Báo cáo Y học: Regulation of a1,3galactosyltransferase expression in pig endothelial cells Implications for xenotransplantation doc

Regulation of a1,3galactosyltransferase expression in pig
endothelial cells
Implications for xenotransplantation
Dominique Mercier
1,2
, Beatrice Charreau
3
, Anne Wierinckx
2
, Remco Keijser
1
, Lize Adriaensens
1
,
Renate van den Berg
1
and David H. Joziasse
1
1
Department of Molecular Cell Biology, Research Institute of Immunology and Inflammatory Diseases and
2
Department of Medical Pharmacology, Research Institute Neurosciences VU, VUmc, Amsterdam, the Netherlands;
3
Institut de Transplantation et de Recherche en Transplantation (ITERT), INSERM U437, Nantes, France
The disaccharide galactosea1,3galactose (the aGal epitope)
is the major xenoantigen responsible for the hyperacute
vascular rejection occurring in pig-to-primates organ trans-
plantation. The synthesis of the aGal epitope is catalyzed by
the enzyme a1,3-galactosyltransferase (a1,3GalT). To be
able to control porcine a1,3GalT gene e xpression specific-
ally, we have analyzed the ups tream portion of the a1,3GalT

gene, and identified the regulatory sequences.
Porcine a1,3GalT transcripts were detected by 5¢ RACE
analysis, and the corresponding genomic sequences were
isolated from a phage library. The porcine a1,3GalT g ene
consists of at least 1 0 d ifferent exons, f our of which c ontain 5 ¢
untranslated sequence. Four distinct promoters, termed A–
D, d ri ve a1,3GalT g ene t ranscription in porcine cells. A
combination of a lternative promoter usage a nd alternative
splicing produces a series of transcripts that differ in their 5¢
portion, but encode the same p rotein.
Promoters A–C have been isolated, and functionally
characterized using luciferase reporter gene assays in trans-
fected porcine endothelial cells (PEC-A). Promoter prefer-
ence in porcine endothelial cells was estimated on the basis o f
relative transcript levels as determined by real-time quanti-
tative PCR. More than 90% of the a1,3GalT transcripts in
PEC-A cells originate from promoter B, which has charac-
teristics of a housekeeping gene promoter. While promoter
preference remains unchanged, a1,3GalT mRNA levels
increase by 50% in 12 h upon tumour necrosis factor
a-activation of P EC-A cells. However, the magnitude of this
change induced by inflammatory conditions could be
insufficient to affect cell surface a1,3-galactosylation.
Keywords: a1,3galactosyltransferase; promoter; pig endo-
thelial cells; regulation; xenotransplantation.
The growing disparity between the demand for transplant-
able organs and the supply has renewed interest in the
possibilities of transplanting animal organs to humans
(xenotransplantation) [1]. Several animal species have been
evaluated f or their suitability a s organ donor. Currently,

pigs are con sidered as the most suitable donor animal
because pig organs are physiolo gically similar to human
organs and the potential risk of pathogen transmission is
low when compared w ith the use of o rgans from species
closely related to humans [1, 2]. But when transplanted into
humans or nonhuman primates, pig organs are rejected
hyperacutely by antibody-mediated complement activation
[3–5]. The hyperacute rejection i s i nitiated by the interaction
between natural preformed anti-pig Ig (xeno reactive natural
antibodies) and carbohydrate epitopes expressed by endo-
thelial cells of donor organs. T his results in the activation of
the classical complement pathway with concomitant endo-
thelial cell activation, which ultimately induces graft failure
[4]. A major portion (about 80%) of xenoreactive natural
antibodies is directed against a single determinant, the
terminal disaccharide structure galactosea1,3galactose (the
aGal epitope), present o n the surface of p ig vascular
endothelium [6–8]. These anti-Gala1,3Gal Ig, originally
identified by Galili et al. [9], are also found in apes and Old
World mo nkeys, bu t not in lower primates (e.g. New World
monkeys) or nonprimate mammals (including the pig). The
latter species express the aGal e pitope, whereas humans and
higher primates don’t [9–11].
Xenoantigens that contain the Gal a1,3Gal structure are
synthesized by UDP-Gal:Galb1,4GlcNAc a1,3galactosyl-
transferase (a1,3GalT). Genes and cDNAs encoding the
a1,3GalT e nzyme have been cloned from several species
(cow, mouse and pig) [12–16]. In humans, one pseudogene
(HGT-10) and one retro-processed pseudogene (HGT-2)
have been identified, both containing multiple frame-shift

mutations and internal stop codons in the protein coding
sequence [17–19]. The absence of a functional a1,3GalT
gene copy in humans, and in apes and Old W orld monkeys,
explains the absence of aGal epitopes in these species. In
Correspondence t o D.Mercier, Department ofMedical Pharmacology,
Research Institute Ne urosciences, Vrije Universiteit Medical Center,
van der B oechorststraat 7, 1081 BT Amsterdam, the N etherlands.
Fax: + 31 20 444 81 00, Tel.: + 31 20 444 80 96,
E-mail:
Abbreviations:AhR,arylhydrocarbonreceptor;Arnt,AhRnuclear
translocator; C/EBP, CCAAT/enhancer-binding protein; GAPDH,
glyceraldehyde 3-phosphate dehydrogenase; NF-jB, nuclear factor j
beta; pPAEC, primary pig aortic endothelial cell; Q-PCR, real-time
quantitative PCR; TNFa, tumor necrosis factor a;YY1,YingYang1
transcription factor.
(Received 28 September 2001, revised 7 January 2002, accepted 16
January 2002)
Eur. J. Biochem. 269, 1464–1473 (2002) Ó FEBS 2002
mouse a nd pig, the c oding r egion of the a1,3GalT gene is
distributed o ver s ix exons that span 24 kb of genomic DNA
(18 k b in mouse) [13, 20, 21]. In addition, the gene contains
several 5¢ noncoding exons.
A suppression of the a1,3-galactosylation of the donor
organ will possibly overcome hyperacute rejection, and t hus
facilitate xenotransplantation. Therefore, efforts have been
directed at targeting t he porcine a1,3GalT gene [22–24], but
thus far, no viable knockout pigs have b een produced. The
design of more subtle methods to down-regulate a1,3GalT
expression in a time- and tissue-dependent fashion requires
an understanding of the regulation o f a1,3GalT g ene

transcription. Therefore we have a nalyzed a1,3GalT regu-
lation in pig endothelial cells. We have set out to isolate the
sequences upstream of the 5¢ untranslated exons. T hree of
the four putative promoter regions were isolated from a pig
genomic library, and functionally characterized using gene
reporter assays. When t ransiently transfected into pig aortic
endothelial cells, all three putative promoter regions were
able to drive luciferase transcription. Relative importance of
the different promoters was determined in resting and
tumor nec rosis fa ctor a (TNFa) stimulated e ndothelial cells
using real-time quantitative P CR (Q-PCR). Results indica-
ted that more than 90% of the a1,3GalT gene expression in
pig e ndothelial cells was associated with only one of the four
putative promoters (promoter B). The modest effect of
TNFa treatment on a1,3GalT transcription suggests that
the various promoters are only weakly s ensitive to inflam-
matory conditions.
MATERIALS AND METHODS
Cells and cell lines
COS7 cells were obtained from the Netherlands Cancer
Institute (Amsterdam, the Netherlands). The pig kidney
cells (PK15) were obtained from A. Roos (Department of
Nephrology, Leiden University Med ical C enter, the Neth-
erlands). Pig aortic endothelial cells (PEC-A [25]), and pig
primary aortic endothelial cells (pPAECs) were provided by
J. Holgersson (Karolinska Institute, Huddinge, S weden)
and B. Charreau (Institut de Transplantation et de Recher-
che en Transplantation, Nantes, France), respectively. All
cells were cultured in Dulbecco’s modified Eagle’s medium
supplemented w ith 10% of fetal bovine serum and 100 units

of penicillin/streptomycin (Life Technologies).
Probe preparation
Pig genomic DNA was prepared from PK15 cells
(2–3 · 10
6
cells) using proteinase K ( Boehringer-Mann-
heim) treatment [26] and phenol/chloroform extraction.
PCR using pig genomic DNA (100 ng) and primers p1 and
p2 (Table 1) hybridizing to 5¢ untranslated exons 2 and 3,
respectively, w as carried out under the following conditions:
one cycle of 2 min a t 94 °C, 15 s at 68 °Cand5minat
72 °C; 35 cycles of 10 s at 94 °C, 15 s at 65 °C, and 1 min at
72 °C i ncremented with 1 s at each cycle, followed by a final
extension at 72 °C for 7 min. The amplified fragment
(538 bp) was purified from a 2% agarose gel (Nucleotrap
nucleic acid purification kit, Clontech), cloned into the
vector pGEM-T easy (pGEM-T easy vector system,
Promega) and sequenced (T7 sequencing kit, USB) using
primers ( SP6 a nd T7) flanking the c loning site. This
fragment was used as a probe to screen for phage clones
containing the A /C region. A second probe w as generated
from PK15 cDN A using primers p3 and p 4 ( Table 1) under
the conditions described previously and was used to screen
for ph age clones containing the p utative p romoter B region.
Isolation of promoter regions B and A/C
A pig genomic library (Clontech) was screened by a standard
plaque hyb ridization m ethod, according to the manufac-
turer’s recommendations. Two probes were used in these
experiments. The first one, d esigned to isolate the promoter
C region, contained the pig a1,3GalT exon 2/intron 2/exon 3

(generated as described above) and the second one, suitable
for t he cloning o f promoter B region, contained exon 1.
After plating (2.5–3 · 10
5
plaques, 5 · 10
4
plaques per
Table 1. Sequences of oligonucleotides used.
Primer name Sequence (5¢-3¢) Localization Target
p1 TCAAACAGAACAACTTCTGAAGCC Exon 2 Promoter A
p2 GCTCTGCTCTGCAGAAGGAGGC Exon 3 Promoter A
p3 GCCACTGTTCCCTCAGCCGAG Exon 1 Promoter B probe
p4 CTGATCGGCAGAAGCTGGGTG Exon 1 Promoter B probe
p5 CCAAGGGTGGTGGCTGTCCCTC Exon 3 Promoter A
p6 TGTCCCTGCTAGTTGTCATTTGG Intron 2 Promoter A
p7 ACGACCACTTTGTCAAGCTCATT GAPDH
p8 TGAGGTCCACCACCCTGTTG GAPDH
p9 TCCTGAAACGCCTTCGGAAGAG E-selectin
p10 CCATTGGGTTGAAGGCATTCG E-selectin
p11 ACAAGGCCCCTGGCTGCT Exon 3 a1,3GalT-5¢-A
p12 CCTGTCAAAAGAATAAACAGCGGTT Exon 3 a1,3GalT-5¢-A
p13 CACTGTTCCCTCAGCCGAGGAC Exon 1 a1,3GalT-5¢-B and -E
p14 CCAACTCCTGATCGGCAGAAGC Exon 1 a1,3GalT-5¢B and E
p15 ACTTCTGAAGCCTAAAGGATGCGA Exon 2 a1,3GalT-5¢-C
p16 AGGCAGGGCTGGGAGGAA Exon 3 a1,3GalT-5¢-C
p17 TTGCTGTCGGAAGATACATTGAG Exon 8 a1,3GalT-coding region
p18 CTTTGTGGCCAACCATGAAGTA Exon 9 a1,3GalT-coding region
Ó FEBS 2002 Regulation of a1,3GalT expression in pig endothelial cells (Eur. J. Biochem. 269) 1465
plate), the plaques were transferred t o H ybond N
+

(Amersham) membranes (two membranes per plate) and
hybridized in 40 m
M
Na
2
HPO
4
,7%SDS,1m
M
EDTA
with the labeled probe (10
6
c.p.m. per membrane) labeled
with [a-
32
P]dCTP (3000 CiÆmmol
)1
, Amersham) using the
Prime-a-gene labeling system (Promega). Double-positive
clones were purified by secondary and tertiary r ounds of
screening and genomic DNA inserts were purified using
poly(ethylene glycol) precipitation [26]. The phage inserts
were mapped by restriction digestion and Southern blot
analysis. Hybridizing DNA fragments were then subcloned
in pBluescript SK + (pBS, Stratagene) and sequenced.
Generation of a1,3galactosyltransferase promoter
luciferase constructs
All the promoter luciferase constructs were subcloned i n t he
reporter plasmid pGL3-Enhancer (Promega). pGL3-
Enhancer contains SV40 enhancer sequences, and is used

rather than pGL3-Basic in view of the relatively low
transcriptional activity of the a1,3GalT promoter.
Clone A represents vector pGEM-T-easy containing the
whole PCR fragment (nucleotides 1249–1786) correspond-
ing to the putative promoter A region (see above). For
construct A.1 (promoter A , construct 1), the P CR fragment
(nucleotides 1249–1786) was excised from clone A with
EcoRI. Construct A.2 (nucleotides 1388–1786) was gener-
ated by PCR (primers p6 and p2, Table 1), in which clone A
DNA was the template. In a s imilar w ay, const ruct A.3
(nucleotides 1483–1786) was also made by PCR, using
primers p5 and p2 (Table 1). For construct A.4, the 5¢ part
(nucleotides 1249–1611) of the insert w as delet ed from the
clone A by Hi n cII digestion . For construct A .5, a Sty I-
internal fragment was deleted from the clone A (Dnt1484–
1590). Construct A.6 was made using a blunted
StyI-fragment of clone A (nucleotides 1484–1590).
Construct A .7 consisted of a HincII fragment ( nucleotides
1249–1611) of clone A.
For promoter B sequences, a BamHI fragment was used
that originated from the hybridization-positive phage clone
2.3.1, isolated from the genomic library. This 2.7-kb DNA
fragment was ligated with plasmid pBS. Part of the intronic
sequence (intron 1, nucleotides 1385–2695) was deleted by
SmaI digestion and re-closure, and the clone thus obtained
(pBS clone B) was used for further constructs. Construct B.1
contained a Bgl II/HindIII fragment of 1.2 kb ( nucleotides
175–1385). An antisense construct (B.2, nucleotides 1385–
175) was also made using a BglII/SmaI digestion. The two
other constructs (B.3 and B.4) contained SacIfragment

nucleotides 29–1099 cloned in sense (B.3) or antisense (B.4)
orientations.
Constructs for the promoter C were made using the
1.8-kb BamHI fragment which was isolated from hybrid-
ization-positive phage clone 2.1.3, and subcloned in pBS.
Constructs C.4 and C.5 consisted of a BglII fragment
(nucleotides 712–1219) and a SacI/Bgl II fragment (nucleo-
tides 1–711), r espectively. Construct C .1 ( nucleotides
1–1219) was made from construct C.5 linearized with BglII
by insertion of the BglII fragment from C.4 (nucleo tides
712–1219). Taking advantage of unique restriction sites in
the insert of C.1 and in the pGL3-Enhancer plasmid, NdeI
(Dnt1–164) a nd PvuII (Dnt1–475) fragments were also
deleted, yielding constructs C.2 and C.3, respectively.
The presence of the insert and its orientation in the
plasmids was checked using restriction enzyme mapping
and sequencing. For the position of the relevant restriction
sites see b elow.
Transient transfections and luciferase assays
COS7 and PEC-A cells were grown in complete medium as
described above (10
5
cells per well plated in 24-well plates).
The DNA transfection complex was p repared by m ixing
0.5 lg of luciferase construct a nd 0.25 lgofpCH110
plasmiddilutedin30 lL of serum-free m edium a nd 3 lLof
SuperFect reagent (Qiagen) per well. After 5–10 m in of
incubation at room temperature, the mixture was diluted
with 170 lL o f Dulbecco’s modified Eagle’s medium
containing 10% of fetal bovine serum and added t o the

cells. After 3 h of incubation at 37 °C, the m ixture w as
replaced by 400 lL o f c omplete m edium. The b-galactosi-
dase plasmid pCH110 (Amersham), containing the SV40
early promoter, served as an internal control for transfection
efficiency. pGL3-Control ( i.e. pGL3-Enhancer plas mid
containing the early promoter of SV40, Promega) was used
as a positive control, and empty pGL3-Enhancer plasmid a s
the n egative c ontrol. All the constructs were tested in two or
three i ndependent experiments, each performed in triplicate.
Luciferase reporter and b-galactosidase assays for cell
extracts were performed 48 h after the start of the transfec-
tion. Luciferase activity was measured using the Luciferase
assay system (Promega) and 5 lL ( out of 60 lL) of cell
extract in a BioOrbit-1250 luminometer (BioOrbit).
b-Galactosidase activity was assayed using ortho-nitrophe-
nyl-b-
D
-galactopyranoside as t he substrate, and t he am ount
of reaction product was determined from the absorbance a t
420 nm.
TNFa activation of pig endothelial cells
and cDNA synthesis
pPAEC and PEC-A cells were cultured as described above
and were stimulated with 100 U ÆmL
)1
of recombinant
human TNFa (hTNFa; CLB, the Netherlands) added to
the medium for different periods o f time (1, 2, 4, 8 , 12, 24, 48
and 72 h). After activation, cells were washed in phosphate
buffered saline (NaCl/P

i
),lysedinSVRNAlysisbuffer
(175 lL per well), and total RNA was extracted using the
SV total RNA isolation system (Promega) according to
manufacturer’s recommendations. One microgram of t otal
RNA was reverse transcribed using the R everse transcrip-
tion system (Promega).
Transcript quantification
cDNAs w ere quantified using Q -PCR. Samples were run on
the ABI PRISM 7700 sequence detector system using
SYBR green PCR core reagents (PE Applied Biosystems).
Q-PCR was carried out in a volume of 25 lL containing
12.5 ng of cDNA, 2.5 m
M
MgCl
2
,0.2m
M
dATP, dCTP,
dGTP and dTTP, 0.35 U Ampli-Taq Gold DNA and
0.14 U AmpErase uracil-N-glycosylase. The PCR condi-
tions were as follows: 4 0 cycles of 1 5 s at 95 °Cand1minat
60 °Ceach.
Primers (Table 1) f or pig glyceraldehyde-3-phosphate
dehydrogenase (GAPDH) (p7 and p8), E-selectin (p9 and
1466 D. Mercier et al. (Eur. J. Biochem. 269) Ó FEBS 2002
p10), a1,3GalT transcripts 5¢-A (p11 and p12), 5¢-B (p13
and p14), 5¢-C (p15 and p16), and total amount of pig
a1,3GalT m RNA (p17 and p18) were used with cDNA
from pPAECs or PEC-A cells (either activated or not with

human TNFa) a s the template. GAPDH was used to
normalize the quantity of cDNA used for each a ssay, and
background due to primer dimerization was c hecked with
nontemplate controls (reaction without cDNA). The activ-
ation e fficiency of the endothelial c ells was tested by
quantification of E-selectin transcripts (GenBank accession
number L 39076) as a control. Ct values, corresponding to
the cycle number required for fluorescence intensity to
exceed an arbitrary threshold in t he exponential phase of the
amplification (0.3 arbitrary units), were determined for all
the samples and the gene to be analyzed. In addition, to
quantify the mRNA copy numbers standard curves were
generated. Plasmids containing exon 2-intron 2-exon 3
(pGEM-T-easy clo ne A), exon 1 (pBS clone B), exons 8
and 9 (PCR product obtained with primers p17 and p18,
Table 1 , subcloned in pGEM-T-easy) or pig E-selectin
cDNA, corresponding to transcripts 5¢-A and -C, 5¢-B
and -E, a1,3GalT coding sequence and E-selectin, respect-
ively, were selected. Various amounts of these different
plasmids (from 10
3
to 10
6
copies per reaction) were used in
Q-PCR assays, and data obtained for each concentration
(2
Ct
) were plotted against the amounts.
RESULTS
The organization of the pig a1,3GalT gene

Using 5¢ RACE analysis, we confirmed the occurrence
in porcine endothelial cells of four transcripts 5 ¢-A, -B, - C
and -E, described earlier by K atayama et al.[20].Inorderto
complete the model of the pig a1,3GalT gene organization,
we have compared the structure of the various a1,3GalT
transcripts with p artial maps of the gene o rganization as
established by Koike et al . [21] and Katayama et al. [20].
Transcripts A–E encode the same protein, but differ in the
structure of their 5¢ ends by the presence or absence of one
or more untranslated exons. These exons were mapped onto
genomic s equences us ing long-distance PCR, w hich allowed
us to establish the order of t he exons, and also to estimate
intron sizes. A model of the a1,3GalT genomic structure,
showing how the various transcripts are formed by a
combination of alternative start site usage and alternative
splicing, is presented in Fig. 1. By 5¢ RACE analysis of
primary porcine endothelial cell ( pPAEC) cDNA we have
identified a n additional, sixth transcript, termed 5¢-F. This
transcript contains untranslated exons 0, 1 and 3, which
confirms that exon 0 previously identified by Katayama
et al. [20] is indeed authentic. In addition, PCR analysis of
porcine genomic DNA showed that the s tart sites that give
rise to transcripts 5¢-A and -C are closely spaced. An intron
of only 427 bp separates exon 2 from exon 3. In fact,
transcript A starts within this intron 2, 94 bp upstream of
the start of exon 3. Similarly, sequences upstream of exon 1
either serve as intron (intron 0), or are retained in the
processed mRNA, depending on the start site used. More
recently, Koike et al . [21] detected two more transcripts
starting in intron 0 (cf. Fig. 1).

BasedonRT-PCR,piga1,3GalT is expressed in l ung and
in all cell types investigated so far (kidney PK15 cells,
hepatocytes, endothelial cells). Transcripts 5¢-B and/or -E
have been detected in all samples, and 5¢-A in most of them
with the exception of hepatocytes . The 5¢-C and - F
transcripts are present in pPAECs. Transcript 5¢-D was
not detected in any of the samples studied here.
Cloning and sequence analysis of pig a1,3GalT
promoter regions
The available a1,3GalT cDNA sequences (this paper and
[20]) were used to generate DNA probes by PCR, with the
aim t o i solate relevant 5¢ flanking sequences of the g ene
from a genomic library. As start sites A and C had been
found to be closely spaced, a single probe was sufficient to
screen the library for their individual regulatory sequences.
To isolate the genomic region upstream of the 5¢-A
transcript, we performed PCR o n pig genomic DNA using
primers p1 and p2 that hybridize with exons 2 and 3,
respectively. A fragment of 538 bp was obtained ( clone A),
which contains e xon2-intron2-exon3 sequences that overlap
with the putative promoter A region (Fig. 2B, GenBank
accession number: AF415202). This fragment was used as a
probe to screen the pig genomic library. A single hybrid-
ization-positive clone (phage 2.1.3) containing an insert of
14 kb was isolated. Southern blot analysis of the phage
DNA confirme d t hat a major portion of the probe sequence
is included in a 1.6-kb BamHI fragment (Fig. 2A). This
DNA fragment contains 1.2 k b of sequence upstream of
start site C (Fig. 2B, GenBank accession number:
AF415202), as well as 430 bp of clone A. Sequences thus

obtained were scanned for putative transcription factor
binding sites using TRANSFAC. E xon 3 is preceded by a
well-conserved pyrimidine-rich acceptor splice site which is
functional i n all transcripts 5¢-B, - C and -F. The 538-bp
sequence of clone A does not contain TATA o r CAAT-
boxes, but multiple putative transcription factor binding
ATGExon 0 Exon 1 Exon 2 Exon 3
Exon 4
5'-A
5'-B
5'-E
5'-C
5'-D
5'-F
16 kb0.5 kb
n.d.
n.d.
D B C A
Koike et al [21]
Fig. 1. Schematic representation of the a1,3galT gene and transcript
structures. Exon numbers are indicated above the correspo nding exons
on the gene structure . The sizes of introns 2 and 3, determined using
long-PCR, are indicated below the gene stru cture. T he length of
introns 0 and 1 could not be determine d (n.d.). Untranslated exonic
sequence is indicated b y white or gray boxes, co ding sequence is
indicated in black . Gray b oxes are fl anked on b oth sides by consensus
splice sites. Structures of the 5¢ e nd of the different transcripts identified
in this paper (5¢-A, -B, -E and -F) or by Katayama et al.(5¢-A to -E
[20]), and/or Koike et al. [21] are drawn below the gene structure.
Ó FEBS 2002 Regulation of a1,3GalT expression in pig endothelial cells (Eur. J. Biochem. 269) 1467

sites that could be important for promoter activity in pig
cells, such a s GATA- and GC-boxes, AP-1, Inr and YY1
are present (Fig. 2B).
Analysis of the sequences upstream o f t he exon 2
transcriptional start site revealed the presence o f four
putative NF-jB binding sites (Fig. 2B) located at nucleo-
tides 86, 167, 371 and 552, respectively. A dditional potent ial
transcription factor binding sites such as Oct-1, AP-1,
GATA- a nd GC-boxes are distributed all along the
promoter C sequence, and a TATA-box is present 16 bp
downstream of the transcriptional start site of exon 2
(Fig. 2B).
In order to clone the putative promoter B region, the
genomic library was screened with a probe corresponding t o
exon 1. Phage clone 2.3.1 thus isolated contained an 11-kb
insert; BamHI digestion of the DN A produced a 2.7-kb
fragment that hybridized with the p robe (Fig. 3A, GenBank
accession number A F415201). This f ragment contains
1.18 kb of sequence upstream of exon 1, exon 1 itself, and
1.36 kb of intron 1. The GC c ontent of the whole fragment
is about 60%, and in the 1.6-kb region between nucleotides
724 a nd nucleotide 233 5 (Fig. 3B) it reaches 68%. Associ-
ated with the high GC content of this r egion, 12 putative
Sp1 binding sites are present. In addition, the promoter B
region contains numerous putative t ranscription factor
binding sites including GATA-boxes, Oct-1, e ts-1, AP-1,
NF-jB and C/EBP sites (Fig. 3B).
Unfortunately, out of the 6 · 10
5
plaques s creened with a

probe corresponding to exon 0, no positive genomic clones
containing exon 0 upstream sequences (promoter D region)
were isolated. The stro ng homology of e xon 0 sequences
with a portion of the porcine invariant chain gene [21] could
be responsible of the isolation of the false positive clones
from the l ibrary.
To search for preferred transcriptional start s ites, a RNA
polymerase II context analysis was performed on promoter
regions A, B and C using
PROMOTERINSPECTOR
software
(Genomatix). Results indicated that promoter region B
contains two putative RNA polymerase II binding regions
located at nucleotides 677–1296 (upstream of exon 1) and
nucleotides 2 201–2392 (within intron 1), r espectively,
whereas promoters A and C do not seem to contain such
regions.
Functional characterization of the porcine a1,3GalT
promoters
Luciferase reporter gene assays were performed to test the
ability of the clon ed sequences to drive transcription. To
characterize the promoters in more detail, a deletion
analysis was carried out. The various test fragments were
placed upstream of the luciferase gene, a nd the resulting
plasmid constructs were transiently transfected into cultured
cells. In view of the relatively low efficiency of transfection
of primary endothelial c ells, these experiments were p er-
formed using the e stablished cell line PEC-A [25].
Construct A.1 that contains the entire 5 38-bp promoter A
fragment is able to drive luciferase gene transcription in

PEC-A pig endothelial cells (Fig. 4A, open bars). Deletion
of the 140 bp 5¢ portion of the fragment t o give A.2 did not
affect activity, but deletion of an additional 9 6 bp ( construct
A.3) re sulted in a fivefold lower luciferase a ctivity (Fig. 4A).
A segment of 1.2-kb containing putative promoter C
regulatory regions was also analyzed. The full 1.2-kb
sequence (construct C.1, containing nucleotides 1–1219)
was able to drive transcription in PEC-A cells (Fig. 4 B,
open bars). Deletion of a 164-bp (C.2) or 719-bp (C.4) 5¢
fragment resulted in a fourfold and t wofold reduction in
luciferase activity, respectively.
ForpromoterB,afragmentof1.2 kb (nucleotides 175–
1385 in Fig. 3B) containing most of the GC-rich region was
studied. When transiently transfected into PEC-A cells,
construct B.1 produced a luciferase a ctivity ninefold greater
than negative control ( Fig. 4C). Deletion of the 3 ¢ 286-bp
portion (construct B.3) did not change the activity, which
5'-C [20]
A
1 2 3 4
6

3


1.5

0.5
Size in kb

AP-1 Oct-1
NF-κB
GATA
Nde I Pvu II
GATA AP-1
BamH
I
NF-
κB NF-κB
1 50 100 150 200 250 300 350 400 450
500
ets-1GATA
GATASp1
Bgl II
C/EBPNF-κB
Sp1 Sp1
Sp1
501 550 600 650 700 750 800 850 900 950
1000
Sp1
TATA
AP-1
Bgl II
Ap-1
p1
ets-1
GATA YY1 GATA
Sty I
exon 2
NF-κB

1001 1050 1100 1150 1200 1250 1300 1350 1400 1450
1500
GATA
Sp1
Sty I Hinc II BamH I
5'-A [20]
GATAAp-1 GATA
Inr
p2
Sp1
exon 3
1501 1550 1600 1650 1700 1750 1800
B
Fig. 2. Schematic representation of the a1,3GalT promoter A an d C
regions. (A) Southern blot analysis. DNA prepared from phage 2.1.3
isolated from the pig genomic library was digested with various
restriction enzymes, and hybridized with the clone A DNA fragment
(see Materials a nd m eth ods). Siz es o f t he d ifferent bands of t he DN A
marker are indicated on the left of the figure. Lane 1: PstI, lane 2:
HindIII, lane 3: EcoRI , lane 4: BamHI. (B) Schematic representation
of th e a1,3GalT promoter A and C regions. Positions of primers used
to gen erate the 5 38-bp fragment ( Table 1) a re positioned un der the
sequence and are indicated by horizontal arrows. Restriction enzyme
sites used to generate the different reporter gene con structs are indi-
cated by vertica l lines ab ove the sequen ce. Exonic sequences (exon 2
and 3) a re indicated b y gray boxes. The sta rt sites of transcript 5¢-A
and -C are in dicated [20]. Putative transcription factor b inding sites
detected using
TRANSFAC
are indicated above the seque nce a nd are

represented by ho rizon tal lines.
1468 D. Mercier et al. (Eur. J. Biochem. 269) Ó FEBS 2002
underlines the importance of the 5¢ part of the fragment.
The same fragments in antisense orientation did not differ
significantly from the negative control (cf. B.2 and B.4).
To determine whether the constructs mediated cell-type
specific expression, they were also transfected into African
green monkey COS7 c ells. Each of the co nstructs A.1, B.1
and C.1 was able to drive transcription, and, generally,
activities observed in COS7 cells were higher than those in
PEC-A cells. Deletion of the 140-bp 5¢ portion of A.1
(construct A.2) resulted in a 10-fold increased luciferase
activity (Fig. 4 A). Upon deletion o f an a dditional 96-bp
(construct A.3) activity decreased to a value close to that of
A.1. Deletion constructs A.4 to A.7, even w hen containing
fragment nucleotides 1388–1483, were inactive (Fig. 4 A).
For p romoter C, a ctivity i n COS7 c ells seems to be
associated with the 0.5-kb 3¢ segment o f C.1, as the 0.7-kb
5¢ portion by itself (C.5 in Fig. 4B) is 10 times less active
than the full-length fragment C.1. C onstruct B .1 produced a
luciferase activity four times higher than in P EC-A cells. The
2
BamH I Bgl IINde I Pvu II Bgl II
0 50 100 150 200 1000 6000
C.3
123
C.5
12
5136
48

pGL3-Control
C.1
158
85
C.2
123
20
C.4
120
48
pGL3-Enhancer
5
5
Normalized Luciferase Activity (mV)
B
0 50 100 150 200
1000
6000
B.1
202
45
B.2
58
5.5
B.3
159
42
1
Bgl IISac I Sac I Sma
I

HinD III
B.4
39
7.5
pGL3-Control
5136
48
pGL3-Enhancer
5
5
Normalized Luciferase Activity (mV)
C
5136
2
3
Sty I Sty
IEcoR I EcoR IHinc II
Hinc
II
A.4 0
A.5 0
A.6 0
A.7 0
0 50 100 150 200 1000 6000
A.1
113
199
A.3
165
40

pGL3-Enhancer
5
pGL3-Control
5
48
1170
A.2
186
Normalized Luciferase Activity (mV)
A
Fig. 4. Transcriptional activity of a1,3GalT promoter constructs in
COS7 and PEC-A cells. Theleftpartofthefigureshowsthestructure
of constructs made for p romoter A (A), C (B) and B (C), and their
relative positions in th e a1,3 GalT gene. Exonic (gray boxes), and
intronic (solid lines) sequences and r estriction enzyme sites are indicated
as well as s equences derived from the plasmid pBS (vertical lines). For
each construct, the segment of genomic sequence tested in luciferase
assay is i ndic ated by horizontal gray b ars. The right part of eac h panel
shows the results of transfection experiments for each construct; values
(in mV) are the means of three or fo ur separate experim ents, per-
formed in triplicate, ± SEM. Luciferase activities are normalized on
b-galactosidase activity from a cotransfected vector (see Materials and
methods). Solid and open b ars correspond to COS7 a nd PEC-A
transfection, respectively. Constructs A.4 to A.7, C.3 and C.5 were
only tested in COS7.
A


6

3

1.5

0.5
Si ze in kb
1

2

3

4 5
B
GATA GATA GATA
Bgl II
Koike et al [21]
Ap
-1
GATA
BamH
I
1 50 100 150 200 250 300 350 400 450
500
Oct
-1
Oct
-1
ets-1 Oct-1
Sp1

GATA
GATA
NF-
κB
501 550 600 650 700 750 800 850 900 950
1000
Koike et al
[21]
Sp1
Sp1
Sp1
Sp1
Sp1 Sp1
Sp1
AhR/Arnt
Sp1
Sac I
5'-E [20]
GATA
exon 1
10011050 1100 1150 1200 1250 1300 1350 1400 1450
1500
Sp1
5'-B
[20]
GATA
Sma
I
Sp1
GATA GATA GATASp1 Arnt

CREBets-1
1501
1550 1600 1650 1700 1750
1800
1850 1900 1950
2000
Sp1
Sp1
C/EBP
Oct-1 GATA
Sp1
GATA
ets-1
NF-
κB
2001 2050 2100 2150 2200 2250
2300 2350 2400 2450
2500
C/EBP
C/EBP
BamH
I
2501 2550 2600 2650
2700
GATA
GATA
Sac I
Fig. 3. Schematic representation of the a1,3GalT promoter B region.
(A) Southern b lot analysis. D NA of p hage 2.3.1, isolated from th e pig
genomic library, w as digested with various restriction enzymes, a nd

hybridized with a probe corresponding to exon 1 (see Mater ials and
methods). Sizes of the different bands of the DNA marker a re indi-
cated on the left of the figure. Lane 1: SacI, lane 2: PstI, lane 3:
HindIII, lane 4: EcoRI, lane 5: BamHI. (B) Schematic representation
of the promoter B region. Restriction enzym e sites used to generate the
different constructs are indicated by vertical lines above the sequence.
Exon 1 sequences are i ndicated by a gray box. The main transcrip-
tional start site used in t ranscripts produced f rom promoter B is
indicated [20]. Putative t ranscription factor binding sequences are
indicated above the sequence and are represented by ho riz ontal lin es.
The GC-rich region of pro moter B i s indicate d by a thi ck line.
Ó FEBS 2002 Regulation of a1,3GalT expression in pig endothelial cells (Eur. J. Biochem. 269) 1469
same fragment inserted in pGL3-enhancer in antisense
orientation was 3.5-fold less active (Fig. 4 C). Values
obtained f or the 3¢ truncated fragments B.3 and B.4
followed the same pattern as those observed for PEC-A
cells (Fig. 4C), in that the ability to drive transcription is
orientation dependent, and that 3¢ deletion of 286 b p did
not significantly alter activity.
Relative levels of a1,3GalT transcripts in pig
endothelial cells
Levels o f a1,3GalT transcripts in pPAEC and in a PEC-A
were measured using Q -PCR in order t o establish t he relative
importance, within the context of the full gene, of the three
different promoters identified above. Taking advantage o f
the sequence differences between the 5¢ regions of the
promoter specific transcripts, and assuming that the differ-
ences observed in terms of transcript levels are proportional
to promoter activity, specific primers ( Table 1) were
designed to follow variations of a1,3GalT g ene expression

in resting and TNFa-stimulated pig endothelial cells. The
strong homology of exon 0 to a portion of the porcine
invariant chain gene did not allow to d esign p rimers specific
of exon 0 and to quantify t he 5¢-D/5¢-F transcripts.
Additional primers were designed to determine expression
of GAPDH (normalization of cDNA quantities used in
Q-PCR) and E-selectin (control o f TNFa stimulation) genes.
Before activation of pPAEC, E-selectin transcripts w ere
present at  2 · 10
5
copies per lg of total RNA, and
a1,3GalT transcripts at 1.1 · 10
6
copiesÆlg
)1
. A mounts of
10
4
,10
6
and 2 · 10
4
copiesÆlg
)1
of total RNA were
measured for 5¢-A, 5¢-B and 5¢-C transcripts, respectively.
During TNFa-induced activation, E-selectin transcript
levels rapidly increased, reaching a maximum of abo ut
60 · 10
6

copiesÆlg
)1
after only 2 h of TNFa-treatment
(340-fold increase, Fig. 5A). A second peak was observed
after 24 h of induction (21 · 10
6
copiesÆlg
)1
,Fig.5A),
clearly indicating that the cells were properly activated in
this experiment. Total mRNA levels of a1,3GalT were also
checked during the time course of TNFa induction, as well
as the levels of 5¢-A, 5¢-B and 5 ¢-C transcripts. Total a mount
of a1,3GalT transcripts started to rise 2 h after the addition
of TNFa, to reach a plateau after 4 h of activation (55%
increase, to 1.8 · 10
6
copies per lg of total RNA, or  35
copies per cell). After 12 h the amount began to decrease to
reach 0.3 · 10
6
copiesÆlg
)1
( 6 copies p er cell) after 72 h of
stimulation. The 5 ¢-A and 5 ¢-B transcript le vels varied in
parallel with the total amount of a1,3GalT transcripts,
whereas quantities of 5¢-C transcripts are regulated
differently with two peaks of transcription, a first one
after 2 h ( increase of 82%) a nd a second one at
12 h (119% increase). At any activation time point studied,

5¢-B/E transcripts (which could not be distinguished by t he
method as used ) were f ound to correspond to 92–97% of
the total amount of a1,3GalT mRNA.
Unlike the pPAECs, PEC-A cells were poorly activated
by recombinant human TNFa (E-selectin increased only
2.5-fold, Fig. 5B). Nevertheless, quantities detected for each
of the a1,3GalT transcripts were similar to those observed i n
pPAECs. The total amount of a1,3GalT increased signifi-
cantly and reached a maximum of 141 % after 1 8 h of TNFa
activation. Furthermore, 5¢-B was found to be also the
most expressed transcript in PEC-A cells (80–90%) and
transcripts 5¢-A and 5¢-B followed t he same pattern of
variation as total a1,3GalT mRNA. But in contrast to
pPAECs expression, after longer periods of activation no
decrease was o bserved for 5¢-A , 5¢-B and total a1,3GalT
mRNAs. Both 5¢-A and 5¢-C transc ript quantities seem to
be higher in PEC-A cells (3% and 7% of the total amount
of a1,3GalT mRNAs, respectively) than in pPAECs (1%
for both). Lastly, the 5¢-C transcript presented a different
expression profile with only one peak reached after 4 h of
activation followed by a fourfold down-regulation after
longer stimulation.
DISCUSSION
Differences in cell surface glycosylation between hu man and
pigs form a major hurdle in organ transplantation from pig
Fig. 5. Kine tics of a1,3GalT mRNA isoforms induction in pPAEC (A)
andPEC-AcellsduringTNFa activation (B). The expression of
a1,3GalT after stimulation with TNFa was quantified using Q-PCR.
Primers specific of the 5¢ region of the different i soforms were u sed t o
quantify specifically each transcript sp ecies (5¢-A, 5¢-B and 5 ¢-C). Total

amount of a1,3GalT transcripts was estimated using primers binding
to the cod ing sequence (exons 8 and 9). E ffective activation of th e cells
was verified b y amplifi cation of E-selectin mRNA. The nu mb er o f
transcripts in the experimental samples was calculated from a c alib-
ration curve obtained by v arying the number of copies of a plasmid
containing the fragment to be amplified, and normalized based on
GAPDH levels.
1470 D. Mercier et al. (Eur. J. Biochem. 269) Ó FEBS 2002
to man. Modification of porcine glycosylation has been
considered as one strategy to facilitate xenotransplantation.
In this respect, it will be important to know the mechanism
of regulation of porcine terminal glycosylt ransferases.
Research focuses on a1,3GalT in p articular, as the latter
enzyme produces the Gala1,3Gal struct ure, the m ajor
porcine xenoantigen with a role both i n hyperacute r ejection
and in delayed vascular r ejection.
Here we have assembled the full structure of the 5¢
flanking regions of the porcine a1,3GalT g ene, completing
partial structures as reported by K atayama et al. [20] and
Koike et al. [21]. The gene consists of 10 exons, four of
whichcontain5¢ untranslated sequence and six coding
sequence. The exact structure of th e 5 ¢ flanking regions of
the a1,3GalT gene has been unclear. Koike et al. [21] have
suggested that exon 0 as detected by K atayama et al. [20]
and by t hemselves ( named e xon I i i n [ 21]) i n f act is b ased on
an artifact, and could be the result of an accidental link-up
of two unrelated sequences. Independently, we have isolated
from porcine endothelial cells a t ranscript, 5¢-F, that does
contain exon 0 in conjunction with additional, downstream
a1,3GalT exons 1 and 3–9. The occurrence o f t his transcript

in porcine cells seems to indicate that exon 0 as d escribed
previously is indeed an authentic portion of the a1,3GalT
gene. This would bring the total number of 5¢ noncoding
exons up to four.
At least four promoters, here called A –D, are involved in
the initiation of transcription of porcine a1,3GalT. Alter-
native start site usage together with alternative splicing in
the 5¢ region generates at least six different transcripts.
Moreover, it i s possible t hat two m ore transcripts a s
described by Koike et al. [21] are controlled by still another
regulatory sequence, as they initiate several hundreds of bp
upstream of the start of transcript 5¢-B (Fig. 3B). Alternat-
ive splicing of the porcine gene is not limited to the 5¢
flanking sequences, i t also occurs in the coding region.
Previously, i t w as reported that the murine a1,3GalT gene is
alternatively spliced in the sequence that encodes the Ôstem
regionÕ of the protein [13]. A similar observation has b een
made by Vanhove et al. [27, 28] for t he porcine gene, which
further increases the number of transcripts that can be
obtained from this single gene. As yet, it is unclear if the
occurrence of multiple transcript isoforms has a physiolo-
gical relevance. Heterogeneity at the 5¢ end o f t he mRNA
does not affect the protein encoded. In contrast, splicing in
the stem region will result in the production of a shortened
enzyme molecule, w hich may be l ess sensitive to intracellular
proteolysis, or differ in its ability to transfer galactose to
Galb1, 4GlcNAc structures [20].
Various 5¢ flanking regions have been tested for t heir
ability to drive a1,3GalT gene transcription, and a deletion
analysis has been carried out to identify minimal promoter

regions. E ach o f t he promoters A, B , and C w as found to be
active in porcine endothelial cells. Sequence analysis of
promoter region A, the 479-bp region directly upstream of
exon-3, revealed the presence of several putative transcrip-
tion factor binding sites (Fig. 2B). The region contains five
GATA(like) sites. One of these, GATA nucleotides 1621–
1624, is in close proximity to an AP-1 motif . Cooperative
interactions between AP-1 and GATA were reported to
regulate transcription driven b y the human P-selectin
promoter [29, 30]. For porcine a1,3GalT, the AP-1/GATA
motif is located just upstream of the start site (at nucleotide
1633) of transcript 5¢-A. This start site is part of an
octanucleotide t hat i s h ighly s imilar t o t he consensus
transcriptional initiator sequence [31, 32]. The initiator
sequence, together with the AP-1/GATA motif, is probably
important for the production of transcript 5¢-A in porc ine
endothelial cells. However, additional upstream sequence is
essential for transcriptional activity. Construct A.2 that
contains the nucleotides 1388–1786 region was found to be
five times more active in PEC-A cells (luciferase assays,
Fig. 4A) than construct A.3 (nucleotides 1483–1786). This
suggests that a transcriptional activator binds to the region
nucleotides 1388–1483. The segment needs to be linked to
the transcriptional start site via StyI-fragment nucleotides
1483–1590, as deletion of the latter fragment results in zero
activity (Fig. 4A). Apart from a single G ATA-box, no
known transcription factor binding site is present in region
nucleotides 1388–1483 (Fig. 2 B). The GATA box shows
only imperfect homology with the consensus sequence.
Therefore, activation by t he nucleotides 1388–1483 segment

may r esult from the binding of a s till unknown transcription
factor. The 538-bp promoter A fragment can also drive
transcription in COS7 cells, s o does not appear to confer cell
type specificity.
A second porcine genomic DNA fragment was isolated
that contains sequences u pstream of exon 2 (nucleotides
1–1219 in Fig. 2B). This putative promoter C contains
multiple transcription factor binding sites, including five
NF-jB sites. The latter sites could be important in
endothelial cell-specific expression and i n the cytokine
response to TNFa [33, 34]. It has been reported that TNFa
can induce t he expression o f a1,3GalT [27], a nd NF-jBsites
are possibly involved in mediating this effect. Other
transcription f actors such as Sp1, G ATA or ets-1 as
detected in promoter C (Fig. 2B) could also be important
for endothelial cell-specific expression [35–38]. Reporter
gene assays have indicated t hat regions important for
promoter activity are mostly located in the 3¢ portion of the
fragment (nucleotides 719–1219). This region contains only
asingleNF-jB site. The presence of a TATA box at
nucleotide 1196 may help to direct initiation specifically to
the position nucleotide 1220. An enhancer may b e present in
the region nucleotides 1–164 of promoter C b ecause deletion
of that region results in a fourfold reduction of luciferase
activity in transfected PEC-A cells. As shown by reporter
luciferase assays, similar activities are observed in both
COS7 and PEC-A cells, suggesting that promoter C does
not contain species-specific regulatory sequences.
The analysis of promoter region B confi rmed that the
region directly upstream of exon 1 contains a GC-rich

sequence o f  1.5 kb, as reported earlier by Koike et al.
[21]. Consequently, numerous Sp1 binding sites h ave been
predicted in t hat region (Fig. 3B) . The lack of TATA o r
CAAT-boxes together with the presence of many Sp1
binding sites, as observed f or promoter B, is a c haracteristic
of ÔhousekeepingÕ genes. For most of these genes, transcrip-
tional s tart is likely to b e imprecise, and indeed a set of
transcripts differing in their 5¢ ends is produced from
promoter B [20, 21]. S everal glycosyltransferase p romoters
present similar structure and characteristics [39–42]. For
example, the promoter of the long form of b1,4-gala ctosyl-
transferase contains 12 Sp1 binding sites, and is active in a
variety of cell types [42, 43]. Two putative NF-jB b inding
sites have been found in promoter B sequence (nucleotides
Ó FEBS 2002 Regulation of a1,3GalT expression in pig endothelial cells (Eur. J. Biochem. 269) 1471
898–907 and nucleotides 2398–2407) suggesting that this
promoter may respond to endothelial c ell activation.
Interestingly, a1,3GalT transcripts generated from pro-
moter B contain a GC-rich 5¢ untranslated region, which is
predicted to form stable h airpin loops. This m ay interfere
with the efficiency of translation of the mRNA as has been
shown fo r b1,4-galactosyltransferase [44]. I n that way,
increased transcription from promoter B could be compen-
sated for by low t ranslation efficiency.
We have established w hich promoter is used preferen-
tially in porcine endothelial cells, and how a1,3GalT gene
transcription is affected by TNFa-activation of endothelial
cells. Results obtained for nonactivated p PAEC and P EC-A
cells were similar. In both cell types the 5 ¢-B transcript is the
most highly expressed i soform (Fig. 5 A,B), and corresponds

to  80–90% of the total amount of a1,3GalT transcript.
This indicates that promoter B is the main a1,3GalT
promoter implicated in endothelial cell expression. Prefer-
ence for promoter B is not affected by TNFa stimulation.
Organ transplantation from pig to man results in an
activation of the donor organ vascular endothelium, con-
comitant with changes in cell surface structures. Activation
of endothelial cells by TNFa treatment was reported to
enhance a1,3GalT expression [28]. Using Q-PCR we found
that, initially, q uantities of a1,3GalT transcripts indeed
increased slightly (25–50%, F ig. 5). However, this increase
was followed over time by a strong decrease (fivefold) in
primary endothelial cells, whereas no down-regulation was
observed in PEC-A. This indicates that the response of
a1,3GalT to TNFa stimulation in PEC-A is different from
that inprimary cells. The same holds forE-selectin expression
(about 300-fold increase in pPAECs vs. 3 -fold in PEC-A).
It remains to be investigated to what extent changes in
endothelial levels of a1,3GalT and other t erminal glycosyl-
transferases under inflammatory conditions will affect cell
surface c arbohydrate structure, and thus influen ce t he
outcome of organ transplantation. The results obtained in
this study will help us to manipulate t he expression of
a1,3GalT in porcine cells and tissues in a precise way. It is
hoped t hat, ultimately, this approach will facilitate clinical
xenotransplantation.
ACKNOWLEDGEMENTS
This work was s upported b y the EU biotechnology project on
xenotransplantation N° BIO4-CT97-2242.
REFERENCES

1. Bu
¨
hler, L., Friedman, T., Lacomini, J. & Cooper, D.K.C. (1999)
Xenotransplantation-state of the art-Update. Front. Biosci.
4, d416–d432.
2. Soin, B., Vial, C.M. & Friend, P.J. (2000) Xenotransplantation,
Br. J. Surg. 87, 138–148.
3. Saadi, S. & P latt, J.L. (1997) Immunology of xe notransplantation.
Life Sci. 62, 365–387.
4. Bach, F.H. (1998) Xenotransplantation: problems and prospects.
Annu. Rev. Med. 49, 301–310.
5. Daniels, L.J. & Platt, J.L. (1997) Hyperacute xenograft r ejection as
an immunologic b arrier to xenotransplantation. Kidney Int. 51,
S28–S35.
6. Sandrin, M.S. & McKenzie, I.F. (1994) Gal alpha(1,3)Gal, t he
major xenoantigen (s) recognised in pigs by human natural anti-
bodies. Immunol. Rev. 141, 169–190.
7. Samuelsson, B.E., Rydberg, L., Breimer, M.E., Backer, A.,
Gustavsson, M., Holgersson, J., Karlsson, E., Uyterwaal, A C.,
Cairns, T. & Welsh, K. (1994) Natural antibodies and human
xenotransplan tation. Immunol. Rev. 141, 151–168.
8. Cooper, D .K., Koren, E. & Oriol, R . (1994) Oligosaccharides and
discordant xenotransplantation. Immunol. Rev. 141, 31–58.
9. Galili, U., C lark, M .R., Shohet, S.B., Buehler, J . & Macher, B .A.
(1987) Evolutionary relationship between the natural anti-Gal
antibody and the Gala1 fi 3Gal epitope in primates. Proc. Natl
Acad. Sci. USA 84, 1369–1373.
10. Galili, U., Shohet, S.B., Kobrin, E., Stults, C.L. & Macher, B.A.
(1988) Man, apes, and Old World monkeys differ from other
mammals in the expression of alpha-galactosyl epitopes on

nucleated cells. J. Biol. Chem. 263, 17755–17762.
11. Oriol,R.,Barthod,F.,Bergemer,A M.,Ye,Y.,Koren,E.&
Cooper, D .K.C. (1994) Monomorphic and polymorphic carbo-
hydrate antigens on pig tissues: implication for organ xeno-
transplantation i n the pig-to-human mo del. Tranplant. Int. 7,
405–413.
12. Joziasse, D.H., Shaper, J.H., van den Eijnden, D.H., Van
Tunen, A.J . & S haper, N.L. (1989) Bovine alpha 1–3-galacto-
syltransferase: isolation a nd c haracterization of a cDNA clone.
Identification of homologous sequences in human ge no mic DNA.
J. Biol. Chem. 264, 14290–14297.
13. Joziasse, D.H., Shaper, N.L., Kim, D., van den Eijnden, D.H. &
Shaper, J.H. (1992) Murine alpha 1,3-galactosyltransferase. A
single gene lo cus specifies four i soforms of the enzyme by alter-
native splicing. J. Biol. C hem . 267, 5534–5541.
14. Joziasse, D.H., Shaper, J.H. & S haper, N.L. (1999) The
a1,3-Galactosyltransferase gene. I n a-Gal an d Anti-Gal ( Galili, U.
& Avila, J.L., eds), p p. 25–47. K luwer Academic/Plenum Pub-
lishers, New York.
15. Sandrin, M.S., Dabkowski, P.L., H enning, M.M., Mouhtouris, E .
& McKenzie, I.F.C. (1 994) Ch aracterization of cDNA clones for
pig a(1,3)galactosyl transferase: the enzyme generatin g the
Gala(1,3)G al epitope. Xenotra nsplantation 1, 81–88.
16. Larsen, R.D., Rajan, V.P., Ruff, M.M., Kukowska-Latallo, J.,
Cummings,R.D.&Lowe,J.B.(1989)IsolationofacDNA
encoding a murine UDPgalactose: beta-
D
-galactosyl-1,4-N-acetyl-
D
-glucosaminide alpha-1,3-galactosyltransferase: expression clon-

ingbygenetransfer.Proc. Natl Acad. Sci. USA 86, 8227–8231.
17. Larsen, R.D., Rivera-Marrero, C.A., Erns t, L.K.,
Cummings, R.D. & Lowe, J.B. (1990) Frameshift and nonsense
mutations in a human g enomic sequence ho mologous to a murine
UDP-Gal:beta-
D
-Gal(1,4)-
D
-GlcNAc a lpha(1,3)–galactosyltrans-
ferase cDNA. J. Biol. Chem. 265, 7055–7061.
18. Joziasse, D.H., Shaper, J .H., Jabs, E.W. & Sha per, N.L. (1991)
Characterization of an al pha 1–3-galactosyltransferase h omologue
on human chromosome 12 that is organized as a processed
pseudogene. J. Biol. Chem. 266, 6991–6998.
19. Shaper, N.L., Lin, S .P., Joziasse, D.H., Kim, D.Y. & Y ang-Feng,
T.L. (1992) A ssignment of two human alpha-1,3-galactosyl-
transferase gene sequences (GGTA1 and GGTA1P) to chromo-
somes 9q33-q34 and 12q14-q15. Genomics. 12, 613–615.
20. Katayama, A., Ogawa, H., Kadomatsu, K., Kurosawa, N.,
Kobayashi, T., Kaneda, N., Uchimura, K., Yokoyama, I.,
Muramatsu, T. & Takagi, H . (1998) Porcine alpha-1,3-galactosyl-
transferase: full length cDNA cloning, genomic organization, and
analysis of sp lici ng var iants. Glycoconj J. 15, 583–589.
21. Koike, C., Friday, R.P., Nakashima, I., Luppi, P., Fung, J.J., Rao,
A.S., Starzl, T.E. & Trucco, M. (2000) Isolation o f t he re gulatory
regions and genomic organization of the porcine alpha1,3-
galactosyltransferase gene. Transplantation. 70, 1275–1283.
22. d’Apice, A.J., Tange, M.J., Chen, G.C., Cowan, P.J., Shinkel,
T.A. & Pearse, M.J. (1996) Two genetic approaches to the
galactose alpha 1,3 galactose xenoantigen. Transplant Proc. 28 ,

540.
1472 D. Mercier et al. (Eur. J. Biochem. 269) Ó FEBS 2002
23. Strahan, K., Preece, A. & Gustafsson, K. (1996) Pig alpha1,3
galactosyltransferase: a major target for genetic manipulation in
xenotransplantation. Front. Biosci. 1, e34–e41.
24. McKenzie, I.F., Osman, N ., Co hn ey, S ., Vau ghan, H .A., Patton,
K., Mouhtouris, E., Atkin, J.D., Elliott, E., Fodor, W .L., Squinto,
S.P., Burton, D., Gallop, M.A., Oldenb urg, K.R. & Sandrin, M.S.
(1996) Strategies to overcome th e anti-Gal a lpha (1–3) G al reac-
tion in xenotransplantation. Transplant Proc. 28, 537.
25. Khodadoust, M.M., Candal, F.J., Maher, S .E., Murray, A.G.,
Ades, E .W. & Bothwell, A.L.M. (1995) PEC-A: An immort alized
porcine endothelial cell. Xenotransplantation 2, 79–87.
26. Sambrook, J., Fritch, E.F. & Maniatis, T. (1989) Molecular
Cloning: a Laboratory Manual, 2 nd edn. Cold Sp ring Harbor
Laboratory Press, New York.
27. Vanhove, B., Goret, F., Soulillou, J.P. & Pourcel, C. (1997) Por-
cine alpha1,3-galactosyltransferase: tissue-specific and regulated
expression of splicing i soforms. Biochim. Biophys. Acta. 1356,
1–11.
28. Vanhove, B., Sebille, F., Cassard, A., Charreau, B. & Soulillou,
J.P. (1998) Transcriptional and posttranscriptional regulation of
alpha 1,3-galactosyltransferase in activated endothelial cells results
in de creased expression of Gal alpha 1,3Gal. Glycobiology 8, 481–
487.
29. Pan, J., Xia, L. & McEver, R.P. (199 8) Comparison of promoters
for the murine and human P- selectin genes suggests species-specific
and conserved mechanisms for transcriptional regulation in
endothelial cells. J. Biol. Chem. 273, 10058–10067.
30. Foletta, V.C., Segal, D.H. & C ohen, D.R. ( 1998) Transcriptional

regulation in the immune system: all roads lead to AP-1. J. Leu-
kocyte Biol. 63, 139–152.
31. Weis, L. & Reinberg, D. (1997) Accurate positioning of RN A
polymerase II on a n atu ral TATA-less promoter is independent of
TATA-binding-protein-associated factors and initiator-binding
proteins. Mol. Cell Biol. 17, 2973–2984.
32. Weis, L. & Reinberg, D. (1992) Transcription by RNA poly-
merase II: initiator-directed formation of transcription-competent
complexes. FASEB J. 6, 3300–3309.
33. Mantavoni, A., Bussolino, F. & Dejana, E. (1992) Cytokine reg-
ulation of endothelial cell function. FASEB J. 6, 2591–2599.
34. Mantavoni, A ., Bussolino, F. & Introna, M. (1997) Cytokine
regulation of endothelial cell f unction: fro m molecular level to the
bedside. Immunol. Today 18, 231–240.
35. Karantzoulis-Fegaras, F., Antoniou, H., Lai, S L.M., Kulkarni,
G., D’Abreo, C., Wong, G.K.T., Miller, T.L., Chan, Y., Atkins,
J., Wang, Y. & Marsden, P.A. (1999) Characterization of the
human endothelial n itric-oxyde synthase promoter. J. Biol. C hem.
274, 3076–3093.
36. Cowan, P .J., Tsang, D., Pedic, C .M., Abbott, L.R., Shinkel, T.A.,
d’Apice, A.J.F. & Pearse, M.J. (1998) The human ICAM-2 pro-
moter is end othelial cell-spec ific in vitro and in vivo and contains
critical Sp1 and GATA binding sites. J. Biol. Chem. 273 , 11737–
11744.
37. Iljin, K., Dube, A., Kontusaari, S., Korhonen, J., Lahtinen, I.,
Oettgen, P. & Alitalo, K. (1999) Role of Ets fac tors in t he activity
and endothelial cell specificity of the mouse T ie gene promoter.
FASEB J. 13, 377–386.
38. Neish, A.S., Khachigian, L.M., Park, A., Baichwal, V.R. &
Collins, T. (1995 ) Sp1 is a component of the cytokine-inducible

enhancer in the promoter of vascular cell adhesion molecule-1.
J. Biol. Chem. 270, 28903–28909.
39. Takashima,S.,Kurosawa,N.,Tachida,Y.,Inoue,M.&Tsuji,S.
(2000) Comparative analysis of the genomic st ructures and
promoter activities of mouse S iaalpha2,3Galbeta1,3GalNAc
GalNAcalpha2,6-sialyltransferase genes (ST6GalNAc III and IV):
characterization of their Sp1 binding sites. J. Biochem. (Tokyo)
127, 399–409.
40. Soejima,M.,Koda,Y.,Wang,B.&Kimura,H.(1999)Functional
analysis of the 5¢-flanking region of FTA f or expression of rat
GDP-
L
-fucose: beta-
D
-galactoside 2-alpha-
L
-fucosyltransferase.
Eur. J. Bio che m. 266, 274–281.
41. Yip, B ., Chen, S.H., Mulder, H., Hoppener, J.W. & Schachter, H.
(1997) Organ ization of the human beta-1,2-N-acetylgluco-
saminyltransferase I gene (MGAT1), which cont rols complex and
hybrid N-glycan synthesis. Biochem. J. 321, 465–474.
42. Rajput, B ., Shaper, N.L. & Shaper, J.H. ( 1996) Transcriptional
regulation of murine b1,4-galactosyltransferase in somatic cells.
J. Biol. Chem. 271, 5131–5142.
43. Harduin-Lepers, A., Shaper, J.H. & Shaper, N.L. (1993) Char-
acterization of two cis-regulatory regions in the murine
b1,4-galactosyltransferase gene. J. Biol. Chem. 268, 14348–14359.
44. Charron, M., Shaper, J.H. & Shaper, N.L. (1998) The inc reased
level of beta1,4-galactosyltransferase required for lactose bio-

synthesis is achieved in part by translational control. Proc. Natl
Acad.Sci.USA95, 14805–14810.
Ó FEBS 2002 Regulation of a1,3GalT expression in pig endothelial cells (Eur. J. Biochem. 269) 1473