DẠY HÓA BẰNG TIẾNG ANH HÓA HỮU CƠ (p4)

CHAPTER 15

ORGANIC COMPOUNDS AND THE ATOMIC
PROPERTIES OF CARBON
CHAPTER REVIEW GUIDE
The following sections provide many aids to help you study this chapter. (Numbers in
parentheses refer to pages, unless noted otherwise).
Learning Objectives These are concepts and skills you should know after studying this
chapter.
Relevant section (§), sample problem (SP), and upcoming end of chapter problem (EP)
numbers appear in parentheses.
1. Explain why carbon’s atomic properties lead to formation of four strong bonds,

multiple bonds, chains, and functional groups (§15.1) (EPs 15.1-15.4)
2. Name and draw alkanes, alkenes, and alkynes with expanded, condensed, and carbon3.
4.
5.
6.
7.

skeleton formulas (§15.2) (SPs 15.1, 15.2a-c) (EPs 15.5, 15.9-15.18, 15.29)
Distinguish among constitutional, optical, and geometric isomers (§15.2) (SP 15.2d,
e) (EPs 15.6-15.8, 15.19- 15.28, 15.30, 15.31)
Describe three types of organic reactions (addition, elimination, and substitution) and
identify each type from reactants and products (§15.3) (SP 15.3) (EPs 15.32- 15.36)
Understand the properties and reaction types of the various functional groups (§15.4)
(SPs 15.4-15.6) (EPs 15.37— 15.58)
Discuss the formation of addition and condensation polymers and draw abbreviated
polymer formulas (§15.5) (EPs 15.59-15.67)
Describe the three types of natural polymers, explain how amino-acid sequence
determines protein shape, and thus function, draw small peptides, and use the

sequence of one DNA strand to predict the sequence of the other (§15.6) (EPs 15.6815.79)

HƯỚNG DẪN ÔN TẬP CHƯƠNG Những phần bên dưới đưa ra các lời giải nhằm giúp
các bạn học tốt chương này. (số trong ngoặc đơn là số trang, trừ các ghi chú khác.)
Mục tiêu học tập Dưới đây là những kĩ năng và khái niệm để ôn tập sau khi học chương
này.
Phần liên quan (), bài tập ví dụ (SP), và ví dụ kết thúc chương (EP) những số được đặt trong
ngoặc.
1. Giải thích tại sao tính chất nguyên tử cacbon lại dẫn đến việc hình thành bốn liên kết
bền, liên kết bội, chuỗi và nhóm chức (15.1) (Eps 15.1-15.4)
2. Danh pháp và cách vẽ ankan, anken, ankin với công thức khai triển, thu gọn, và thu gọn
nhất (15.2) (SPs 15.1, 15.2a-c) (EPs 15.5, 15.9-15.18, 15.29)
3. Phân biệt giữa đồng phân lập thể, đồng phân quang học và đồng phân hình học (15.2)
(SP 15.2d, e) (Eps 15.6-15.8, 15.19-15.28, 15.30, 15.31)


4. Mô tả ba loại phản ứng hóa học hữu cơ (phản ứng cộng, phản ứng tách và phản ứng thế)
và xác định mỗi loại từ các chất tham gia và chất sản phẩm (15.3) (SP 15.3) (Eps 15.3215.36)
5. Hiễu rõ tính chất và những loại phản ứng của các nhóm chức khác nhau (15.4) (SPs
15.4-15.6) (Eps 15.37-15.58)
6. Thảo luận về sự hình thành của các polime phản ứng trùng cộng và phản ứng trùng
ngưng, viết các công thức viết tắ của polime (15.5) (Eps 15.59-15.67)
7. Mô tả ba loại polime tự nhiên, giải thích tại sao chuỗi axit amin tại quyết định đến hình
dạng protein, và suy ra chức năng, viết các chuỗi peptit nhỏ, và sử dụng chuỗi của một
sợi DNA để suy đoán ra chuỗi khác (15.6) (Eps 15.68-15.79)

Key Terms These important terms appear in boldface in the chapter and are defined again in
the Glossary.
Introduction

alkene (CnH2n) (640)

organic compound (629)

unsaturated hydrocarbon (640)

Section 15.1

geometric (cis-trans) isomers (641)

heteroatom (631)

alkyne (CnH2n—2) (643)

functional group (631)

aromatic hydrocarbon (644)

Section 15.2

Section 15.3

hydrocarbon (632)

alkyl group (646)

alkane (CnH2n+2) (635)

addition reaction (647)

homologous series (635)

elimination reaction (648)

saturated hydrocarbon (635)

substitution reaction (648)

cyclic hydrocarbon (637)

Section 15.4

isomers (637)

alcohol (650)

constitutional (structural) isomers (637)

haloalkane (alkyl halide) (652)

stereoisomers (639)

amine (652)

optical isomers (639)

carbonyl group (655)

chiral molecule (639)

aldehyde (655)

polarimeter (640)

ketone (655)

optically active (640)

organometallic compound (656)


carboxylic acid (657)

Section 15.6

ester (657)

monosaccharide (666)

amide (657)

polysaccharide (666)

fatty acid (658)

disaccharide (666)

acid anhydride (658)

protein (667)

lipid (658)

amino acid (667)

hydrolysis (659)

nucleic acid (670)

nitrile (661)

mononucleotide (670)

Section 15.5

double helix (671)

addition polymer (663)

base pair (671)

condensation polymer (664)

genetic code (671)

Những thuật chính
Các thuật ngữ quan trọng xuất hiện trong phần in đậm bên dưới được định nghĩa lại trong
phần Thuật ngữ.
Giới thiệu
các hợp chất hữu cơ (460)

Phần 15.1
sự liên kết thành chuỗi (460)
nguyên tử khác loại (461)
nhóm chức (461)
Phần 15.2
hydrocacbon (462)
ankan (CnH2n+2) (464)
dãy đồng đẳng (464)
hydrocacbon no (464)
cyclic hydrocacbon (466)
đồng phân (467)
đồng phân cấu trúc (467)
đồng phân lập thể (468)
đồng phân quang học (468)
phân tử bất đối xứng (468)
hoạt tính quang học (469)
anken (CnH2n) (469)
hydrocacbon không no (469)
đồng phân hình học (cis-trans)

ankin (CnH2n-2) (470)
hydrocacbon thơm (471)
Phần 15.3
nhóm ankin (472)
phản ứng cộng (473)
phản ứng tách (473)
phản ứng thế (473)
Phần 15.4
alcohol (476)
haloankan (476)

amin (477)
nhóm cacbonyl (479)
anđêhit (479)
xeton (479)
axit cacboxylic (480)
este (480)
amit (480)
axit béo (480)
andydrit axit (480)
lipid (481)
phản ứng thủy phân (481)


nitrile (482)
Phần 15.5
polime (483)
đại phân tử (483)
tiểm phân tử (483)
polime phản ứng trùng cộng (483)
polime phản ứng trùng ngưng (484)
Phần 15.6
monosaccharit (486)

polysaccharit (486)
disaccharit (486)
protein (487)
axit amin (487)
axit nucleic (490)
mononucleotit (490)
chuỗi xoắn kép (491)

cặp bazơ (491)
mã di truyền (491)



PROBLEMS
Problems with colored numbers are answered in Appendix E. Sections match the text
and provide the numbers of relevant sample problems. Bracketed problems are
grouped in pairs (indicated by a short rule) that cover the same concept.
Comprehensive Problems are based on material from any section or previous chapter.
The Special Nature of Carbon and the Characteristics of Organic Molecules
15.1 Explain each statement in terms of atomic properties:
(a) Carbon engages in covalent rather than ionic bonding.
(b) Carbon has four bonds in all its organic compounds.
(c) Carbon forms neither stable cations, like many metals, nor stable anions, like

many nonmetals.
(d) Carbon bonds to itself more extensively than does any other element.
(e) Carbon forms stable multiple bonds.
15.2 Carbon bonds to many elements other than itself.
(a) Name six elements that commonly bond to carbon in organic compounds.
(b) Which of these elements are heteroatoms?
(c) Which of these elements are more electronegative than carbon? Less

electronegative?
(d) How does bonding of carbon to heteroatoms increase the number of organic

compounds?
15.3
Silicon lies just below carbon in Group 4A(14) and also forms four

covalent bonds. Why aren’t there as many silicon compounds as carbon
compounds?
15.4
Which of these bonds to carbon would you expect to be relatively
reactive: C—H, C—C, C—I, C=O, C—Li? Explain.
Bài tập
Các bài tập in đậm đã được giải trong Phụ lục E. Phần phù hợp với đề bài và cung cấp
con số của các bài tập liên quan. Các bài tập trong ngoặc được nhóm theo cặp (được
xác định theo một quy luật) cùng chung một khái niệm. Nói dễ hiểu thì các bài tập dựa
vào tài liệu từ bất kì phần nào hoặc trong chương trước.
Tính tự nhiên đặc trưng của cacbon và đặc điểm các phân tử hữu cơ
15.1 Giải thích về tính chất nguyên tử mỗi câu bên dưới.
(a) Cacbon có xu hướng tham gia vào liên kết cộng hóa trị hơn là liên kết ion.
(b) Cacbon có bốn liên kết trong tất cả các hợp chất hữu cơ của nó.
(c) Cacbon hình thành cả ion dương giống các kim loại, và cả ion âm giống các phi
kim.
(d) Cacbon liên kết với chính nó một cách giãn rộng hơn so với nguyên tử khác.
(e) Cacbon hình thành những liên kết bội bền.
15.2 Cacbon liên kết với nguyên tố khác nhiều hơn là tự liên kết với chính nó.
(a) Kể tên sáu nguyên tố thường liên kết với cacbon trong các hợp chất hữu cơ.


(b) Nguyên tố nào là những nguyên tử khác loại?
(c) Nguyên tố nào có độ âm điện lớn hơn cacbon? nguyên tố nào ít hơn?
(d) Tại sao liên kết của cacbon với nguyên tử khác loại làm tăng số lượng hợp chất
hữu cơ?
15.3 Silicon nằm bên dưới cacbon trong Nhóm 4A(14) và cũng hình thành bốn liên
kết cộng hóa trị. Tại sao hợp chất silicon lại không có nhiều bằng hợp chất cacbon?
15.4 Cặp nào dưới đây liên kết với cacbon xảy ra phản ứng: C-H, C-C, C-I, C=O, CLi? Giải thích tại sao.
The Structures and Classes of Hydrocarbons (Sample Problems 15.1 and 15.2)

15.5 (a) What structural feature is associated with each type of hydrocarbon: alkane,

cycloalkane, alkene, and alkyne?
(b) Give the general formula for each type.
(c) Which hydrocarbons are considered saturated?
15.6 Define each type of isomer: (a) constitutional; (b) geometric; (c) optical. Which
types of isomers are stereoisomers?
15.7 Among alkenes, alkynes, and aromatic hydrocarbons, only alkenes exhibit cis-trans
isomerism. Why don’t the others?
15.8 Which objects are asymmetric (have no plane of symmetry): (a) circular clock face;
(b) a football; (c) a dime; (d) a brick; (e) a hammer; (f) a spring?
15.9 Draw all possible skeletons for a 7-C compound with
(a) A 6-C chain and 1 double bond
(b) A 5-C chain and 1 double bond
(c) A 5-C ring and no double bonds
15.10 Draw all possible skeletons for a 6-C compound with
(a) A 5-C chain and 2 double bonds
(b) A 5-C chain and 1 triple bond
(c) A 4-C ring and no double bonds
15.11 Add the correct number of hydrogens to each of the skeletons in Problem 15.9.
15.12 Add the correct number of hydrogens to each of the skeletons in Problem
15.10.
15.13 Draw correct structures, by making a single change, for any that are incorrect:
CH3

(a) CH3 CH

CH2 CH3

(b) CH3 CH

CH2 CH3

(d) H3C

CH2 CH3

CH3
(c) CH

C

CH3

CH2
CH3
15.14 Draw correct structures, by making a single change, for any that are incorrect:


15.15 Draw the structure or give the name of each compound:

(a) 2,3-dimethyloctane
(b) l-ethyl-3-methylcyclohexane
CH3

CH3 CH2 CH

(c)

CH

CH3

CH2

(d)

CH2 CH3

15.16 Draw the structure or give the name of each compound:

H3C
(a)

CH3

(b)

CH3

(c) 1,2-diethylcyclopentane (d) 2,4,5-trimethylnonane
Each of the following names is wrong. Draw structures based on them, and
correct the names:
(a) 4-methylhexane
(b) 2-ethylpentane

15.17

(c) 2-methylcyclohexane

(d) 3,3-methyl-4-ethyloctane

Each of the following names is wrong. Draw structures based on them, and
correct the names:
(a) 3,3-dimethylbutane
(b) 1,1,1-trimethylheptane

15.18

(c) 1,4-diethylcyclopentane

(d) 1-propylcyclohexane

15.19 Each of the following compounds can exhibit optical activity. Circle the chiral
center(s) in each:
H
H
H
(a)
Cl

H

C
C

H

H

C

C

H

H

H

(b)

H

H

H

H

C

C

C

H

H
H

C
H

C

H
H

C

C

H

H

H

H


15.20 Each of the following compounds can exhibit optical activity. Circle the chiral

center(s) in each:
H
H

H
C

C

(a)

C
C

H

OH

H

C

C

H

H

H

C

H

H

C

H

(b)

H

H

H

15.21 Draw structures from the following names, and determine which compounds are

optically active:
(a) 3-bromohexane

(b) 3-chloro-3-methylpentane

(c) l,2-dibromo-2-methylbutane
15.22 Draw structures from the following names, and determine which compounds are

optically active:
(a) 1,3-dichloropentane

(b) 3-chloro-2,2,5-trimethylhexane

(c) 1 -bromo-1 -chlorobutane
15.23 Which of the following structures exhibit geometric isomerism? Draw and name
the two isomers in each case:

(a) CH3 CH2

CH3
CH

CH CH3

(b)

(c) CH 3

C

H 3C
CH

CH

CH2

H3C

15.24 Which of the following structures exhibit geometric isomerism? Draw and name
the two isomers in each case:
CH3
(a) CH3 C

CH

CH

CH3

(b)

CH3
Cl
(c) Cl

CH2 CH

C

CH2 CH2 CH2 CH3


15.25 Which compounds exhibit geometric isomerism? Draw and name the two
isomers in each case:
(a) propene

(b) 3-hexene

(c) 1,1-dichloroethene

(d) 1,2-dichloroethene

15.26 Which compounds exhibit geometric isomerism? Draw and name the two
isomers in each case:
(a) 1-pentene

(b) 2-pentene

(c) 1-chloropropene

(d) 2-chloropropene

15.27 Draw and name all the constitutional isomers of diclorobenzene.
15.28 Draw and name all the constitutional isomers of trimethylbenzene.
15.29 Butylated hydroxytoluene (BHT) is a common preservative added to cereals
and other dry foods. Its systematic name is 1-hydroxy-2,6-di-tert-butyl-4methylbenzene (where “tert-butyl” is 1,1-dimethylethyl). Draw the stracture of BHT.
15.30 There are two compounds with the name 2-methyl-3- hexene, but only one
with the name 2-methyl-2-hexene. Explain with structures.
15.31 Any tetrahedral atom with four different groups attached can be a chiral center.
Which of these species is optically active?
(a) CHClBrF

(b) NBIC12H+

(c) PFClBrI+

(d) SeFCIBrH

Cấu trúc và phân loại hydrocacbon
(Bài tập 15.1 và 15.2)
15.5 (a) Đặc điểm cấu trúc nào liên quan đến mỗi loại hydrocacbon: ankan,
cycloankan, anken, và ankin?
(b) Nêu công thức chung của mỗi loại.
(c) Hydrocacbon nào được xem là no?
15.6 Định nghĩa mỗi loại đồng phân: (a) đồng phân cấu trúc, (b) đông phân hình học,

(c) đồng phân quang học. Loại nào trong số đồng phân này là đồng phân lập thể?
15.7 Giữa anken, ankin, và hydrocacbon thơm, chỉ có anken có đồng phân cis-trans.
Tại sao những loại khác thì không?
15.8 Những vật nào sau đây không đối xứng: (a) đồng hồ mặt tròn; (b) quả bóng; (c)
đồng xu; (d) viên gạch; (e) cây búa, (f) lò xo?
15.9 Viết tất cả các công thức cấu tạo thu gọn nhất của hợp chất 7-C với
(a) Chuỗi 6-C và một liên kết đôi
(b) Chuỗi 5-C và một liên kết đôi
(c) Vòng 5-C và không có liên kết đôi
15.10 Viết tất cả các công thức cấu tạo thu gọn nhất của hợp chất 6-C với
(a) Chuỗi 5-C và 2 liên kết đôi
(b) Chuỗi 5-C và một liên kết ba
(c) Vòng 4-C và không có liên kết đôi


15.11 Cân bằng đúng số hóa trị của hydrogen ở mỗi công thức cấu tạo thu gọn nhất
trong Bài tập 15.9
15.12 Cân bằng đúng số hóa trị của hydrogen ở mỗi công thức cấu tạo trong Bài tập
15.10.
15.13 Viết đúng các cấu tạo bằng cách thay đổi một liên kết đơn bất kì mà thấy phù
hợp
15.14 Viết đúng các cấu tạo bằng cách thay đổi một liên kết đơn bất kì mà thấy phù
hợp
15.15 Viết cấu tạo hoặc nêu tên của mỗi hợp chất: ...
15.16 Viết cấu tạo hoặc nêu tên của mỗi hợp chất:
15.17 Mỗi tên bên dưới đều bị sai. Hãy vẽ cấu tạo của chúng và sửa lại tên:
15.19 Mỗi hợp chất dưới đây đều có hoạt tính hình học. Khoanh tròn (các) trung tâm
đối xứng trong mỗi câu:
15.20 Mỗi hợp chất bên dưới có thể có hoạt tính quang học. Khoanh tròn (các) trung
tâm đối xứng trong mỗi câu:

(a) (b)
15.21 Viết cấu tạo của các danh pháp dưới đây, và xác định hợp chất nào có hoạt tính
quang học:
(a) 3-bromohexan
(b) 3-chloro-3-metylpentan
(c) 1,2-dibromo-2-metylbutan
15.22 Viết cấu tạo của các danh pháp dưới đây, và xác định hợp chất nào có hoạt tính
quang học:
15.23 Cấu tạo nào dưới đây là đồng phân hình học? Viết công thức cấu tạo và kể tên
hai đồng phân trong mỗi câu:
15.24 Cấu tạo nào dưới đây là đồng phân hình học? Viết công thức cấu tạo và kể tên
hai đồng phân trong mỗi câu:
15.25 Hợp chất nào dưới đây là đồng phân hình học? Viết công thức cấu tạo và kể tên
hai đồng phân trong mỗi câu:
15.26 Hợp chất nào dưới đây là đồng phân hình học? Viết công thức cấu tạo và kể tên
hai đồng phân trong mỗi câu:
15.27 Viết và kể tên toàn bộ đồng phân cấu trúc của dichlorobenzen.
15.28 Viết và kể tên toàn bộ đồng phân cấu trúc của trimetylbenzen.
15.29 Butylated Hydroxy Toluene (BHT) là chất bảo quản thường được cho vào các
loại ngũ cốc. Tên hệ thống của nó là 1-hydroxy-2,6-di-tert-butyl-4-metylbenzen ( từ
“tert-butyl” chính là 1,1-dimetyletyl). Viết cấu tạo của BHT.
15.30 Có hai hợp chất có tên 2-metyl-3-hexen, nhưng chỉ có một hợp chất có tên 2metyl-2-hexen. Giải thích các cấu trúc đó.
15.31 Bất kì các nguyên tử tứ diện nào có bốn nhóm khác nhau được đính kết đều có
thể là một trung tâm bất đối xứng. Hóa chất nào dưới đây có hoạt tính hình học?
Some Important Classes of Organic Reactions
(Sample Problem 15.3)


15.34 Write equations for the following: (a) an addition reaction between HjO and 3-hexene

(H+ is required and shown above the yield arrow); (b) an elimination reaction between
2-bromo- propane and hot potassium ethoxide, CH 3—CH2—OK (KBr and ethanol are
also products); (c) a light-induced substitution reaction between Cl 2 and ethane to
form 1,1 -dichloroethane.
15.35 Write equations for the following: (a) a substitution reaction between 2-bromopropane
and KI; (b) an addition reaction between cyclohexene and Cl 2; (c) an addition reaction
between 2-propanone and H2 (Ni metal is required and shown above the yield arrow).
15.36 Phenylethylamine is a natural substance that is structurally similar to amphetamine. It
is found in sources as diverse as almond oil and human urine, where it occurs at
elevated concentrations as a result of stress and certain forms of schizophrenia. One
method of synthesizing the compound for pharmacological and psychiatric studies
involves two steps:
C6H5CH2Cl + NaCN → C6H5CH2CN → C6H5CH2CH2NH2

Classify each step as an addition, elimination, or substitution.
Một vài loại phản ứng hữu cơ điển hình
(Bài tập 15.3)
15.32 Xác định loại phản ứng của mỗi câu bên dưới:
15.33 Xác định loại phản ứng của mỗi câu bên dưới:


15.34 Viết phương trình hóa học cho mỗi câu bên dưới:
(a) phản ứng cộng giữa H2O và 3-hexen (H+ là chất xúc tác được đặt trên mũi tên);
(b) phản ứng tách giữa 2-bromo-propan và kalietylat đun nóng, CH 3-CH2-OK (KBr và
etanol cũng là các chất sản phẩm);
(c) phản ứng thế giữa Cl2 và etan tạo ra 1,1-dichloroetan, có ánh sáng.
15.36 Viết phương trình hóa học cho mỗi câu bên dưới:
(a) phản ứng thế giữa 2-bromopropane và KI.
(b) phản ứng cộng giữa cyclohexene và Cl2
(c) phản ứng cộng giữa 2-propanone và H2

15.36 Phenyletylamin là một chất tự nhiên có cùng cấu trúc với amphetamin. Nó được
tìm thấy từ các nguồn khác nhau như dầu hạnh nhân và nước tiểu của con người,
những nơi xuất hiện việc tập trung cao độ cao như là kết quả của sự căng thẳng và các
dạng nhất định của tâm thần phân liệt. Phương pháp tổng hợp các hợp chất cho nghiên
cứu dược lý và tâm thần học gồm có hai bước sau: ...
Phân loại mỗi bước thành một phản ứng cộng, một phản ứng tách, và một phản ứng
thế
Properties and Reactivities of Common Functional Groups
(Sample Problems 15.4 to 15.6)
15.37 Compounds with nearly identical molar masses often have very different physical
properties. Choose the compound with the higher value for each of the following
properties, and explain your choice.
(a) Solubility in water: chloroethane or methylethylamine
(b) Melting point: diethyl ether (CJHJ—O—CJH5) or 1-butanol
(c) Boiling point: trimethylamine or propylamine
15.38 Fill in each blank with a general formula for the type of compound formed:
H2O, H+
R

CH CH2
HBr
CH3O

H+
OH
HBr

15.39 Why does the C=0 group react differently from the C=C group? Show an example of
15.40

15.41
15.42
15.43

the difference.
Many substitution reactions are initiated by electrostatic attraction between reactants.
Show where this attraction arises in the formation of an amide from an amine and an
ester.
What reaction type is common to the formation of esters and acid anhydrides? What is
the other product?
Both alcohols and carboxylic acids undergo substitution, but the processes are very
different. Explain.
Name the type of organic compound from each description of the functional group: (a)
polar group that has only single bonds and does not include O or N;
(b) group that is polar and has a triple bond;
(c) group that has single and double bonds and is acidic in water;
(d) group that has a double bond and must be at the end of a C chain.


15.44 Name the type of organic compound from each description of the functional group: (a)

N-containing group with single and double bonds;
(b) group that is not polar and has a double bond;
(c) polar group that has a double bond and cannot be at the end of a C chain;
(d) group that has only single bonds and is basic in water.
15.45 Circle and name the functional group(s) in each compound:

15.46 Circle and name the functional group(s) in each compound:

15.47 Draw all alcohols with the formula C3H120.

15.48 Draw all aldehydes and ketones with the formula C 3H10O.
15.49 Draw all amines with the formula C4H,,N.
15.50 Draw all carboxylic acids with the formula CsH10O2.
15.51 Draw the organic product formed when the following compounds undergo a

substitution reaction: (a) acetic acid and methyl- amine; (b) butanoic acid and 2propanol; (c) formic acid and 2-methyl-1 -propanol.
15.52 Draw the organic product formed when the following compounds undergo a
substitution reaction: (a) acetic acid and 1-hexanol; (b) propanoic acid and
dimethylamine; (c) ethanoic acid and diethylamine.
15.53 Draw condensed formulas for the carboxylic acid and alcohol that form the following
esters.

15.54 Draw condensed formulas for the carboxylic acid and amine that form the following

amides.


15.55 Fill in the expected organic substances

15.56 Fill in the expected organic substances

15.57 (a) Draw the four isomers of C 5H12O that can be oxidized to an aldehyde, (b) Draw the

three isomers of C5H12O that can be oxidized to a ketone, (c) Draw the isomers of
C5H120 that cannot be easily oxidized to an aldehyde or ketone, (d) Name any isomer
that is an alcohol.
15.58 Ethyl formate (HCOO—CH2—CH3) is added to foods to give them the flavor of rum.
How would you synthesize ethyl formate from ethanol, methanol, and any inorganic
reagents?
Tính chất và phản ứng hóa học của cá nhóm chức thường gặp

(Bài tập 15.4 đến 15.6)
15.37 Các hợp chất có khối lượng phân tử gần bằng nhau thường có rất nhiều tính chất
vật lý khác nhau. Hãy chọn hợp chất có giá trị cao hơn cho mỗi câu của các tính chất
hóa học bên dưới, và giải thích tại sao bạn lại chọn như vậy.
(a) Hòa tan trong nước: chloroethane hoặc metyletylamin
(b) Độ tan chảy: dietyl ether (C2H5-O-C2H5) hoặc 1-butanol
(c) Độ sôi: trimetylamin hoặc propylamin
15.38 Điền vào chỗ trống có một công thức chung cho loại hóa chất được hình thành
dưới đây: ...
15.39 Tại sao nhóm C=O phản ứng khác với nhóm C=C? Đưa ra một ví dụ về sự khác
nhau đó.


15.40 Nhiều phản ứng thế được bắt đầu bằng việc hút tĩnh điện giữa các chất phản
ứng. Hãy chỉ ra vị trí lực hút này phát sinh trong quá trình hình thành amit của một
amin và một este.
15.41 Loại phản ứng nào thường dùng đối với quá trình hình thành của este và axit
anhydrit? Chất sản phẩm kia là gì?
15.42 Cả alcohol và axit cacboxylic đều trải qua phản ứng thế, nhưng những quá trình
này rất khác nhau, hãy giải thích.
15.43 Nêu tên loại hợp chất hữu cơ từ mỗi câu mô tả nhóm chức sau đây:
(a) nhóm phân cực có liên kết đơn duy nhất, và không chứa O và N;
(b) nhóm không phân cực và có chứa một liên kết ba;
(c) nhóm có các liên kết đơn và liên kết đôi và có tính axit trong nước;
(d) nhóm có một liên kết đôi và phải nằm cuối của một chuỗi C.
15.44 Nêu tên loại hợp chất hữu cơ từ mỗi câu mô tả nhóm chức sau đây:
(a) nhóm chứa N có các liên kết đơn và liên kết đôi, và không chứa O và N;
(b) nhóm không phân cực và có chứa một liên kết đôi;
(c) nhóm phân cực có một liên kết đôi và không thể nằm cuối một chuỗi C;
(d) nhóm có liên kết đơn duy nhất và có tính bazơ trong nước.

15.45 Khoanh tròn và gọi tên (các) nhóm chức trong mỗi hợp chất dưới:
15.46 Khoanh tròn và gọi tên (các) nhóm chức trong mỗi hợp chất dưới:
15.47 Viết cấu tạo tất cả các alcohol có công thức C5H12O.
15.48 Viết cấu tạo tất cả các anđêhit và xeton có công thức C 5H10O.
15.49 Viết cấu tạo tất cả các amin có công thức C4H11N.
15.50 Viết cấu tạo tất cả các axit cacboxylic có công thức C5H10O2.
15.51 Viết chất sản phẩm hữu cơ được hình thành khi các hợp chất bên dưới trải qua
phản ứng thế: (a) axit acetic và 1-hexanol; (b) axit propanoic và dimetylamin; (c) axit
etanoic và dietylamin.
15.53 Viết công thức cấu tạo thu gọn cho axit cacboxylic và alcohol hình thành từ các
este bên dưới: (a), (b), (c)
15.54 Viết công thức cấu tạo thu gọn cho axit cacboxylic và amin hình thành từ các
amit bên dưới: (a), (b), (c)
15.55 Điền vào ô trống các chất hữu cơ phù hợp: (a), (b)
15.56 Điền vào ô trống các chất hữu cơ phù hợp: (a), (b)
15.57 Viết bốn đồng phân của C 5H12O mà có thể oxi hóa với một anđêhit. (b) Viết ba
đồng phân của C5H12O mà có thể oxi hóa với một xeton. (c) Viết các đồng phân của
C5H12O mà không thể dễ dàng bị oxi hóa đối với một anđehit hoặc xeton. (d) Kể tên
đồng phân bất kì là một alcohol.
15.58 Etyl fotmat được thêm vào thức ăn để khiến chúng có hương vị của rượu rum.
Bạn sẽ làm cách nào để tổng hợp focmat etyl từ etanol, metanol, và các thuốc thử vô
cơ bất kì?
The Monomer-Polymer Theme I: Synthetic Macromolecules
15.59 Name the reaction processes that lead to the two types of synthetic polymers.
15.60 Which functional group occurs in the monomers of addition polymers? How are these

polymers different from one another?


15.61 Which intermolecular force is primarily responsible for the different types of

polyethylene? Explain.
15.62 Which of the two types of synthetic polymer is more similar chemically to
biopolymers? Explain.
15.63 Which functional groups react to form nylons? Polyesters?
15.64 Draw an abbreviated formula for the following .polymers, with brackets around the
repeat unit:
(a) Polyfvinyl chloride) (PVC) from CH2=CH-Cl
(b) Polypropylene from CH2=CH-CH3
15.65 Draw an abbreviated formula for the following polymers, with brackets around
the repeat unit:
(a) Teflon from CF2=CF2
(b) Polystyrene from C6H5CH=CH2
15.66 Write a balanced equation for the reaction between 1,4- benzenedicatboxylic
acid and 1,2-dihydroxyethane to form the polyester Dacron. Draw an abbreviated
structure for the polymer, with brackets around the repeat unit.
15.67 Write a balanced equation for the reaction of dihydroxydimethylsilane (right)
to form the condensation polymer sold as Silly Putty.
CH3

HO

Si

OH

CH3

Đại cương polime-monome phần 1: Cao phân tử tổng hợp
15.59 Kêt tên các quá trình phản ứng tạo ra hai loại polime tổng hợp.

15.60 Nhóm chức nào xuất hiện trong monome của phản ứng trùng cộng? Những loại
polime này khác với loại kia như thế nào?
15.61 Lực nào giữa các phân tử chịu trách nhiệm chủ yếu về các loại polyetylen? Hãy
giải thích.
15.62 Loại nào trong số hai loại polime tổng hợp có tính hóa học giống với polime
sinh học nhất? Hãy giải thích.
15.63 Nhóm chức năng nào phản ứng cho ra dạng nilon? Polyeste?
15.64 Vẽ công thức viết tắt cho nhựa đang quan sát, với các ngoặc đơn quanh vị trí
lập lại :
(a) Poly(vinyl chloride) (PVC) từ

(b)Polypropylene từ

15.65 Vẽ công thức viết tắt cho nhựa đang quan sát, với các ngoặc đơn quanh vị trí
lập lại :
(a) Teflon từ

(b) Polystyrene từ


16.66 Viết phương trình cân bằng cho phản ứng giữa 1.4 axit benzenedicarboxylic với
1.2- dihydroxyethane để tạo thành polieste Dacron. Bản vẽ một cấu trúc ngắn gọn cho
Polime, Với các ngoặc đơn quanh vị trí lập lại.
15.67 Bản vẽ một phương trình cân bằng cho phản ứng của dihydroxymethylsilane
(phải) để tạo thành sự ngưng tụ polime được bán cho Silly Putty.
The Monomer-Polymer Theme II: Biological Macromolecules
15.68 Which type of polymer is formed from each of the following monomers: (a) amino
15.69
15.70
15.71

15.72
15.73
15.74

15.76

15.77

acids; (b) alkenes; (c) simple sugars; (d) mononucleotides?
What is the key structural difference between fibrous and globular proteins? How is it
related, in general, to the proteins’ amino acid composition?
Protein shape, function, and amino acid sequence are interrelated. Which determines
which?
What is base pairing? How does it pertain to DNA structure?
Draw the R group of (a) alanine; (b) histidine; (c) methionine.
Draw the R group of (a) glycine; (b) isoleucine; (c) tyrosine.
Draw the formula of each of the following tripeptides:
(a) Aspartic acid-histidine-tryptophan
(b) Glycine-cysteine-tyrosine with the charges that exist in cell fluid
15.75 Draw the formula of each of the following tripeptides:
(a) Lysine-phenylalanine-threonine
(b) Alanine-leucine-valine with the charges that exist in cell fluid
Write the sequence of the complementary DNA strand that pairs with each of the
following DNA base sequences:
(a) TTAGCC
(b) AGAC AT
Write the sequence of the complementary DNA strand that pairs with each of the
following DNA base sequences:
(a) GGTTAC
(b) CCCGAA

15.78 Protein shapes are maintained by a variety of forces that arise from interactions
between the amino-acid R groups. Name the amino acid that possesses each R group
and the force that could arise in each of the following interactions:
(a)

—CH2—SH

with HS—CH2—

(b)

—(CH2)4—NH3+

with

(c)

—CH2—CO—NH2 with HO—CH2—

(d)

—CH—CH3

-

OO—C—CH2—

with C6H5—CH2—

CH3

15.79 Amino acids have an average molar mass of 100 g/mol. How many bases on a single

strand of DNA are needed to code for a protein with a molar mass of 5X10 5 g/mol?
Đại cương polime-monome phần 2: Cao phân tử sinh học


15.68 Loại polyme nào được tạo thành từ mỗi đơn phân đang quan sát: (A) amino axit
; (b) anken ; (c) đường đơn ; (d) phân tữ vĩ mô?
15.69 Sự khác biệt cấu trúc chủ yếu giữa chất xơ và protein dạng cầu là gì? Nó liên
quan nhau thế nào,nói chung để có được tổ hợp amino axit của protein?
15.70 Hình dạng, chức năng, dãy amino axit của protein thì tương quan với nhau. Xác
định cái nào tương quan với cái nào?
15.71 ghép cơ sở là gì? Nó liên quan đen cấu trúc AND như thế nào?
15.72 Bản vẽ nhóm R của (a) a-la-nin ;(b) histidine ; (c)methionine.
15.73 Bản vẽ nhóm R của (a) glycine ;(b) isoleucine ; (c)tyrocine.
15.74 Viết công thức cho mỗi tripeptides đang quan sát:
(a) Aspartic axit- histidine-tryptophan
(b) Glycine-cysteine-tyrocine với việc nạp điện tồn tại trong dịch tế bào
15.75 Viết công thức cho mỗi tripeptides đang quan sát:
(a) Lycine-phenylalanine-threonine
(b) Alanine-leucine-valine với việc nạp điện tồn tại trong dịch tế bào
15.76 Viết dãy của chuổi DNA bổ sung ghép cặp với mỗi dãy DNA cơ sở đang quan
sát:
(a)TTAGCC

(b) AGACAT

15.77 Viết dãy của chuổi DNA bổ sung ghép cặp với mỗi dãy DNA cơ sở đang quan
sát:
(a) GGTTAC

(b) CCCGAA

15.78 Hình dạng protein được duy trì bởi các lực khác nhau mà được sinh ra từ các
phản ứng giữa các nhóm R amino axit. Tên amino axit chiếm hữu một nhóm R và lực
được sinh ra trong các phản ứng đang quan sát:
15.79 Các amino axit có khối lượng phân tử trung bình là 100g/mol. Có bao nhiêu
amino axit dựa trên chuổi đơn của DNA được cần để viết mã cho một protein với khối
lượng phân tử trung bình là 5 x 105g/mol?
Comprehensive Problems
15.80 A synthesis of 2-butanol was performed by treating 2-bromobutane with hot
sodium hydroxide solution. The yield was 60%, indicating that a significant portion of
die reactant was converted into a second product Predict what this other product might
be.


15.81 Pyrethrins, such as jasmolin II (below), are a group of natural compounds
synthesized by flowers of the genus Chrysanthemum (known as pyrethrum flowers) to
act as insecticides.
(a) Circle and name the functional groups in jasmolin n.
(b) What is the hybridization of the numbered carbons?
(c) Which, if any, of the numbered carbons are chiral centers?

15.82 Compound A is branched and optically active and contains C, H, and O.
(a) A 0.500-g sample bums in excess O 2 to yield 1.25 g of CO2 and 0.613 g of H20.
Determine the empirical formula.
(b) When 0.225 g of compound A vaporizes at 755 torr and 97°C , the vapor occupies
78.0 mL. Determine the molecular formula.
(c) Careful oxidation of the compound yields a ketone. Name and draw compound A,
and circle the chiral center.

15.83 The genetic code consists of a series of three-base words that each code for a
given amino acid.
(a) Using the selections from the genetic code shown below, determine the amino acid
sequence coded by the following segment of RNA:
UCCACAGCCUAUAUGGCAAACUUGAAG
AUG = methionine CCU = proline

CAU “ histidine

UGG = tryptophan AAG = lysine

UAU = tyrosine

GCC = alanine

UUG =leucine

CGG = arginine

UGU = cysteine

AAC = asparagine ACA = threonine

UCC = serine

GCA =alanine

UCA = serine

(b) What is the complementary DNA sequence from which this RNA sequence was

made? (Hint: Uracil, U, in RNA pairs with adenine, A, in DNA).
15.84 Sodium propanoate (CH3—CH2—COONa) is a common preservative found in
breads, cheeses, and pies. How would you synthesize sodium propanoate from 1propanol and any inorganic reactants?
15.85 Supply the missing organic and/or inorganic substances:


Cl
CH3 CH

Br
CH3

?

CH3 CH

?

CH2

CH3 CH

Br
CH2

O
CH3 CH2 CH2 OH

?

CH3 CH2 C

?

OH

?

O
CH3 CH2 C

O

CH2

Các vấn đề toàn diện
15.80 Sự tổng hợp của 2 butanol được thực hiện bằng việc xử lý 2-bromobutane với
các quá trình làm nóng Na-tri hi-dro-xit. SẢn lượng là 60%, chỉ là một phần quan
trọng của các chất phản ứng được biến đổi thành 2 chất tạo thành. Dự đoán các sản
phẩm tạo thành khác trong trường hợp này có thể là gì?
15.81 Pyrethrins, như là jasmolin 2 (dưới) là một nhóm hợp chất tự nhiên tổng hợp
bởi các bông hoa của loại hoa cúc ( được biết như là các bông hoa cúc lá nhỏ) để phản
ứng như các thuốc trừ sâu.
(a) Khoanh tròn tên các nhóm chức năng trong jasmolin II
(b) Sự lai giống của số lượng carbon là gì?
(c) thế nào nếu bất kỳ số lượng carbon ở trung tâm bất đối??
15.82 Phức hợp A được phân chia và quang học tích cực và bao gồm C, H và O (a) A
0.500-g mẫu đốt cháy bị dư thừa O 2 để tao ra 1.25g CO 2 va 0.613 g H2O. Việc xác
định công thức thí nghiệm (b) khi 0.225 g hợp chất A bi bốc hơi ở 755torr và . CÁch
làm bốc hơi chieems.0 mL. XÁc định công thức phân tử (c) quan tâm đến sự ô-xi hóa

các hợp chất tạo ra một xeton. Nêu tên và Bản vẽ Hợp chất A, khoanh tròn các trung
tâm bất đối.
15.83 Mã di truyền là một dãy gồm ba tuwfmaf mỗi mã là một amino axit nhất định.
(a) Sử dụng các lựa chọn từ mã di truyền để nhất định bên dưới, xác định mã dãy
amino axit bằng cấc đoạn RNA nhất định:

AUG
UGG
GCC
UGU

= methionine
= tryptophan
= alanine
= cysteine

CCU
AAG
UUG
AAC

= proline
= lysine
= leucine
= asparagine

CAU
UAU
CGG
ACA

= histidine
= tyrosine
= arginine
= threonine


UCC
= serine
GCA
= alantine
UCA
= serine
15.84 Natri propan là một chất bảo quản phổ biến được tìm thấy trong bánh mì,phô
mai, và bánh quy. Bạn sẽ làm thế nào để tạo Natri propan từ 1- propanol và bất kỳ
chất phản ứng vô cơ nào.
15.85 Cung cấp các chất hữu cơ bị mất đi hay các chất vô cơ:
Cl
CH3 CH

Br
CH3

?

CH3 CH

?

CH2

CH3 CH

Br
CH2

O
CH3 CH2 CH2 OH

?

CH3 CH2 C

?

OH

?

O
CH3 CH2 C

O

CH2