Báo cáo Y học: Molecular mechanisms underlying SHP-1 gene expression potx

Molecular mechanisms underlying
SHP-1
gene expression
Hing Wo Tsui
1
, Kathleen Hasselblatt
2
, Alberto Martin
3
, Samuel Chi-ho Mok
2
and Florence Wing Ling Tsui
1,4
1
Division of Cellular & Molecular Biology, Toronto Western Research Institute, University Health Network, Toronto, Ontario,
Canada;
2
Laboratory of Gynecologic Oncology, Department of Obstetric Gynecology and Reproductive Biology, Brigham and
Women’s Hospital, Dana-Farber Harvard Center, Boston, Massachusetts, USA;
3
Department of Cell Biology, Albert Einstein College
of Medicine, Bronx, New York, USA;
4
Department of Immunology, University of Toronto, Toronto, Ontario, Canada
SHP-1, a protein-tyrosine phosphatase with two src-
homology 2 domains, is expressed predominantly in
hematopoietic and epithelial cells and has been implicated in
numerous signaling pathways as a negative regulator. Two
promoters direct the expression of human and murine
SHP-1, and two types of transcripts (I) and (II) SHP-1,are
initiated from each of these promoters. The cDNA

sequences of (I)SHP-1 and (II)SHP-1 are identical except
in the 5¢ untranslated region and in the first few coding
nucleotides. In this report, we show that promoter usage is
similar in mouse and human hematopoietic cells, but
different in epithelial cells. In human epithelial cells, only
(I)SHP-1 transcripts were expressed. In addition,
4b-phorbol 12-myristate 13-acetate up-regulates human
(I)SHP-1 transcript expression in SKOV3 cells (an ovarian
cancer cell line). Indirect evidence suggests that nuclear
factor-jB might play a role in this induction. We also show
that a 12-bp repeat in the distal SHP-1 promoter, which
directs (I)SHP-1 expression, is of functional relevance as
deletion of one copy of this E-box-containing 12-bp repeat
resulted in a significant decrease in promoter activity. Elec-
trophoretic mobility shift assays and supershift experiments
showed that the upstream stimulatory factors USF1 and
USF2 hetero-dimerize and interact with this 12 bp repeat.
Our results suggest that USFs which have antiproliferative
functions might regulate the expression of SHP-1, which
itself is predominantly a negative growth regulator.
Keywords: cis elements; distal promoter; NFjB; promoter
usage; USFs.
Phosphorylation of proteins serves to alter their activity,
providing a simple and mostly reversible change in
molecular function. The regulation of tyrosine phosphory-
lation is important in the control both of normal cellular
processes including cell growth, cell cycle regulation, and
differentiation, and of pathological events such as malignant
transformation. Protein tyrosine kinases and phosphatases
are the key players in the regulation of protein tyrosine

phosphorylation. Among the known protein tyrosine
phosphatases, SHP-1 and SHP-2 are distinguished by the
presence of two tandem src-homology 2 domains. Src-
homology 2 domains interact with phospho-tyrosine resi-
dues in many growth factor receptors and thus play an
important role in directing the effects of tyrosine phos-
phorylation [1]. We [2] and others [3] showed that motheaten
mice have mutations in the SHP-1 gene. These mutant mice
thus provide insight into the role of SHP-1. Motheaten mice
die prematurely and have characteristics of both immuno-
deficiency and autoimmunity [4]. From analyses of moth-
eaten mice and other work in cell lines, SHP-1 functions
predominantly as a negative regulator in hematopoietic
signaling pathways [5].
SHP-1 is expressed predominantly in hematopoietic and
epithelial cells [6]. It has recently been shown that localiza-
tion of SHP-1 differs between hematopoietic and epithelial
cells (i.e. cytoplasmic in hematopoitic cells vs. nuclear in
epithelial cells) [7]. Two promoters direct the expression of
human [8] and murine SHP-1 [9], and two types of
transcripts are initiated from the promoters. Transcripts
that contain the 5¢-most exon [termed (I)SHP-1] encode
SHP-1 with the initial amino acid sequences being MLSRG
as compared to the MVR sequence encoded by transcripts
that contain the 3¢ exon 1 [termed (II)SHP-1]. As there are
minor to no enzymatic differences between (I) and (II)
isoforms [9], we favor the view that different forms have
arisen because of a need to regulate SHP-1 transcription
using distinct promoters. Very little is known regarding the
functionality of the two promoters and their usage in

different cell types. In this study, we assessed the generation
of (I) and (II) SHP-1 transcripts in various human and
mouse cell lines and carried out functional deletional
analyses of the distal promoter of human SHP-1 in
epithelial cell lines.
MATERIALS AND METHODS
RT-PCR
Reverse transcription of total RNA from cell lines, prepared
by the Trizol (BRL) method, was carried out as described
previously [2]. The primers (I)SHP-1-90-5¢ (5¢-AA
CAGCTGTGCCACTCGATTG-3¢) and SHP-1-1859-3¢
(5¢-CCACAGGTCTCAGTCTATCGGGT-3¢); (II)SHP-
1-74-5¢ (5¢-GTGCCTGCCCAGACAAACTG-3¢)and
SHP-1-1859-3¢ were used in RT-PCR of (I)SHP-1 and
Correspondence to F. W. L. Tsui, Toronto Western Hospital,
Mc14-417, 399 Bathurst Street, Toronto, Ontario M5T 2S8, Canada.
Fax: + 1 416 603 5745, Tel.: + 1 416 603 5904,
E-mail:
Abbreviations: bGal, b-galactosidase; EMSA, electrophoretic mobility
shift assay; HPRT, hypoxanthine guanine phosphoribosil transferase
gene; PMA, 4b-phorbol 12-myristate 13-acetate.
(Received 24 October 2001, revised 10 April 2002,
accepted 7 May 2002)
Eur. J. Biochem. 269, 3057–3064 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.02986.x
(II)SHP-1 transcripts, respectively. Ten-fold serial dilution
of the RT products were used to amplify either (I)SHP-1 or
(II)SHP-1 transcripts. The RT-PCR products were separ-
ated by electrophoresis through 0.7% agarose gels, blotted
to nitrocellulose and probed with a
32

P-labeled DNA
fragment containing sequences encoding the phosphatase
domain of SHP-1 and autoradiographed. The intensity of
bandswasmeasuredbydensitometryonanimager(Bio-
Rad Fluor-S
TM
multi-imager).
Electrophoretic mobility shift assay (EMSA)
Nuclear extracts were prepared from cell lines [10]. Protein
concentrations of the nuclear extracts were determined
using the Coomassie protein assay reagent (Pierce). Five
lg of nuclear extracts were mixed with herring DNA
(BMC) and labeled oligonucleotide with and without
competitor DNA (500-fold excess) in a buffer containing
25 m
M
Tris/HCl pH 7.5, 50 m
M
KCl, 0.6 m
M
dithiothre-
itol, 1 m
M
EDTA, 0.5 m
M
spermidine, 12% glycerol for
20 min at room temperature. For supershift experiments,
the nuclear extracts were incubated with 2 lgofthe
antibody for 30 min at room temperature before adding
the labeled oligonucleotide. The reaction was subjected to

electrophoresis on a 6% native polyacrylamide gel in Tris/
glycine buffer (25 m
M
Tris pH 7.7, 200 m
M
glycine, 1 m
M
EDTA). The gels were dried and exposed to phospho-
screens and the images were visualized on a phosphoi-
mager (Bio-Rad). Quantitation of bands was carried out
using the
QUANTITY-ONE
software. Antibodies to the
upstream stimulatory factors USF1, USF2, Max, NFjB
p50 were from Santa Cruz Biotech. Inc.; antibody to
NFjB p65 (RelA) was from Upstate Biotechnology.
Generation of reporter constructs
An 845-bp BamHI–PvuII DNA segment containing the
(I)SHP-1 promoter and 83 bp of the 5¢ UTR [without the
(I)SHP-1 AUG] was isolated from a SHP-1-containing
cosmid clone (LL12NCOIN 143H6, a gift from P. Mary-
nen, Leuven, Belgium) and inserted upstream of the
luciferase reporter gene in the pGL2-Basic vector (Promega)
(construct A). For generation of construct B, a 420-bp KpnI
segment was removed from construct A, followed by
re-circularization of the vector. For generation of construct
C, a 610-bp SmaI segment was removed from construct A,
followed by re-circularization of the vector. In the 12 bp
repeat sequences, there is an SstI site in each of the 12-bp
segments. By deleting the 12 bp SstI–SstIfragmentineither

construct A or B and re-circularizing the constructs, one
copy of the 12-bp repeat was removed from each of the two
constructs to form constructs A)12 bp and B)12 bp.
Analysis of promoter function
SKOV3 cells were cotransfected with the (I)SHP-1 pro-
moter–luciferase constructs and pSV
2
bGal (pCH110) by
lipofection using Fugene 6 (Roche Molecular Biochem).
Forty-eight hours after transfection, fractions of each cell
extract were used for the b-galactosidase (bGal) [11] and
luciferase [12] assays. The conditions used for the luciferase
assay were within the linear range of the assay for the
promoters tested in this study. Each construct was tested in
three different transfection experiments, with triplicates for
each experiment.
RESULTS
Differential expression of SHP-1 isoform transcripts
in human vs. murine cell lines
In mouse as well as in human, SHP-1 proteins are detected
in both hematopoietic and epithelial cells. As the two SHP-1
protein isoforms only differ in the first few amino acids, it is
difficult to distinguish the two protein isoforms. Thus, it is
unclear whether the SHP-1 proteins are translated from the
(I)SHP-1 or (II)SHP-1 transcripts or both. To assess
whether both SHP-1 promoters are transcriptionally active
in hematopoietic and epithelial cells, we used RT-PCR to
specifically amplify either the (I)SHP-1 or (II)SHP-1
transcripts. Expression of (I)SHP-1 and (II)SHP-1 tran-
scripts were assessed using the primers (I)SHP-1-90-5¢ and

SHP-1-1859–3¢ vs. (II)SHP-1-74-5¢ and SHP-1-1859–3¢,
respectively. We determined the relative abundance of the
two isoform transcripts using a quantitative RT-PCR assay.
We previously [13] showed that the (I)SHP-1 and
(II)SHP-1 isoforms were amplified to a similar extent
using isoform specific primers, as mentioned above. As
explained in the legend to Fig. 1, a serial dilution of the
initial RT reaction mixture was used to amplify type
(I)SHP-1 and (II)SHP-1 cDNAs. Blots of the electro-
phoresed RT-PCR products were probed with P
32
-labeled
sequences of the SHP-1 phosphatase domain, and the
intensity of the autoradiographed bands was measured by
densitometry. We analysed six human hematopoietic cell
lines (K562, Raji, HL60, BL-JC, CEM and U937) and six
human epithelial cell lines (HeLa, CAOV3, SKOV3,
MDA453, Calu 1 and HT1080) as well as eight mouse
hematopoietic cell lines (BW5147, M1, NFS-5C1, J774,
IC21, 70Z/3, J558L and A20) and four mouse epithelial cells
(Y1, L cells, LA-4 and MMT060562) (Table 1). In both
human [8] and mouse SHP-1 [9], alternative transcripts
(both longer and shorter than the major transcripts) have
been reported and except for one human splice variant [14],
most of these variant transcripts contain premature stop
codons ([9] and our unpublished results for the human
variants) and therefore cannot be translated into functional
phosphatases. Thus, in this study, we only quantified the
major transcripts. Fig. 1 shows representative profiles of
SHP-1 isoform transcripts expressed in both human and

mouse cell lines and the relative abundance of these
isoforms are summarized in Table 1. In most human
(4/6) and mouse (6/8) hematopoietic cell lines, both SHP-1
isoform transcripts were detected. However, some cell lines
expressed only one of the two isoforms (Table 1). Of the cell
lines that expressed both isoforms, the ratio of (II)SHP-1
to (I)SHP-1 transcripts ranged from 0.3 : 1 to 63 : 1
(human) and 28 : 1 to 110 : 1 (mouse). Similarly, in mouse
epithelial cell lines (3/4), both isoform transcripts were
present, although the ratio of (II)SHP-1 to (I)SHP-1,
which ranged from 1.3 : 1 to 2 : 1 is much lower than that
found in hematopoietic cells. However, in human epithelial
cell lines (5/6), only (I)SHP-1 transcripts were detected.
As all the cell lines used for this study are transformed, we
asked whether the SHP-1 promoter usage is similar in
untransformed hematopoietic cells. For human, we used
3058 H. W. Tsui et al. (Eur. J. Biochem. 269) Ó FEBS 2002
tonsillar T cells grown in the presence of phytohemagglu-
tinin (TON-phytohemagglutinin) and for mouse, we used
splenic T cells as well as thymus. In all three cases,
both (II)SHP-1 and (I)SHP-1 transcripts were detected,
with the former isoform being the predominant species
(Table 1).
(I)SHP-1
transcripts were up-regulated by 4b-phorbol
12-myristate 13-acetate (PMA) in HL60 and SKOV3 cells
As human epithelial cells expressed only (I)SHP-1 tran-
scripts, these cells (such as SKOV3, an ovarian cancer cell
line) are ideal for the study of the distal promoter function of
SHP-1. We first wished to identify agent(s) that can

modulate the expression of (I)SHP-1 transcripts. Nuclear
run-on experiments showed that PMA treatment increased
SHP-1 transcription in HL60 cells [15].However, it is unclear
which promoter is responsible for the increase in SHP-1
transcription. We used RT-PCR to assess the relative
abundance of (I)SHP-1 and (II)SHP-1 transcripts [nor-
malized to hypoxanthine guanine phosphoribosil transferase
(HPRT)] in untreated vs. PMA treated (48 and 72 h) HL60
cells. We observed that the relative levels of (I)SHP-1 and
(II) SHP-1 transcripts were up-regulated 48-fold and
fivefold, respectively, when the cells were treated with
PMA (Fig. 2A). SHP-1 proteins were increased
 5-fold in PMA treated HL60 cells (data not shown).
Because HL60 is a hematopoietic cell line, we asked whether
PMA induces a similar effect in epithelial cells. We treated
SKOV3 cells, which expressed only (I)SHP-1 transcripts,
with PMA and compared the relative abundance of this
isoform transcript in treated vs. untreated cells after
normalization with HPRT. We found a lower but significant
increase in the relative level of (I)SHP-1 transcripts (twofold
to fourfold) in PMA treated SKOV3 cells (Fig. 2B). Thus, in
both hematopoietic and epithelial cells, PMA can
up-regulate the expression of (I)SHP-1 transcript.
Role of NFjB in the expression of
(I)SHP-1
transcripts
As we found that PMA up-regulates the expression of
human (I)SHP-1 transcripts (Fig. 2), we were interested in
identifying potential activator(s) of the human distal SHP-1
promoter. PMA is a known nonphysiological activator of

NFjB. In the distal promoter of human SHP-1,thereisa
putative NFjBsiteat)314 (GGGATTTTCC). We first
asked whether NFjB proteins can bind to this putative
NFjB consensus sequence. We carried out EMSAs using
SKOV3 nuclear extracts and a double-stranded oligonucle-
otide containing this consensus sequence as a probe. We
detected two specific DNA–protein complexes (Fig. 3, lane
2), both of which can be super-shifted using anti-NFjBIg
(p50) and anti-NFjB Ig (p65) (Fig. 3, lanes 3 and 4). If
(I)SHP-1 transcription is increased because PMA activated
NFjB, we would expect to find more NFjB binding to this
NFjB site located in the distal SHP-1 promoter. We thus
carried out EMSA using equal amounts of untreated and
PMA-treated SKOV3 nuclear extracts. As expected, we
found that nuclear extracts from PMA treated SKOV3 cells
had a 4–5-fold higher NFjB activity than those from
untreated cells (Fig. 3, compare lane 8 with lane 6). These
data suggest that the up-regulation of (I)SHP-1 transcrip-
tion by PMA is mediated via the NFjB site in the distal
promoter of SHP-1.
Fig. 1. Relative abundance of (I)SHP-1 and (II)SHP-1 transcripts in human vs. mouse cell lines. Raji is a Burkitt’s Lymphoma cell line (i.e.
hematopoietic); HeLa and HT1080 are human epithelial cancer cell lines. BW5147 is a mouse T-cell line and L cell are a mouse epithelial cell line.
RNA from the cell lines were reverse transcribed, and serial dilutions (shown below each lane) of the RT mixture were used in PCR for (I)SHP-1
with primer pair (I)SHP-1-90-5¢ and SHP-1-1859-3¢,or(II)SHP-1 with primer pair (II)SHP-1-74-5¢ and SHP-1-1859-3¢. The RT-PCR products
were separated by electrophoresis, transferred to nitrocellulose and probed with
32
P-labeled sequences of the phosphatase domain for SHP-1.
Arrows denote the SHP-1 transcripts which are translatable into proteins [9,13]. Densitometry was performed on this species of SHP-1 transcripts.
Bottom panels: Schematics showing the generation of (I)SHP-1 vs. (II)SHP-1 transcripts from the SHP-1 gene.
Ó FEBS 2002 Regulation of SHP-1 expression (Eur. J. Biochem. 269) 3059

Table 1. Relative abundance of (II) vs. (I)SH P-1 transcripts in human (A) and mouse (B) cell lines and untransformed cells.
(II)SHP-1 (I)SHP-1 Ratio(II) : (I)SHP-1
Human cells
Epithelial cell lines
HeLa 0 10
CAOV3 0 36
Calu I 0 40
SKOV3 0 8
MDA453 0 60
HT1080 3 0
Hematopoietic cell lines
K562 1 3 0.3 : 1
Raji 100 1.6 63 : 1
HL60 167 9 19 : 1
BL-JC 206 43 5 : 1
CEM 346 0
U937 971 0
Hematopoietic cells
TON-photohaemagglutinin 193 69 3 : 1
Mouse cells
Epithelial cells lines
Y1 3 2.2 1.4 : 1
L cells 8 4 2 : 1
LA-4 7 5.6 1.3 : 1
MMT060562 15 0
Hematopoietic cell lines
BW5147 110 1 110 : 1
M1 229 3 76 : 1
NFS-5C1 195 4.4 44 : 1
J774 666 24 28 : 1

IC21 977 24 41 : 1
70Z/3 1320 27 49 : 1
J558L 140 0
A20 520 0
Hematopoietic cells
Splenic T cells 82 1.2 68 : 1
Thymus 629 11 60 : 1
Fig. 2. Up-regulation of SHP -1 expression in
PMA treated HL60 (A) and SKOV3 (B) cells.
Relative abundance of (I)SHP-1 and
(II)SHP-1 transcripts in untreated or PMA
treated cells was estimated by quantitative
RT-PCR (as in Fig. 1).
3060 H. W. Tsui et al. (Eur. J. Biochem. 269) Ó FEBS 2002
Functional deletional analyses of the distal promoter
of human SHP-1 in epithelial cells
To characterize further the distal promoter, we needed to
obtain a genomic segment containing the distal promoter.
From a human SHP-1-containing cosmid clone
(LL12NCOIN 143H6), we isolated the 5¢ flanking region
upstream of the first exon of (I)SHP-1. We sequenced the
region 986 bp upstream of the transcription initiation site,
and the sequence was identical to the published one [8]. To
test the functionality of the human SHP-1 distal promoter,
we generated three deletion constructs (A, B and C) which
were adjoined to a luciferase reporter gene (Fig. 4). These
constructs contained different amounts of 5¢ flanking DNA
and lacked the (I)SHP-1 AUG. They were individually
transfected into SKOV3 cells, and lysates were assayed for
luciferase activities. A bGal construct was cotransfected

with each deletion construct and bGal activities were used to
normalize the efficiency of each transfection. The promo-
terless vector, pGL2-basic (D), was included as a negative
control. The pGL2-control vector with both the SV40
promoter and enhancer (E) was included as a positive
control. As shown in Fig. 4, maximal (I)SHP-1 activity
was observed with construct A [845 bp of the (I)SHP-1 5¢
flanking region including 83 bp of 5¢UTR]. Deletion
construct B (425 bp 5¢ flanking region) and C (235 bp 5¢
flanking region) produced less luciferase activities in
SKOV3 transfections (47% and 30% of construct A,
respectively).
Identification of an activator(s) that binds to a 12-bp
repeat
Located in both constructs A and B, about 190 bp
upstream of the distal SHP-1 initiation site, is a 12-bp
repeat. As direct repeats in promoter regions usually
represent important regulatory elements, we asked whe-
ther this 12-bp repeat contributes to (I)SHP-1 promoter
activity. We generated two additional constructs: construct
A)12 bp differs from construct A by 12 bp (one copy of
the 12 bp repeat was deleted from construct A) and
likewise construct B)12 bp differs from construct B by
the same 12 bp. Transfection studies using both sets of
constructs (A vs. A)12 bp and B vs. B)12 bp; Fig. 4)
showed that deletion of one copy of the 12-bp sequences
in both cases resulted in a significant decrease in the
luciferase activity. Construct A)12 bp had 75% of
construct A activity, and construct B)12 bp had only
16% of construct B activity (Fig. 4) suggesting that an

activator(s) binds to this 12-bp repeat. The reasons for a
much larger effect on construct B will be considered in the
Discussion.
Fig. 3. EMSA and supershift analyses. The NFjBsite(TGTTAGG
GATTTCCTTA) from (I)SHP-1 promoter was used as a probe.
Lanes: 1 and 5, no nuclear extracts present in the reaction mix; lanes 2
and6,twospecificcomplexes(AandB)formedwhenthereactionmix
contains both nuclear extracts and labeled probe. The lowest shifted
band is nonspecific, as it cannot be competed out with excess unlabeled
oligonucleotide in the reaction mix (lane 7); Both complexes A and B
were supershifted when either anti-NFjB Ig, p50 or p65 (Rel A) were
included in the reaction mix; lane 8, more complexes A and B
were formed when nuclear extracts from PMA treated SKOV3 cells
were used.
Fig. 4. Schematic of the (I)SHP-1 deletion
constructs and luciferase activities of these
constructs in SKOV3 cells. Constructs A, B
and C contain various lengths of (I)SHP-1
promoter region. Construct D is promoterless
and was used as a negative control. Construct
E is a luciferase construct driven by the
SV40 promoter and enhancer; it served as a
positive control. Both copies of the 12-bp
repeat are present in constructs A and B, while
only one copy of the repeat is present in either
construct A)12 bp or B)12 bp. K, KpnI;
S, SstI.
Ó FEBS 2002 Regulation of SHP-1 expression (Eur. J. Biochem. 269) 3061
USF1 and USF2 bind to the 12-bp repeat in the
(I)SHP-1

promoter
We were interested in identifying the nuclear factor(s) that
bind to the 12-bp repeat and activates (I)SHP-1 expression.
Within the 12-bp sequences, there is an E-box (GAG
CTCCAGGTG). Using this 12-bp repeat as a probe for
binding factors in nuclear extracts from SKOV3 (an ovarian
cancer cell line) and MDA453 (a breast cancer cell line)
(Fig. 5, lanes 2 and 7) for EMSA, we detected several shifted
bands. One band (U) was completely inhibited with 500-
fold excess of the same unlabeled probe (Fig. 5, lanes 1 and 6)
but not by an excess amounts of mutated oligonucleotide
(GAGCTCCAGGGA; Fig. 5, lane 5), indicating that the
protein complex binds to the E-box sequences in the 12-bp
repeat. Two other shifted bands (a doublet X, and Y) were
only partially inhibited in the presence of 500-fold excess of
unlabeled probe (Fig. 5, lanes 1 and 6), and were not
detectably competed with excess mutated oligonucleotide
(Fig. 5, lane 5). These findings indicate that proteins in the
X and Y complexes also have specificity to the E-box within
the 12-bp repeat sequences.
c-Myc and Max proteins are known E-box binding
proteins [16]. We therefore tested whether antibody to Max
can supershift the protein complex. We first used a known
Myc–Max consensus probe and Ramos (a Burkitt’s Lym-
phoma cell line) nuclear extract to check whether the anti-
Max Ig can be used for supershift experiments. We detected
two protein complexes, one of which can be supershifted by
the anti-Max Ig (Fig. 5, lane 12). However, the same anti-
Max Ig failed to supershift the protein complexes formed
using the wild-type 12-bp repeat oligonucleotide and nuclear

extracts from both SKOV3 and MDA453 cells (Fig. 5, lanes
2 and 7). As Myc hetero-dimerizes with Max, the inability of
anti-Max Ig to supershift the complex would imply that
Myc, like Max, does not bind to the E-box sequences in the
12-bp repeat.
USFs are also known E-box binding proteins [17]. We
therefore asked whether the protein complexes formed,
contain USF1 and/or USF2 using the 12-bp repeat
oligonucleotide and nuclear extracts from SKOV3 and
MDA453 cells. As shown in Fig. 5 (lanes 3, 4, 8 and 9), one
of the protein complexes was supershifted using either anti-
USF1 Ig or anti-USF2 Ig. Therefore, both USF1 and USF2
proteins form a stable complexes with the 12 bp repeat.
We have not identified the proteins involved in the
formation of complexes X and Y.
DISCUSSION
Differential usage of
SHP1
promoters in mouse vs.
human epithelial cell lines
A previous report [8] showed that a few human hemato-
poietic cell lines expressed only (II)SHP-1 transcripts.
Contrary to their finding that HL60 cells expressed only
(II)SHP-1 transcripts, we found that HL60 cells not only
express (I)SHP-1 transcript, but also can be stimulated by
PMA to express up to 48-fold more (I)SHP-1 mRNA. In
addition, we found that most human (5/7) and mouse (8/10)
hematopoietic cells, expressed both SHP-1 transcript
isoforms, albeit with (II)SHP-1 transcripts being the
predominant species. In mouse hematopoietic cell lines

(II)SHP-1 transcripts were always much more abundant
than (I)SHP-1 transcripts. However, the relative difference
between (II)SHP-1 and (I)SHP-1 transcripts was less
pronounced in human hematopoietic cell lines. In both
human and mouse, similar ratios were found in untrans-
formed vs. transformed hematopoietic cells.
The relative abundance of the SHP-1 transcript isoforms
in epithelial cells was different from that of hematopoietic
cells. In mouse epithelial cell lines, both SHP-1 transcript
isoforms are of similar abundance. However, no (II)SHP-1
transcripts were detected in most human epithelial cell lines.
Thus, the control of SHP-1 promoters appears to be
different in mouse vs. human epithelial cell lines. It is not
clear whether this species difference is due to cis-elements or
trans-activating factors that regulate the SHP-1 promoters.
It has recently been shown that in human epithelial cells
(such as HeLa, A549 and MCF-7), SHP-1 proteins were
Fig. 5. EMSA and supershift analyses. Either
the 12-bp repeat from (I)SHP-1 promoter
(TTGAGCTCCAGGTGGAGCTCCAG
GTG; E-box consensus sequences are in bold)
or a Myc–Max consensus (TTAAGCA
GACCAC GTGGTCTGCAACC) was used
as a probe. Nuclear extracts from SKOV3 (an
ovarian cancer cell line) or MDA453 (a breast
cancer cell line) or Ramos (a Burkitt’s Lym-
phoma cell line) were used. To show specificity
of the shifted bands, a 500-fold excess of either
cold 12-bp repeat oligonucleotide (lanes 2
and 6) or cold 12-bp repeat mutant oligonu-

cleotide (TTGAGCTCCA GGGAGAG
CTCCAGGGA; lane 5) was included in the
reaction mix for EMSA.
3062 H. W. Tsui et al. (Eur. J. Biochem. 269) Ó FEBS 2002
localized in the nuclei [7]. As we showed that only (I)SHP-1
transcripts were expressed in human epithelial cells, it
appears that SHP-1 proteins derived from human
(I)SHP-1 transcript are localized in the nuclei and thus
might have different signaling substrates compared to that
of the cytoplasmic (II)SHP-1 proteins. In support of this
notion, tyrosine-phosphorylated stat-5b and SHP-1 com-
plex has been detected in the nuclei of growth hormone
stimulated liver cells in culture [18].
Activators of the distal promoter of human
SHP-1
Our deletional analyses of the distal promoter of SHP-1 (in
an ovarian cancer cell line, SKOV3) showed less promoter
activity with sequential deletion of the 5¢ flanking region.
This suggests that the distal promoter of SHP-1 is regulated
by multiple activators. Indeed, we found two motifs within
the distal promoter that were important for promoter
activity. One such motif was an E-box containing a 12-bp
repeat. Deletion of one copy of the repeat resulted in
significantly lower promoter activity (Fig. 4). The additional
region I (420 bp) in construct A presumably contains
redundant regulatory elements, thus masking the contribu-
tion of the 12-bp repeats in the comparison of construct A
vs. construct A)12 bp activities. It appears that the two
tandem E-boxes separated by 6 bp are crucial for presum-
ably high affinity binding of the activator(s) involved.

EMSA and supershift experiments showed that USF1 and
USF2 hetero-dimerize and interact with this 12-bp repeat.
USFs are thought to have anti-proliferative functions as
their over-expression inhibited growth of numerous cancer
cell lines [19]. As SHP-1 is predominantly a negative
regulator of growth, it is possible that USFs mediate their
anti-proliferative functions via the regulation of SHP-1
expression. To confirm whether USF proteins bind to the
12 bp repeat in the (I)SHP-1 promoter, in vivo binding of
USF proteins can be assessed by formaldehyde cross-linking
followed by chromatin immunoprecipitation and PCR
amplification of the (I)SHP-1 promoter. In addition, it
will be of interest to assess whether cotransfection of USF
dominant negative mutants and a (I)SHP-1 promoter–
luciferase construct would down-regulate luciferase activity
in SKOV3 cells.
In our EMSA analyses, aside from the shifted band that
contained USF1 and USF2, we observed other shifted
bands (X and Y). As bands X and Y were only partially
inhibited by 500-fold excess of unlabelled wild-type oligo-
nucleotide, we propose that the proteins involved in these
complexes have very low ÔonÕ rates, resulting in an ineffi-
cient, albeit stable binding to the oligonucleotides. Our
finding that an oligonucleotide bearing a mutated E-box
competed less than the wild-type oligonucleotide suggests
that the proteins involved in the X and Y complexes
recognize sequences in the E-box. However, we have not
identified the proteins involved in the formation of
complexes X and Y.
The second motif in the distal promoter of SHP-1 which

might contribute to the regulation of SHP-1 expression is a
NFjB site located 105 bp upstream of the E-box containing
12-bp repeat. EMSA and supershift experiments show that
NFjB p50 and p65 bind this NFjB consensus sequence
(GGGATTTTCC). It was previously shown that PMA
treatment of HL60 cells increased SHP-1 transcription [15].
We found that (I)SHP-1 transcripts were upregulated by
PMA in HL60 and SKOV3 cells. Furthermore, PMA-
treated SKOV3 nuclear extracts showed more NFjB
binding activity (fourfold to fivefold; Fig. 3) than those
from untreated cells. Thus, it is likely that PMA activates
NFjB proteins which in turn leads to higher expression of
(I)SHP-1 transcripts. Confirmation of this result can be
achieved by deleting the NFjB site in the promoter
construct and assessing whether this will render transfected
cells unresponsive to PMA.
Our analyses of the deletion constructs transfected into
SKOV3 cells indicated that deletion of the region I (the 5¢
420 bp sequences, Fig. 4) from the promoter construct
(construct B) resulted in a 54% reduction of luciferase
activity. Interestingly, no consensus sequences for known
nuclear factors are found in region I. This result indicates
that there might be novel nuclear factors (activators) which
contribute to (I)SHP-1 promoter activity.
Contrary to our results (i.e. progressively less promoter
activity with sequential deletion of the 5¢ flanking region), a
recent deletional study of the same distal promoter in
MCF7 cells (a breast cancer cell line), showed a dramatic
drop of promoter activity to  15% using a deletion
construct with 5¢ flanking sequences up to 60 bp upstream

of the 12-bp repeat [20]. It is possible that the vast difference
in the level of SHP-1 transcripts expressed in SKOV3 vs.
MCF7 cells might account for the discrepancy in the results
between the two deletional analyses. We found that MCF7
expressed at least 10-fold more SHP-1 transcripts and SHP-
1 proteins than SKOV3 cells (unpublished data). It has also
been reported that SHP-1 was up-regulated in MCF7 cells,
as in human breast cancers [21]. We showed previously that
SKOV3 expressed SHP-1 levels similar to normal ovarian
epithelial cells [22] and thus our deletional analysis in
SKOV3 might reflect a more physiological (and not
pathological) situation of SHP-1 expression. Although we
favor the above explanation, we cannot rule out the
possibility that the control of SHP-1 expression might
differ in ovarian vs. mammary cells.
ACKNOWLEDGEMENTS
This work was funded by the National Cancer Institute of Canada. We
thank Dr P. Marynen for the generous gift of the SHP-1 containing
cosmid clone, and Dr M. Shulman for a critical review of the
manuscript.
REFERENCES
1. Koch, C.A., Anderson, D., Moran, M.F., Ellis, C. & Pawson, T.
(1991) SH2 and SH3 domains: elements that control interactions
of cytoplasmic signaling protein. Science 252, 668–672.
2. Tsui, H.W., Siminovitch, K.A., de Souza, L. & Tsui, F.W.L.
(1993) Motheaten and viable motheaten mice have mutations in the
haematopoietic cell phosphatase gene. Nat. Genet. 4, 124–129.
3. Shultz, L.D., Schweitzer, P.A., Rajan, T.V., Yi, T., Ihle, J.N.,
Matthews, R.J., Thomas, M.L. & Beier, D.R. (1993) Mutations at
the murine motheaten locus are within the heamtopoietic cell

protein-tyrosine phosphatase (Hcph) gene. Cell 73, 1445–1454.
4. Shultz, L.D., Coman, D.R., Bailey, C.L., Beamer, W.G. &
Sidman, C.L. (1984) ÔViable motheatenÕ, a new allele at the moth-
eaten locus. Am. J. Pathol. 116, 179–192.
5. Neel, B.G. (1997) Role of phosphatases in lymphocyte activation.
Curr. Opin. Immunol. 9, 405–420.
Ó FEBS 2002 Regulation of SHP-1 expression (Eur. J. Biochem. 269) 3063
6. Plutzky, J., Neel, B.G. & Rosenberg, R.D. (1992) Isolation of a src
homology 2-containing tyrosine phosphatase. Proc. Natl Acad.
Sci. USA 89, 123–1127.
7. Cragg, G. & Kellie, S. (2001) A functional nuclear localization
sequence in the C-terminal domain of SHP-1. J. Biol. Chem. 276,
23719–23725.
8. Banville, D., Stocco, R. & Shen, S.H. (1995) Human protein
tyrosine phosphatase 1C (PTPN6) gene structure: alternate pro-
moter usage and exon skipping generate multiple transcripts.
Genomics 27, 165–173.
9. Martin, A., Tsui, H.W., Shulman, M.J., Isenman, D. & Tsui,
F.W.L. (1999) Murine SHP-1 splice variants with altered src
homology 2 (SH2) domains: implications for the SH2-mediated
intramolecular regulation of SHP-1. J. Biol. Chem. 274,
21725–21734.
10. Dignam, J.D., Lebovitz, T.M. & Roeder, R.G. (1983) Accurate
transcription initiation by RNA polymerase II in a soluble extract
from isolated mammalian nuclei. Nucleic Acids Res. 11,
1475–1489.
11. Rosenthal, N. (1987) Identification of regulatory elements
of cloned genes with functional assays. In Methods in Enzy-
mology Vol. 152 (Berger, S.L. & Kimmel, A.R., eds)
pp. 704–720.

12. Alam, J. & Cook, J.L. (1990) Reporter genes: application to the
study of mammalian gene transcription. Anal. Biochem. 188,
245–254.
13. Martin, A., Tsui, H.W. & Tsui, F.W.L. (1999) SHP-1 variant
proteins are absent in motheaten mice despite presence of splice
variant transcripts with open reading frames. Mol. Immunol. 36,
1029–1041.
14. Jin, Y.J., Yu, C.L. & Burakoff, S.J. (1999) Human 70-kDa
SHP-1L differs from 68-kDa SHP-1 in its C-terminal structure and
catalytic activity. J. Biol. Chem. 274, 28301–28307.
15. Uchida, T., Matozaki, T., Matsuda, K., Suzuki, T., Matozaki, S.,
Nakano, O., Eada, K., Konda, Y., Sakamoto, C. & Kasuga, M.
(1993) Phorbol ester stimulates the activity of a protein tyrosine
phosphatase containing SH2 domains (PTP1C) in HL-60 leuke-
mia cells by increasing gene expression. J. Biol. Chem. 268, 11845–
11850.
16. Cole, M.D. & McMahon, S.B. (1999) The myc oncoprotein: a
critical evaluation of transactivation and target gene regulation.
Oncogene 18, 2916–2924.
17. Gregor, P.D., Sawadogo, M. & Roeder, R.G. (1990) The adeno-
virus major late transcription factor USF is a member of the helix-
loop-helix group of regulatory proteins and binds to DNA as a
dimer. Genes Dev. 4, 1730–1740.
18. Ram, P.A. & Waxman, D.J. (1997) Interaction of growth hor-
mone-activated STATs with SH2-containing phosphotyrosine
phosphatase SHP-1 and nuclear JAK2 tyrosine kinase. J. Biol.
Chem. 272, 17694–17702.
19. Luo, X. & Sawadogo, M. (1996) Antiproliferative properties of
the USF family of transcription factors. Proc. Natl Acad. Sci. USA
93, 1308–1313.

20. Xu, Y., Banville, D., Zhao, H F., Zhao, X. & Shen, S H. (2001)
Transcriptional activity of the SHP-1 gene in MCF7 cells is dif-
ferentially regulated by binding of NF-Y factor to two distinct
CCAAT-elements. Gene 269, 141–153.
21. Yip, S.S., Crew, A.J., Gee, J.M.W., Hui, R., Blamey, R.W.,
Robertson, J.F.R., Nicholson, R.I., Sutherland, R.L. & Daly, R.J.
(2000) Up-regulation of the protein tyrosine phosphtase SHP-1 in
human breast cancer and correlation with grb2 expression. Int. J.
Cancer. 88, 363–368.
22. Mok, S.C., Kwok, T.T., Berkowitz, R.S., Barrett, A.J. & Tsui,
F.W.L. (1995) Overexpression of the protein tyrosine phospha-
tase, nonreceptor type 6 (PTPN6), in human epithelial ovarian
cancer. Gynecol. Oncol. 57, 299–303.
3064 H. W. Tsui et al. (Eur. J. Biochem. 269) Ó FEBS 2002