Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx

Template requirements and binding of hepatitis C virus
NS5B polymerase during in vitro RNA synthesis from the
3¢-end of virus minus-strand RNA
The
´
re
`
se Astier-Gin, Pantxika Bellecave, Simon Litvak and Michel Ventura
UMR-5097 CNRS, Universite
´
Victor Segalen Bordeaux 2, Bordeaux, France
Hepatitis C virus (HCV) is the major causative agent
of non-A, non-B hepatitis [1]. This virus has a posit-
ive-stranded RNA genome and belongs to the Flavivir-
idae family. The RNA contains a large open reading
frame that encodes a polyprotein which is cleaved into
10 viral proteins: C, E1, E2, p7, NS2, NS3, NS4A,
NS4B, NS5A and NS5B [2]. Recently, a frame shift
product of HCV core encoding sequence, the F pro-
tein, was described [3,4]. This protein has no known
functions. The large open reading frame is flanked by
two untranslated regions (UTR). The 341-nucleotide
(nt) 5¢UTR in association with the first nucleotides of
the core protein contains an internal ribosome entry
site (IRES) that directs cap-independent translation of
the viral RNA [5,6]. The 3¢UTR is composed of a
short variable region, a polypyrimidine tract (poly
U-UC) of variable length and a highly conserved
98-nucleotide segment (3¢X). The two latter domains
are essential for viral infectivity in vivo [7] and RNA
replication of HCV in the HCV replicon system [8,9].

HCV RNA replication occurs in two steps. In the
first step the viral replicase synthesizes a minus-strand
RNA that serves as a template for the synthesis of
new plus-strand RNA molecules. Initiation of RNA
synthesis at the 3¢-end of the plus- and minus-strand
RNA most probably involves interactions between
the protein components of the replication complex,
in particular with the viral polymerase (NS5B), and
structures and ⁄ or sequences of the viral RNA
templates. The secondary structure of the 3¢-end of the
Keywords
HCV; minus strand RNA; RdRp
Correspondence:
The
´
re
`
se Astier-Gin, CNRS UMR5097,
Universite
´
Victor Se
´
galen Bordeaux 2, 146,
rue Le
´
o Saignat, 33076 Bordeaux cedex,
France
Fax: +33 5 57571766
Tel: +33 5 57571742
E-mail:

(Received 23 March 2005, revised 24 May
2005, accepted 3 June 2005)
doi:10.1111/j.1742-4658.2005.04804.x
In our attempt to obtain further information on the replication mechanism
of the hepatitis C virus (HCV), we have studied the role of sequences at
the 3¢-end of HCV minus-strand RNA in the initiation of synthesis of the
viral genome by viral RNA-dependent RNA polymerase (RdRp). In this
report, we investigated the template and binding properties of mutated and
deleted RNA fragments of the 3¢-end of the minus-strand HCV RNA in
the presence of viral polymerase. These mutants were designed following
the newly established secondary structure of this viral RNA fragment. We
showed that deletion of the 3¢-SL-A1 stem loop significantly reduced the
level of RNA synthesis whereas modifications performed in the SL-B1 stem
loop increased RNA synthesis. Study of the region encompassing the 341
nucleotides of the 3¢-end of the minus-strand RNA shows that these two
hairpins play a very limited role in binding to the viral polymerase. On the
contrary, deletions of sequences in the 5¢-end of this fragment greatly
impaired both RNA synthesis and RNA binding. Our results strongly sug-
gest that several domains of the 341 nucleotide region of the minus-strand
3¢-end interact with HCV RdRp during in vitro RNA synthesis, in parti-
cular the region located between nucleotides 219 and 239.
Abbreviations
HCV, hepatitis C virus; IRES, internal ribosome entry site; nt, nucleotide; RdRp, RNA-dependent RNA polymerase; TCA, trichloroacetic acid;
UTR, untranslated region.
3872 FEBS Journal 272 (2005) 3872–3886 ª 2005 FEBS
plus-strand RNA has been determined [10,11] and the
involvement of the three stem loops of the 3¢X has
been extensively studied both in vitro, in the replicon
system and in vivo [7–9,12]. The secondary structure of
the 3¢-end of the minus-strand RNA has been estab-

lished more recently [13,14]. It was shown that the
341 nt from the 3¢-end of the minus-strand RNA, com-
plementary to the HCV 5¢UTR, folds into six stem
loops. With the exception of the short SL-A1 stem
loop, the one closest to the 3¢-end, these structures dif-
fered from those of the plus-strand RNA. Thus the
minus-strand 3¢-terminal domain is not the mirror
image of its antisense sequence corresponding to
5¢UTR. Its role in the initiation of the plus-strand
RNA synthesis cannot be directly assessed in the HCV
replicon system because translation and replication are
linked in this system. However, it has been shown that
the first 125 nt of the 5¢UTR are essential for RNA
replication of HCV replicons in HuH7 cells [15,16].
Most probably the 125 nt present at the 3¢-end of the
complementary minus-strand RNA is an important
element for de novo synthesis of plus-strand RNA.
Data obtained from in vitro experiments using the
recombinant NS5B protein argue for this hypothesis.
We have previously shown that the recombinant HCV
RNA polymerase efficiently replicates the 341 nt of the
3¢-end of the HCV minus-strand RNA in vitro and that
deletion of the 3¢ 45 nt greatly impaired RNA synthesis
[17]. Oh et al. [18] showed that RNA synthesis from the
HCV minus-strand RNA required a minimum of 239 nt
from the 3¢-end. Furthermore, we have reported that an
oligonucleotide complementary to the SL-B1 domain
in the 3¢-end of the HCV minus-strand RNA inhibits
in vitro initiation of RNA synthesis by the viral poly-
merase [19]. Kashiwagi et al. [20] studied RNA synthesis

by recombinant HCV NS5B using deletion mutants of
the 3¢ terminus of the minus-strand RNA but deletions
were made on the basis of the structure of the 5¢UTR of
the plus-RNA, the structure of the 3¢-end of the minus-
strand RNA being at that time unavailable.
In the present study we investigated the involvement
of sequences and ⁄ or structures in RNA synthesis direc-
ted in vitro by HCV NS5B by using new mutants of
the 3¢-end of minus-strand RNA.
Results
Effect of mutations in the 3¢- or the 5¢-end of the
(–)IRES HCV RNA template on RNA synthesis
The secondary structure of the 3¢-terminal nucleotide
region of the HCV minus-strand RNA is illustrated in
Fig. 1. This fragment contains two domains: domains
I and II. Structures of both domain I (A), as deter-
mined by Schuster et al. [13] and by Smith et al. [14],
and domain II, as determined, respectively, by Smith
et al. [14] (B), Schuster et al. [13] (C) or predicted by
RNA Draw software (D) are represented. Nucleotides
are numbered increasingly from the 3¢-end of the
RNA; the five first stem-loops (A) are named as repor-
ted by Schuster et al. [13]. The 228 nt of domain I fold
into five stable stem-loops (A). It has been found to
display the same secondary structure in the three mod-
els presented here: the fragment containing 365 nucleo-
tides described in [14], the 416 nt fragment described
by [13] and the 341 nt fragment, used in this work. On
the contrary, the 5¢-end of the different RNA frag-
ments (137 nt in Fig. 1B, 188 nt in Fig. 1C, and 113 nt

in Fig. 1D) is less stably organized, thus giving differ-
ent structures in the three cases.
Effect of modifications at the 3¢-end: mutations or
deletions in the SL-A1 and SL-B1 stem loop
We have shown previously that the 3¢-end of the
HCV minus-strand RNA is replicated highly efficiently
in vitro by purified viral polymerase NS5B [17]. This
high level of RNA synthesis is associated with the
presence of a cytidine residue at the 3¢-end. Upstream
sequences and ⁄ or structures also seem to be involved,
as deletion of 45 nt at the 3¢-end greatly reduces RNA
synthesis. Moreover, as another indication of the
importance of this region, we have recently shown that
ODN7, an antisense oligonucleotide complementary to
a domain comprised between nt 85 and 103 of the
3¢-terminal minus-strand HCV RNA, was able to inhi-
bit RNA initiation [19].
To identify more precisely sequences or structural
elements important for RNA synthesis we constructed
mutants in the SL-A1 and SL-B1 domains comprised
in a 341 nucleotide fragment of the 3¢-end minus-
strand RNA called (–)IRES. This fragment is effi-
ciently replicated in vitro by the HCV NS5B [17]. The
mutants were designed in such a way that the deletions
or the base changes did not alter the structure of the
other domains of the (–)IRES RNA as determined by
predicted secondary structure with RNA Draw soft-
ware. The structure of the first 151 nt nucleotides of
wild-type and mutated RNA is shown in Fig. 2.
The mutated RNAs were used as templates in the

RdRp assay and the levels of RNA synthesis were
compared with that of the wild-type (–)IRES. Very
different results were obtained when changing either
stem-loop. As shown in Table 1, the deletion of the
SL-A1 stem loop in the (–)IRES DSL-A1 mutant
reduced the RNA synthesis by 39%. These results were
T. Astier-Gin et al. Binding and replication of 3¢-end of HCV minus RNA
FEBS Journal 272 (2005) 3872–3886 ª 2005 FEBS 3873
in accordance with those of Kashiwagi et al. [20],
which showed that deletion of SL-A1 reduced the
RNA synthesis by 25%.
We then performed different deletions or site-direc-
ted mutagenesis in the sequence of the hairpin SL-B1
(Fig. 2). We carried out the following mutations of
SL-B1: (a) [(–)IRESD91-97)] that contains a deletion of
nt 91–97 corresponding to a bulge where the ODN7
antisense hybridized; (b) [(–)IRES Dhp2] that contains
a deletion of the 39 nt corresponding to the apical part
of SL-B1; (c) [(–)IRES hp2b] with a change of four nt
that induces a dissociation of the stem at the base of
SL-B1; (d) [(–)IRES LDH2] with a complete deletion
of SL-B1 In contrast to the results obtained when
changes were introduced in SL-A1, none of the modifi-
cations in SL-B1 reduced RNA synthesis (Table 1). In
all cases RNA synthesis was increased.
Altogether, these results indicated that while the
presence of the SL-A1 domain is necessary for efficient
RNA synthesis, the SL-B1 region does not contain
Fig. 1. Secondary structure of the 3¢ ter-
minal sequences of HCV minus-strand RNA.

Model structures of domain I (A) and domain
II (B, C and D) are shown. (A) Domain I is
composed by 228 nt located at the 3¢ end.
The first five stem loops are named as des-
cribed in [13]. (B) Secondary structure of
a fragment spanning from nt 229–365 in
domain II as described in [14]. (C) Secondary
structure of domain II, spanning nt 229–416,
as described by in [13]. (D) Secondary struc-
ture of a fragment spanning from nt 229–341
in domain II (predicted by
RNA DRAW soft-
ware).
Binding and replication of 3¢-end of HCV minus RNA T. Astier-Gin et al.
3874 FEBS Journal 272 (2005) 3872–3886 ª 2005 FEBS
sequences or structural domains necessary for the
high level of RNA synthesis obtained when incubating
in vitro NS5B and the 3¢-end of the minus-strand HCV
RNA as template. Moreover, modifications of the lat-
ter domain even resulted in enhanced RNA synthesis
(Table 1).
Effect of deletions at the 5¢-end
It has been shown that almost all the 5¢UTR region is
required for efficient RNA replication of HCV RNA
when using the replicon system [15]. Thus, we exam-
ined the effect of 5¢-end deletions in the (–)IRES 341
template on the amount of RNA synthesized in vitro
by the HCV NS5B 1a. The predicted secondary struc-
ture of three deletion mutants is displayed in Fig. 3.
As shown in Table 1 deletion of 102 nt at the 5¢-end

of (–)IRES RNA leading to (–)IRES 239 reduced
RNA synthesis by 51%. These results are in agreement
with those obtained by Oh et al. [18]. Further deletion
of the 5¢-end by 20 nt to give (–)IRES 219 showed a
striking reduction of RNA synthesis to only 19% of
that obtained with the (–)IRES wild-type RNA. Struc-
ture prediction by computer analysis showed that the
four bases at the 3¢-end of the (–)IRES 239 and
(–)IRES 219 were unannealed as in the wild-type
Fig. 2. Secondary structure of RNA mutated
in the SL-A1 and SL-B1 domains. Only the
secondary structure of the 151 nt from the
3¢-end of the minus-strand RNA is shown.
The computer predicted structure at 25 °C
of the same domain is shown for each mut-
ant RNA. The DG of the wild-type (–)IRES
RNA and those of the five mutant RNA are
indicated. The arrows or the curly bracket
showed the location of deletions or muta-
tions, respectively.
T. Astier-Gin et al. Binding and replication of 3¢-end of HCV minus RNA
FEBS Journal 272 (2005) 3872–3886 ª 2005 FEBS 3875
(–)IRES RNA and that the secondary structures of the
stem loops SL-A1, SL-B1, SL-C1 and SL-D1 were
unmodified. The 5¢-SL-E1 stem loop was unchanged in
(–)IRES 239 whereas in (–)IRES 219, the base of the
stem was replaced by a six nt bulge (Fig. 3). We also
performed a deletion of 237 nt at the 5¢-end to give
the (–)IRES 104. This deletion preserved the structure
of the SL-A1 and of the SL-B1 hairpin and the 4 nt at

the 3¢-end remained free as in the wild-type (–)IRES.
RNA synthesis obtained with the (–)IRES 104 RNA
was only 24% of that of the wild-type (–)IRES RNA,
a value similar to that of the (–)IRES 219 RNA. The
fact that the (–)IRES 104 can be used as a template by
the recombinant HCV NS5B differed from the data
obtained by Oh et al. [18]. These authors showed that
the 122 nt of the 3¢-end of the HCV minus-strand
RNA was unable to sustain RNA synthesis. Structure
prediction by computer analysis revealed that the sec-
ondary structure of the 3¢-end of the 122 nt RNA frag-
ment was unmodified compared to wild-type RNA.
This discrepancy can be explained by differences
between the sensitivity of the assays used in the two
studies. Finally, we performed an RdRp assay with an
RNA fragment corresponding to 20 nt of the 3¢-end of
the minus-strand HCV RNA that formed the four base
single-strand region and the SL-A1 hairpin. As shown
in Table 1, our recombinant NS5B was unable to use
this RNA as template for RNA synthesis. It could be
argue that this data results from a misfolding of this
short RNA due to a bimolecular association. However,
this last hypothesis is unlikely because the (–)IRES 20
migrates as one RNA species of the expected size in
native gel (data not shown). Further studies are needed
to clarify this point.
Taken together, these results indicate that regions
located at the 5¢-end of the (–)IRES RNA are crucial to
obtain a high level of RNA synthesis by NS5B in vitro,
in particular the 122 nt located at the 5¢-end. Alternat-

ively, the elimination of this less stably structured
domain decreased RNA synthesis by increasing the
relative amount of structured regions giving rise to
templates poorly replicated by the NS5B.
Analysis of RNAs synthesized using wild-type
and mutant (–)IRES RNA as templates
To examine the products synthesized in the presence of
the mutated (–)IRES, an RdRp assay was performed
with the NS5B 1a (Fig. 4). The same amount of each
product (833 Bq) was loaded onto a 6% denaturing
polyacrylamide gel. All templates with mutations or
deletions in the SL-A1 or the SL-B1 stem loop allowed
synthesis of a major RNA product with the size of
the input template (Fig. 4A). No arrest bands were
observed during the synthesis with the exception of
RNA (–)IRES DSL-A1 that gave a small amount of a
product about 39 nt shorter than the template
(Fig. 4A). The relative quantity of this short product
was variable in different experiments. In all cases,
slower migrating bands were also observed. The major
one migrated to a position corresponding to an RNA
two times larger than the template. For the wild-type
(–)IRES RNA we have previously shown that this
product corresponds to two successive copies of the
template [17]. Products of higher molecular weight in
very low amounts were also visible. They may corres-
pond to three (or more) successive copies of the tem-
plate.
When RNA synthesis was performed with (–)IRES
RNA templates that have deletions in the 5¢-end, a

major product migrating to the same position as the
template and slower ones were observed (Fig. 4A). In
the case of the (–)IRES 104, the product which was
two-fold the size of the template was almost as abun-
dant as the product the same size as the template. In
Table 1. RNA synthesis obtained with mutants of (–)IRES RNA
without or with heparin. Determination of K
d
for various (–)IRES
RNAs. An RdRp assay was performed with the purified NS5B1a
(150 n
M) and mutant RNAs as templates as described in Experi-
mental procedures. The amount of RNA synthesized was deter-
mined after TCA precipitation and counting in a Wallac scintillation
counter. The results were expressed as a percentage of the value
obtained with the wild-type (–)IRES in the absence or in the pres-
ence of heparin. (The addition of heparin during RNA synthesis
reduced RNA synthesis by 72%). Data were corrected following
the number of A residues in each RNA template and were the
mean of at least three experiments. For K
d
determination, a rena-
tured
32
P-labeled RNA (13 nM, 167 Bq) was incubated with NS5B
(50 n
M, 100 nM, 200 nM,500nM and 1 lM) for 20 min at 25 °C.
The K
d
was estimated from the concentration of NS5B resulting in

50% shifting of
32
P RNA. Results correspond to mean values of
3–4 independent experiments for each RNA. N.D., not determined.
RNA
RNA synthesis percentage
(–)IRES
K
d
(nM)
(–)-heparin (+)-heparin
(–)IRES 341 100 100 340 ± 40
(–)IRES DSL-A1 61 ± 7 59 ± 7 370 ± 10
(–)IRESD91-97 164 ± 20 154 ± 28 ND
(–)IRESDhp2 159 ± 15 165 ± 17 ND
(–)IRES hp2b 186 ± 14 173 ± 18 ND
(–)IRES LDH2 131 ± 16 101 ± 5 ND
(–)IRES 239 49 ± 8 40 ± 2 376 ± 31
(–)IRES 219 19 ± 4 13 ± 3 290 ± 30
(–)IRES 104 24 ± 3 25 ± 2 330 ± 30
(–)IRES 2 0 ND No binding
Binding and replication of 3¢-end of HCV minus RNA T. Astier-Gin et al.
3876 FEBS Journal 272 (2005) 3872–3886 ª 2005 FEBS
addition to the product twice the template size, the
(–)IRES 239 RNA gave a product of about 375 nt
indicated by a star (Fig. 4A). Again no prominent
arrest of RNA synthesis was observed when (–)IRES
RNAs harboring 5¢ deletions were used as templates.
Data presented in Fig. 4A were obtained by using
the NS5B D21 from HCV H77 genotype 1a. To exam-

ine whether a NS5B of another strain of HCV would
give the same results, we performed an RdRp assay
with a recombinant NS5B D21 purified from the HCV
J4 of genotype 1b. The products obtained with both
enzymes in the presence of wild-type (–)IRES (–)IRES
239 and (–)IRES 104 are shown in Fig. 4B. The migra-
tion patterns of the products synthesized by NS5B of
both HCVs were identical. Altogether, these results
indicated that the mutations and deletions performed
in the RNA fragment corresponding to the 3¢-end of
the HCV minus-strand RNA did not significantly alter
the initiation site of RNA synthesis by recombinant
HCV NS5B from different viral strains.
Analysis of RNA synthesized in one round
of synthesis
RNA products shown in Fig. 4 were obtained under
conditions where HCV NS5B could reinitiate RNA
synthesis several times. To analyze the RNA synthes-
ized in one round of synthesis, we performed RdRp
assays in the presence of heparin in order to prevent
reinitiation. In a first step we determined the heparin
concentration needed to prevent reinitiation during a
2 h RdRp assay. As illustrated in Fig. 5A, heparin at
a concentration of 200 lgÆmL
)1
(220 times heparin
molar excess with respect to the enzyme) reduced
RNA synthesis by 72%. Incubation with a higher con-
centration (400 lgÆmL
)1

) did not significantly modify
the level of RNA synthesis, suggesting that the amount
of heparin was sufficient to sequester all enzyme mole-
cules. These data were confirmed by performing a
kinetic experiment in the presence of heparin at
200 lgÆmL
)1
. As shown in Fig. 5B, the amount of syn-
thesized RNA greatly increased in the first 10 min of
the reaction to reach a plateau after 30 min. Analysis
of the RNA products on polyacrylamide gel showed
that the size of the products did not increase, indica-
ting that the elongation step was achieved (data not
shown).
We then compared the total level of RNA synthes-
ized in the presence or absence of heparin at
200 lgÆmL
)1
, using the various templates. Results
reported in Table 1 show that the level of RNA syn-
thesis obtained with the mutated templates (compared
Fig. 3. Predicted structure of the (–)IRES RNA with deletions of the 5’-end. The computer predicted structure at 25 °C and the DG values
are shown for three 5’-deleted mutants.
T. Astier-Gin et al. Binding and replication of 3¢-end of HCV minus RNA
FEBS Journal 272 (2005) 3872–3886 ª 2005 FEBS 3877
to wild-type RNA) was very similar under both condi-
tions. The only exception was observed in the case of
the (–)IRES LDH2 template, where the entire SL-B1
stem loop has been deleted. Results with this construc-
tion displayed a slightly but significantly reduced RNA

synthesis in the presence of heparin compared to that
observed in the absence of this compound.
Our further step was to study RNA products formed
under single-round conditions, i.e. in the presence of
heparin as the trapping molecule. As shown in Fig. 6A
when the wild-type (–)IRES was used as template for
HCV NS5B in the presence of heparin, a template
sized RNA was the major RNA product. Interestingly,
the high molecular weight RNA corresponding to two
(or more) successive copies of the template disap-
peared. Heterogeneous RNA of smaller sizes were also
observed but in very low amounts. These data indicate:
(a) that the HCV NS5B is highly processive and
(b) that the high molecular weight product was the
result of a reinitiation process. The same results were
obtained when (–)IRES RNA mutated or deleted in
the SL-A1 or in the SL-B1 stem loops were used as
templates in the presence of heparin (data not shown).
When one round of RdRp assay was performed with
the 5¢ deleted (–)IRES RNA 239 and 104 different
patterns were observed (Fig. 6B). With the (–)IRES
239 the major product was always a template size
RNA, while the high molecular weight RNA twofold
the size of the template was absent. In contrast, the
375 nt RNA product was synthesized (Fig. 6B). The
same type of experiment undertaken with the (–)IRES
104 showed that all the products two to four times the
size of the template (and visible in Fig. 4A) disap-
peared almost completely, as only a faint high mole-
cular weight band was visible (Fig. 6B). In this latter

case, in addition to the template size product, a short
RNA product was present in relatively high amounts
suggesting that under these conditions HCV NS5B
often released from the 104 nt RNA template after ini-
tiation of RNA synthesis.
In addition to RNA synthesized from the 3¢-end of
the HCV minus-strand RNA, we have previously des-
cribed the products using the 3¢-end of the plus-strand
HCV RNA as template [17]. To assess whether the
high molecular weight RNA produced from one of
these plus-strand RNA fragments called (+)
3¢UTRNDX also disappeared, we performed experi-
ments in the presence of heparin. The (+) 3¢UTRNDX
template corresponded to 150 nt 3¢ of the NS5B cod-
ing sequence plus the 3¢UTR sequence deleted from
BA
Fig. 4. RNA synthesized by NS5B in the
presence of wild-type and mutated RNAs.
Wild-type and mutated (–)IRES RNAs were
used in RdRp assays. An aliquot of the reac-
tion products was precipitated by 10% TCA
and the radioactivity incorporated in newly
synthesized RNA determined as described
in Experimental procedures section. The
remaining of the products was purified by
phenol ⁄ chloroform extraction (1 : 1, v ⁄ v) and
precipitated by one volume of isopropanol in
the presence of 0.5
M ammonium acetate.
32

P-labeled reaction products (833 Bq each)
were denatured and loaded onto a 6%
denaturing polyacrylamide gel. (A) Products
synthesized by HCV NS5B genotype 1a.
(B) Products synthesized by HCV NS5B
genotype 1a or NS5B 1b as indicated in the
figure. A labeled 0.16–1.77 kb RNA ladder
(Gibco-BRL) and the labeled RNA templates
were used as size markers.
Binding and replication of 3¢-end of HCV minus RNA T. Astier-Gin et al.
3878 FEBS Journal 272 (2005) 3872–3886 ª 2005 FEBS
the 3¢X 98 nt. As shown in Fig. 6A, in the absence of
heparin this RNA gave a major RNA product of the
template size (282 nt) and a slower migrating product
twice the size of the template. This high molecular
mass RNA was not observed in the presence of hep-
arin (Fig. 6A) indicating that the mechanism of reiniti-
ation operates in RNA synthesis using both the plus
and the minus 3¢-ends of HCV RNA as templates.
Finally, we wanted to see if a recombinant NS5B
purified from a highly related virus, the GBV-B was
able to synthesize the same type of RNA as HCV
NS5B from the wild-type (–)IRES RNA. Data presen-
ted in Fig. 6A showed that as in the case of HCV
NS5B, the GBV-B NS5B synthesized a major product
of the template size but, even in the absence of hep-
arin, no high molecular weight RNA were observed
suggesting a different initiation mechanism of RNA
synthesis for both viral polymerases.
Binding of wild-type and mutated (–)IRES RNA

to HCV NS5B
Data described above indicate that deletions of the
stem loop SL-A1 at the 3¢-end or of 102, 122 or 237
nucleotides at the 5¢-end of the (–)IRES 341 nt RNA
diminished in vitro RNA synthesis directed by the
HCV NS5B. To assess whether the low level of RNA
synthesis was related to the binding of these templates
to the HCV RdRp, we performed gel shift assays.
Results of such an experiment are presented in Fig. 7.
They showed that the binding of both wild-type and
239 (–)IRES RNA was complete at 1 lm NS5B. In a
native polyacrylamide gel, the two RNA migrated as
one species (Fig. 7A); however, in some experiments
a slowly migrating band of RNA was observed
(see below). In our experimental conditions the
[
32
P]RNA ⁄ NS5B complex remained at the top of the
gel. The K
d
values for the wild-type and deleted RNAs
were determined from curves obtained as in Fig. 7B.
As shown in Table 1, with the unique exception of the
(–)IRES20 RNA that did not bind the NS5B, all four
mutated RNAs bound the viral polymerase with the
same affinity as the wild-type (–)IRES RNA.
Competition experiments were then performed with
all mutated RNAs and the wild-type (–)IRES RNA
for binding to the enzyme. NS5B (500 nm) and wild-
type [

32
P](–)IRES RNA (13 nm) were incubated with
increasing amounts of cold RNAs and analyzed by
electrophoresis on nondenaturing polyacrylamide gel.
Free
32
P-labeled (–)IRES migrated as two bands, a
major one indicated by an arrow and a minor one that
migrated more slowly (Fig. 8). Repeated experiments
indicated that the latter band was not visible in every
electrophoresis analysis of a same
32
P-labeled RNA
preparation. Small variations in denaturation–renatur-
ation conditions or during electrophoresis could
explain these differences. In the presence of NS5B,
a clear shift of both RNA species was observed. As
shown in Table 2 and illustrated in Fig. 8A, 44 nm of
wild-type RNA released half of the labeled RNA in
the complex with NS5B. This dissociation is specific as
4 lm yeast tRNA was unable to release the (–)IRES
RNA bound to NS5B (data not shown). The five
RNAs with deletions or mutations in the two stem
loops SL-A1 or SL-B1 located close to the 3¢-end dis-
placed the
32
P-labeled (–)IRES RNA at slightly higher
concentrations ranging from 53 nm for (–)IRES Dhp2b
Fig. 5. Effect of heparin on RNA synthesized by NS5B. (A) Wild-
type (–)IRES RNA was preincubated for 30 min at 25 °C in the

RdRp reaction mixture without ATP and UTP. Various concentra-
tions of heparin were then added followed by ATP and 3H-UTP.
The reaction mixture was further incubated at 25 °C for 2 h. The
amount of radioactivity incorporated into the nucleic acids was
measured after TCA precipitation and plotted against heparin con-
centration. (B) An RdRp assay using 32P-UTP as labeled nucleotide
was performed as above in the presence of heparin (200 lgÆmL
)1
)
with wild-type (–)IRES RNA as template. Twenty microliters were
removed from the reaction mixture at different times. The amount
of radioactivity incorporated into the nucleic acids was measured
after TCA precipitation and plotted against the incubation time in
minutes.
T. Astier-Gin et al. Binding and replication of 3¢-end of HCV minus RNA
FEBS Journal 272 (2005) 3872–3886 ª 2005 FEBS 3879
to 97 nm for (–)IRES hp2b. On the contrary, higher
amounts of 5 ¢ deleted RNAs were needed to dissociate
the NS5B ⁄ [
32
P](–)IRES RNA complex (Table 2 and
Fig. 8B). As expected no competition was observed
between the wild-type (–)IRES and the (–)IRES 20
RNAs (data not shown). These results strongly suggest
that multiple domains of the 341 nt of the minus-
strand RNA 3¢-end are involved in the binding to
NS5B in particular the region located between nt 219
and 239. Consequently, one can hypothesize that the
5¢ deleted RNA did not bind NS5B in the same man-
ner as the wild-type RNA and could not efficiently dis-

placed this RNA in complex with NS5B.
Discussion
The replication mode of Flaviviridae, which involves
synthesis of a minus-strand RNA serving as template
for synthesis of the plus RNA genomic strand, would
seem to indicate that the 3¢-end of HCV minus-strand
RNA should play an important role in the initiation of
synthesis of the viral genome.
In this report we investigated the template and bind-
ing properties of mutated and deleted RNA fragments
of the 3¢-end of the minus-strand HCV RNA in
further detail. This study should lead to interesting
interpretations since it is facilitated by the recent deter-
mination of the secondary structure of this region
[13,14]. We first analyzed the effect of mutations or
deletions in the two stem loops SL-A1 and SL-B1
located near the 3¢-end. The deletion of SL-A1 signifi-
cantly reduced the level of RNA synthesis directed by
NS5B but mutations or deletions performed on SL-B1
(including its complete deletion) do not have a deleteri-
ous effect on the level of RNA synthesis in one or sev-
eral rounds of synthesis. Our results showed that,
unlike for SL-A1, the deletion of the entire stem loop
SL-B1 or part of this domain increased in vitro RNA
AB
Fig. 6. Effect of heparin on RNA synthe-
sized by NS5B. Wild-type and mutated
(–)IRES RNAs were preincubated for 30 min
at 25 °C in the RdRp reaction mixture with-
out ATP and UTP. Heparin (200 lgÆmL

)1
)
was then added followed by ATP and
[
32
P]UTP. The reaction mixture was further
incubated at 25 °C for 2 h. [
32
P]RNA prod-
ucts were quantified after TCA precipitation
of an aliquot of the reaction mixture as des-
cribed in Experimental procedures section.
32
P-labeled reaction products (833 Bq each)
were denatured and loaded onto a 6%
denaturing polyacrylamide gel. (A) RNA
products synthesized without or with hep-
arin (200 lgÆmL
)1
) by HCV or GBV-B NS5B.
The templates used corresponded to 3’
domains of plus or minus-strand HCV RNA.
(B) RNA products synthesized by HCV NS5B
in the presence of heparin with wild-type or
5’ deleted (–)IRES RNA.
Binding and replication of 3¢-end of HCV minus RNA T. Astier-Gin et al.
3880 FEBS Journal 272 (2005) 3872–3886 ª 2005 FEBS
synthesis by NS5B. It looks like, when increasing the
relative amount of unstructured domains in the tem-
plate, the RNA synthesis by NS5B is enhanced. How-

ever, the level of RNA synthesis observed with the
RNA mutant (–)IRES D91–97 did not fit with this
hypothesis, suggesting that interactions of the bulge
formed by the deleted sequences with other regions of
the RNA or with NS5B could occur.
Analysis of the products showed that the synthesized
RNAs are homogenous in size suggesting that initi-
ation occurred by a de novo mechanism at the 3¢-end
of all SL-A1 or SL-B1 mutated templates, as previ-
ously shown for the wild-type (–)IRES RNA [17]. The
HCV NS5B polymerase appeared to be highly proces-
sive in all cases as no major product shorter than the
template could be observed even in the presence of
heparin.
We have also shown that the NS5B is unable to syn-
thesize RNA from the (–)IRES20 RNA corresponding
to the four free nucleotides of the 3¢-end and the
SL-A1 hairpin. RNA products were only obtained
when sequences corresponding to the SL-B1 stem loop
were added at the 5¢-end giving the (–)IRES104 RNA.
A significant level of RNA produced from the (–)IRES
104 RNA was obtained even though it is about 25%
that of the wild-type (–)IRES. However in the latter
case the synthesis is less processive as a pause is
observed in about half of the initiation events. These
results indicate that the polymerase frequently dissoci-
ates from the template after initiation from (–)IRES
104 RNA suggesting that sequences between nt 104
and 341 stabilize the RNA polymerase complex during
the elongation process. Data obtained with other 5¢

deleted mutants (–)IRES 219 and (–)IRES 239, con-
firmed these results. In both cases, these two templates
can sustain efficient elongation without polymerization
arrest and NS5B release from the template. The level
of RNA synthesized from (–)IRES 219 is in the range
of that observed with (–)IRES 104 but the addition of
20 nucleotides at the 3¢-end to give (–)IRES 239
enhances this process by doubling the amount of RNA
product (Table 1).
A striking observation when analyzing the products
obtained with our recombinant NS5B-1a is the pres-
ence of high molecular weight RNA two to three times
the size of the template. These products correspond to
successive copies of the (–)IRES RNA [17]. In this
study, we showed that these high molecular weight
products were also synthesized with the recombinant
RdRp of an HCV of genotype 1b (Fig. 4B) but not
with the NS5B of the highly related GBV-B virus
(Fig. 6A). These products were not specifically pro-
duced from templates derived from the 3¢-end of HCV
minus-strand RNA as they were also present when
RNA fragments of the 3¢UTR were used as templates.
Data from RdRp assays performed in the presence of
heparin indicated that these products occurred after a
reinitiation event on a different template except in the
case of a product of about 375 nt when using the
(–)IRES 239 as template. The nature of the latter
375 nt RNA remains to be elucidated.
A
B

Fig. 7. Gel shift assay with wild-type or 239 (–)IRES RNA. After
denaturation and renaturation,
32
P-labeled RNA 341 (–)IRES and
239 (–)IRES (13 n
M, 167 Bq) were incubated with NS5B (50 nM,
100 n
M, 200 nM, 500 nM,1000nM and 2500 nM) in the RdRp reac-
tion mixture without nucleotides for 20 min at 25 °C. The reaction
products were analyzed on a 4% polyacrylamide nondenaturing gel.
The gel was autoradiographied and the amount of unbound RNA
determined by scanning with NIH image. (A) Autoradiogram of the
gel. (B) The percentage of wild-type (d) or 239 (s) RNA bound with
enzyme was plotted against NS5B concentration.
T. Astier-Gin et al. Binding and replication of 3¢-end of HCV minus RNA
FEBS Journal 272 (2005) 3872–3886 ª 2005 FEBS 3881
A similar study [20] analyzed the template properties
of different deletion mutants of the 3¢-end of the
minus-strand HCV RNA. Apparently our results
obtained with the (–)IRES DSL-A1 are in accordance
with their observations using a similar template called
SL234–1D. However, in the absence of secondary
structure available for the 3¢-end of the minus-strand
RNA at that time, they designed their mutations fol-
lowing the secondary structure of the 5¢UTR that dif-
fers completely except at the level of the first stem.
Consequently their results are hardly comparable with
those described in this report. Moreover, it should be
noted that they observed products corresponding to
polymerase arrests when sequences comprised between

nt 247 and 313 from the 3¢-end were present in their
templates derived from the 3¢-end of the minus-strand
RNA. This differed from our data that showed that
short products were only visible with (–)IRES 104. This
discrepancy could be explained by differences in RdRp
assays, particularly the divalent cation used. Kashiwagi
et al. [20] used manganese whereas we use magnesium
which is assumed to be the divalent cation involved in
the viral polymerase activity in infected cells.
With the exception of the (–)IRES 20, all our RNA
mutants bound the HCV NS5B but they compete with
the wild-type sequence with varying efficiencies. The five
RNAs carrying deletions or mutations in SL-A1 or
SL-B1 domains (DSL-A1, D91-97, Dhp2, hp2b and
LDH2) competed with (–)IRES RNA for binding on
NS5B with a slightly lower efficiency than the wild-type
RNA. On the contrary, the 5¢ deleted mutants were poor
competitors. Indeed, the amount of (–)IRES 239, 219
and 104 needed to displace labeled (–)IRES RNA were
four-, eight- and 16-fold higher than that of wild-type
RNA, respectively. The strong effect of the deletion of
nt 219–239 on RNA binding correlated with the effect
of this deletion on RNA synthesis, suggesting an
important interaction between this domain and the
AB
Fig. 8. Competition gel shift assay with wild-type and deleted (–)IRES RNA.
32
P-labeled (–)IRES RNA was incubated with NS5B (500 nM)and
different amounts of unlabelled RNAs in a 10 lL reaction mixture. RNA was renatured as described in material and methods section. After
20-min incubation at 25 °C, the products were analyzed in non denaturing polyacrylamide gels.

Table 2. Determination of K
d
by competition gel shift assay with
wild-type and mutated (–)IRES RNA.
32
P-labeled (–)IRES was incu-
bated with NS5B (500 n
M) and the various mutated unlabelled
RNAs (10 n
M,50nM, 200 nM, 400 nM and 800 nM). The dissoci-
ation constant was estimated from the concentration of the unla-
belled RNA resulting in 50% dissociation of [
32
P]RNA. Experiments
were repeated at least three times with each RNA.
RNA K
d
(nM)
(–)IRES 341 44 ± 3
(–)IRES DSLA1 64 ± 10
(–)IRES D91-97 85 ± 23
(–)IRES Dhp2 53 ± 11
(–)IRES hp2b 97 ± 2
(–)IRES LDH2 67 ± 9
(–)IRES 239 178 ± 34
(–)IRES 219 344 ± 34
(–)IRES 104 670 ± 47RNA
Binding and replication of 3¢-end of HCV minus RNA T. Astier-Gin et al.
3882 FEBS Journal 272 (2005) 3872–3886 ª 2005 FEBS
HCV NS5B during RNA synthesis. It should be noted

that this deletion affected the hinge between stem loops
SL-E1 and SL-AII. Notably, the apical loop and the
upper part of the stem of SL-E1 has a primary sequence
homology with the SL-II stem loop of the 3¢UTR
[13,14]. It has been previously shown that a recombinant
NS5B interacts with the 3¢X sequence of the 3¢UTR by
binding the stem of the SL-II stem loop and the hinge
between SL-I and SL-II [12]. More precise analysis by
site directed mutagenesis in the context of the 341 nt
RNA fragment is needed to identify the role of this stem
loop in NS5B binding and RNA synthesis from the
HCV minus-strand RNA.
Altogether these results suggest that several domains
of the RNA fragment comprising the 341 nt from the 3¢-
end of the minus-strand RNA are able to interact with
NS5B. This is reminiscent of the observation by Friebe
et al. [15] showing that the 341 nt of the 5¢UTR are nee-
ded for efficient replication of HCV RNA in the repl-
icon system. Their study showed that the first 125 nt of
the 5¢UTR are sufficient for a low level of RNA replica-
tion in agreement with our results. However, our data
differ from theirs since they observed that a deletion
between nucleotides 72–96 and 61–104 abolished RNA
synthesis whereas in our experiments deletion in this
domain had no such effect. This discrepancy may be
explained by the fact that we have used different systems
to study RNA synthesis and also that sequences identi-
fied in the replicon system may be involved in replica-
tion step(s) other than the synthesis of plus-strand RNA
from the minus-strand. In our case, we used the soluble

recombinant NS5B alone whereas in the replicon sys-
tem, NS5B is bound to reticulum membranes and is
included in a complex formed by viral and cellular pro-
teins [22–24]. We are currently developing a cellular
system with a reporter gene which will allow the
measurement of plus-strand RNA synthesis from
minus-strand RNA in HuH7 cells constitutively expres-
sing the HCV nonstructural proteins. Such a system
should permit a direct means of determining the cis-
sequences of the HCV minus-strand RNA involved in
synthesis of the viral genome. Data presented in this
report provide a basis to test the relevance of sequences
and ⁄ or structures implicated in this step of viral RNA
replication in the infected cells.
Experimental procedures
Recombinant HCV RdRp
The recombinant HCV NS5B-D21 of H77 (genotype 1a)
was expressed in Escherichia coli and purified as previously
described [17]. For construction of an expression vector of
a HCV NS5B-D21 (genotype 1b), a 1728 bp DNA fragment
was amplified from the HCV infectious molecular clone
pCV-J4L6S [21] kindly provided by J. Bukh (NIH, Beth-
esda, MD, USA). The primers used were NS5Bj4s2:
5¢-GATATCATGTCAATGTCCTATACGTGGAC-3¢ and
NS5Bj4r 5¢-AAACTCGAGGCGGGGTCGGGCACGAGA
CAGG-3¢. The PCR fragment was cleaved with restriction
enzymes EcoRV and Xho1 and inserted between the Nde1
site (blunted by Klenow enzyme) and the Xho1 site of the
pET21b vector. For construction of an expression vector of
the GBV-B NS5B-D19, a 1728 bp DNA fragment was

amplified from the sequence coding for the GBV-B-NS5B
kindly provided by A. Martin (Institut Pasteur, Paris,
France). The primers used were VB1: 5¢-AAACATATGA
GCATGAGCTACCACCTGGACC-3¢ and VB3: 5¢-CTCG
AGCTTCACAAGAAACTTCTGC-3¢. The PCR fragment
was cleaved by the restriction enzymes Nde1 and Xho1 and
inserted between the Nde1 and the Xho1 sites of the
pET21b. The HCV NS5B-1b and the GBV-B NS5B were
purified following the same procedure as for the HCV
NS5B-1a except that for the GBV-B NS5B a desalting col-
umn (HiTrap 5 mL desalting, Amersham Pharmacia Bio-
tech) was used instead of the monoS column after IMAC.
RNA templates
RNA (–)IRES corresponding to the 3¢-end of the minus-
strand RNA was synthesized by in vitro transcription of DNA
obtained by PCR amplification from the pGEM9Zf(–)
containing the 341 nucleotides of the 5¢UTR of HCV-H77
(pCU-UTRu). The PCR primers were designed to introduce
a T7 RNA polymerase promoter in the correct orientation
(Table 3). PCR was performed with the AmpliTaq gold
DNA polymerase kit (Applied Biosystem, Branchburg,
USA). RNAs were synthesized using the MEGAscript kit
(Ambion, Austin, TX, USA). DNA templates were digested
with DNase for 15 min. After phenol ⁄ chloroform extraction,
the RNAs were precipitated with isopropanol. The purity
and the integrity of RNAs were determined by analysis on a
6% polyacrylamide gel containing 7 m urea in TBE buffer
(90 mm Tris ⁄ borate pH 8.0, 1 mm EDTA). All RNA
mutants were obtained by modification of the 5¢UTR
sequence contained in the pCV-UTR4. The RNA (–)IRES

D91-97 and (–)IRES hp2b were obtained by mutagenesis
using the QuikChange Site-Directed Mutagenesis Kit (Stra-
tagene, La Jolla, CA, USA) with oligonucleotides D91–97a
and D91–97b and oligoncleotides hp2bs and hp2br, respect-
ively. The RNA (–)IRES Dhp2 was obtained by replacement
of the Not1-Nco1 fragment of the pCV-UTR4 with the cor-
responding sequence deleted of the nucleotides 38–77 (olig-
nucleotides DHp2s and DHp2r). Before ligation these
oligonucleotides were hybridized and cleaved by Not1 and
Nco1. The RNA (–)IRES LDH2 was obtained by changing
the Not1-Age 1 fragment of the pCV-UTR4 with the
corresponding fragment deleted from all nucleotides of SLB1
T. Astier-Gin et al. Binding and replication of 3¢-end of HCV minus RNA
FEBS Journal 272 (2005) 3872–3886 ª 2005 FEBS 3883
(oligonucleotides LDH2s and LDH2r). The RNA (–)IRES
DSLA1 (–)IRES 239 (–)IRES 219 (–)IRES 104 were obtained
by PCR on pCV-UTR 4 with primers indicated in Table 3.
The (–)IRES20 RNA was chemically synthesized by Dhar-
macon RNA technologies (Chicago, USA).
RNA labeling
RNAs were labeled by in vitro transcription using the
MEGAscript kit (Ambion) and 15 lCi [
32
P]UTP[aP]
(Amersham Pharmacia Biotech, Piscataway, NJ, USA).
The amount of radioactivity incorporated into the nucleic
acids was measured by precipitating 2 lL aliquots with
10% (v ⁄ v) trichloroacetic acid (TCA) and counting in a
Wallac scintillation counter. RNA were precipitated with
isopropanol and dissolved in water.

RdRp assay
The assay was performed in a total volume of 20 lL
containing 20 mm Tris ⁄ HCl pH 7.5, 1 mm DTT, 5 mm
MgCl
2
,40mm NaCl, 17 U RNasin (Promega, Madi-
son, WI, USA), 0.5 mm each of the 3 NTP (ATP, CTP,
GTP), 86 nm of RNA template, 150 nm of purified NS5B
and either 10 lCi [
32
P]UTP[a P] (3000 CiÆmmol
)1
, Amer-
sham Pharmacia Biotech) and 2 lm UTP or 2 lCi [
3
H]UTP
(46 CiÆmmol
)1
). The reaction mixture was incubated for 2 h
at 25 °C and stopped by the addition of 10% (v ⁄ v) TCA.
The radioactivity incorporated into newly synthesized RNA
was then determined. To quantify and analyze the
32
P-labe-
led RNA, the synthesis was stopped by adding 6.25 mm
EDTA, 10 mm Tris ⁄ HCl pH 7.5 and 0.125% (w ⁄ v) SDS.
An aliquot of the reaction products was precipitated by
10% (v ⁄ v) TCA and the radioactivity incorporated in newly
synthesized RNA determined as above. The remaining of
the products was purified by phenol ⁄ chloroform extraction

(1 : 1, v ⁄ v) and precipitated by 1 volume of isopropanol in
the presence of 0.5 m ammonium acetate. RNAs were dis-
solved in 95% formamide, 0.5 mm EDTA, 0.025% (w ⁄ v)
SDS, 0.025% (w ⁄ v) bromophenol blue, 0.025% (w ⁄ v)
xylene cyanol, then heated for 2 min at 94 °C and a same
amount of each sample was loaded onto a 6% (w ⁄ v) poly-
acrylamide denaturing gel containing 7 m urea in TBE
buffer. After electrophoresis, the gel was dried and auto-
radiographied using Kodak Xomat-AR-5 films.
For single-round replication assay, HCV RdRp and
RNA were preincubated for 30 min at 25 °C in the same
reaction mixture as above but without ATP and UTP. Hep-
arin (MW 4000–6000 Da, 200 lgmL
)1
) was then added
followed by ATP and [
32
P]UTP. The reaction mixture was
further incubated at 25 °C for 2 h. The
32
P-labelled RNA
products were quantified after TCA precipitation and a
same amount of each product was analyzed on a denatur-
ing polyacrylamide gel as described in the above paragraph.
Table 3. Oligonucleotides used in PCR and mutagenesis experiments. The sequence corresponding to the T7 RNA polymerase promoter is
underlined.
RNA Oligonucleotide Sequence (5¢fi3¢)
(–)IRES 5’S2 GCCAGCCCCCTGATGGGGGCGA
341 5’341T7
TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT

(–)IRES DSLA1 GCCAGACACTCCACCATGAATCACTCCCCTGTGAGGAACTACTGTCTTCACG
DSLA1 5’341T7
TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT
(–)IRES DHp2s TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT
Dhp2 AGCCATGGTTT
DHp2r AAACCATGGCTAGAATTCATGGTGGAGTGTCGCCCCCATCAGGGGGCTGGC
GCGGCCGCAAA
(–)IRES D91–97a GGCTGCACGACACTCCGCCATGGCTAGACGCTTTC
D91–97 D91–97b CGTCTAGCCATGGCGGAGTGTCGTGCAGCCTCCAGG
(–)IRES hp2bs CCCCTGATGGGGGCGTATTTCCACCATGAATCACTCCCC
hp2b hp2br GTGATTCATGGTGGAAATACGCCCCCATCAGGGGGCTGG
(–)IRES LDH2s TTTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGCAGCCTCCAGGA
LDH2 CCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTTTT
LDH2r AAAAACCGGTTCCGCAGACCACTATGGCTCTCCCGGGAGGGGGGG
TCCTGGAGGCTGCGCCCCCATCAGGGGGCTGGCGCGGCCGCAAAA
(–)IRES 239r
TAATACGACTCACTATAGGGGCACGCCCAAATCTC
239 5’S2 GCCAGCCCCCTGATGGGGGCGA
(–)IRES 219r AAA
TAATACGACTCACTATAGGCATTGAGCGGGTTTATCC
219 5’S2 GCCAGCCCCCTGATGGGGGCGA
(–)IRES 104r AAA
TAATACGACTCACTATAGACACTCATACTAACGCCATG
104 5’S2 GCCAGCCCCCTGATGGGGGCGA
+UTR3’ UTR 3a2 AAA
TAATACGACTCACTATAGCCGGCTGGACTTGTCCGG
NDX UTR3d GGAGCCACCATTAAAGAAGGG
Binding and replication of 3¢-end of HCV minus RNA T. Astier-Gin et al.
3884 FEBS Journal 272 (2005) 3872–3886 ª 2005 FEBS
Gel shift assay

Labeled RNA was thermally denatured for 2 min at 94 °C,
and then quickly cooled on ice for 5 min. RNA at a concen-
tration of 13 nm (167 Bq) was renaturated at 25 °C during
10 min in 9 lL RdRp reaction mixture (without NTP) before
adding various amounts of enzyme (in a 1 lL volume). The
incubation was continued for 20 min at 25 °C. Two lLof
electrophoresis loading buffer [10 mm Tris pH 8.0, 1 mm
EDTA, 0.1% (w ⁄ v) bromophenol blue, 0.1% (w ⁄ v) xylene
cyanol, 30% (v ⁄ v) glycerol] were added to the samples before
loading onto a nondenaturing 4% (w ⁄ v) polyacrylamide gel
(acrylamide ⁄ bis acrylamide 59 : 1). The electrophoresis was
run at 200 V at room temperature. The gel was autoradio-
graphed and scanned using the NIH image program. The
amount of unbound [
32
P]RNA was calculated from scanning
analyses. The percentage of bound RNA was deduced and
plotted against NS5B concentration. The 0% and 100%
unbound [
32
P]RNA corresponded to the values obtained at
saturating concentration of NS5B and in the absence of
enzyme, respectively. The dissociation constant was estima-
ted from the concentration of the NS5B resulting in 50%
shifting of [
32
P]RNA.
For competitive EMSA, labeled RNA was incubated in
the same conditions as above with unlabelled RNAs at
different concentrations and with NS5B (500 nm). The

amount of [
32
P]RNA released from the NS5B protein was
calculated from scanning analyses and plotted against the
concentration of unlabelled RNA. The 0 and 100%
released [
32
P]RNA corresponded to the values obtained in
the absence of unlabelled RNA with enzyme and without
enzyme, respectively. The dissociation constant was estima-
ted from the concentration of the unlabelled RNA resulting
in 50% dissociation of [
32
P]RNA.
Acknowledgements
We thank Laura Tarrago-Litvak for helpful discus-
sions and critical reading of the manuscript. This work
was supported by the Agence Nationale de Recherche
contre le Sida (ANRS), the Centre National de la
Recherche Scientifique (CNRS), the Institut National
de la Sante
´
et de la Recherche Me
´
dicale (INSERM),
The University Victor Segalen Bordeaux 2, the Ligue
contre le Cancer (Comite
´
de la Dordogne), and the
Re

´
seau National he
´
patite. P. B. was supported by a
graduate fellowship from ANRS.
References
1 Choo QL, Kuo G, Weiner AJ, Overby LR, Bradley
DW & Houghton M (1989) Isolation of a cDNA clone
derived from a blood-borne non-A, non-B viral hepatitis
genome. Science 244, 359–362.
2 Clarke B (1997) Molecular virology of hepatitis C virus.
J Gen Virol 78, 2397–2410.
3 Walewski JL, Keller TR, Stump DD & Branch AD
(2001) Evidence for a new hepatitis C virus antigen
encoded in an overlapping reading frame. RNA 7, 710–
721.
4 Xu Z, Choi J, Yen TS, Lu W, Strohecker A,
Govindarajan S, Chien D, Selby MJ & Ou J (2001)
Synthesis of a novel hepatitis C virus protein by ribo-
somal frameshift. EMBO J 20, 3840–3848.
5 Wang C, Sarnow P & Siddiqui A (1993) Translation of
human hepatitis C virus RNA in cultured cells is
mediated by an internal ribosome-binding site. J Virol
67, 3338–3344.
6 Rijnbrand R, Bredenbeek P, Van Der Straaten T, Whet-
ter L, Inchauspe G, Lemon S & Spaan W (1995) Almost
the entire 5¢ non-translated region of hepatitis C virus
is required for cap-independent translation. FEBS Lett
365, 115–119.
7 Yanagi M, St Claire M, Emerson SU, Purcell RH &

Bukh J (1999) In vivo analysis of the 3¢ untranslated
region of the hepatitis C virus after in vitro mutagenesis
of an infectious cDNA clone. Proc Natl Acad Sci USA
96, 2291–2295.
8 Friebe P & Bartenschlager R (2002) Genetic analysis of
sequences in the 3¢ nontranslated region of hepatitis C
virus that are important for RNA replication. J Virol
76, 5326–5338.
9 Yi M & Lemon SM (2003) 3¢ nontranslated RNA sig-
nals required for replication of hepatitis C virus RNA.
J Virol 77, 3557–3568.
10 Tanaka T, Kato N, Cho MJ, Sugiyama K & Shimo-
tohno K (1996) Structure of the 3¢ terminus of the hepa-
titis C virus genome. J Virol 70, 3307–3312.
11 Blight KJ & Rice CM (1997) Secondary structure deter-
mination of the conserved 98-base sequence at the 3¢
terminus of hepatitis C virus genome. J Virol 71, 7345–
7352.
12 Oh JW, Sheu GT & Lai MM (2000) Template require-
ment and initiation site selection by hepatitis C virus
polymerase on a minimal viral RNA template. J Biol
Chem 275, 17710–17717.
13 Schuster C, Isel C, Imbert I, Ehresmann C, Marquet R &
Kieny MP (2002) Secondary structure of the 3¢ terminus
of hepatitis C virus minus- strand RNA. J Virol 76, 8058–
8068.
14 Smith RM, Walton CM, Wu CH & Wu GY (2002)
Secondary structure and hybridization accessibility of
hepatitis C virus 3¢-terminal sequences. J Virol 76,
9563–9574.

15 Friebe P, Lohmann V, Krieger N & Bartenschlager R
(2001) Sequences in the 5¢ nontranslated region of hepa-
titis C virus required for RNA replication. J Virol 75,
12047–12057.
T. Astier-Gin et al. Binding and replication of 3¢-end of HCV minus RNA
FEBS Journal 272 (2005) 3872–3886 ª 2005 FEBS 3885
16 Kim YK, Kim CS, Lee SH & Jang SK (2002) Domains
I and II in the 5¢ nontranslated region of the HCV gen-
ome are required for RNA replication. Biochem Biophys
Res Commun 290, 105–112.
17 Reigadas S, Ventura M, Sarih-Cottin L, Castroviejo M,
Litvak S & Astier-Gin T (2001) HCV RNA-dependent
RNA polymerase replicates in vitro the 3¢ terminal
region of the minus-strand viral RNA more efficiently
than the 3¢ terminal region of the plus RNA. Eur J
Biochem 268, 5857–5867.
18 Oh JW, Ito T & Lai MM (1999) A recombinant hepati-
tis C virus RNA-dependent RNA polymerase capable
of copying the full-length viral RNA. J Virol 73, 7694–
7702.
19 Reigadas S, Ventura M, Andreola ML, Michel J,
Gryaznov S, Tarrago-Litvak L, Litvak S & Astier-Gin
T (2003) An oligonucleotide complementary to the SL-
B1 domain in the 3¢-end of the minus-strand RNA of
the hepatitis C virus inhibits in vitro initiation of RNA
synthesis by the viral polymerase. Virology 314, 206–
220.
20 Kashiwagi T, Hara K, Kohara M, Iwahashi J, Hamada
N, Honda-Yoshino H & Toyoda T (2002) Promoter ⁄
origin structure of the complementary strand of

hepatitis C virus genome. J Biol Chem 277, 28700–
28705.
21 Yanagi M, St Claire M, Shapiro M, Emerson SU,
Purcell RH & Bukh J (1998) Transcripts of a chimeric
cDNA clone of hepatitis C virus genotype 1b are infec-
tious in vivo. Virology 244, 161–172.
22 Mottola G, Cardinali G, Ceccacci A, Trozzi C,
Bartholomew L, Torrisi MR, Pedrazzini E, Bonatti S &
Migliaccio G (2002) Hepatitis virus nonstructural pro-
teins are localized in a modified endoplasmic reticulum
of cells expressing viral subgenomic replicons. Virology
293, 31–43.
23 Moradpour D, Gosert R, Egger D, Penin F, Blum HE &
Bienz K (2003) Membrane association of hepatitis C
virus nonstructural proteins and identification of the
membrane alteration that harbors the viral replication
complex. Antiviral Res 60, 103–109.
24 Aizaki H, Lee K-J, Sung VM, Ishiko H & Lai MM
(2004) Characterization of the hepatitis C virus RNA
replication complex associated with lipid rafts. Virology
324, 450–461.
Binding and replication of 3¢-end of HCV minus RNA T. Astier-Gin et al.
3886 FEBS Journal 272 (2005) 3872–3886 ª 2005 FEBS