctgtccacaggtt
TART RV ccttcgtagtcgggtaggattattcgt
mst40 FW aaaagacagacatgccttcgctccc
mst40 RV ctggggtaaccttgaacttcgtctga
Cap analysis
cycB 5'UTR FW aactcgatcaggttttcggata
cycB 5'UTR RV gcttggctatcacttggtttg
U1 FW gcatacttacctggcgtagagg

U1 RV accaaaaattacacgcacgag