Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt

Vertical-scanning mutagenesis of amino acids in a model
N-myristoylation motif reveals the major amino-terminal
sequence requirements for protein N-myristoylation
Toshihiko Utsumi, Kengo Nakano, Takeshi Funakoshi, Yoshiyuki Kayano, Sayaka Nakao, Nagisa Sakurai,
Hiroyuki Iwata
1
and Rumi Ishisaka
Department of Biological Chemistry and
1
Department of Veterinary Medicine, Faculty of Agriculture, Yamaguchi University,
Yamaguchi, Japan
In order to determine the amino-terminal sequence
requirements for protein N-myristoylation, site-directed
mutagenesis of the N-terminal region was performed using
tumor necrosis factor (TNF) mutants as model substrate
proteins. Subsequently, the susceptibility of these mutants to
protein N-myristoylation was evaluated by metabolic labe-
ling in an in vitro translation system using rabbit reticulocyte
lysate. A TNF mutant having the sequence MGAAAAA
AAA at its N-terminus was used as the starting sequence
to identify elements critical for protein N-myristoylation.
Sequential vertical-scanning mutagenesis of amino acids at a
distinct position in this model N-terminal sequence revealed
the major sequence requirements for protein N-myristoyla-
tion: the combination of amino acids at position 3 and 6
constitutes a major determinant for the susceptibility to
protein N-myristoylation. When Ser was located at position
6,11aminoacids(Gly,Ala,Ser,Cys,Thr,Val,Asn,Leu,Ile,
Gln, His) were permitted at position 3 to direct efficient
protein N-myristoylation. In this case, the presence of Lys at
position 7 was found to affect the amino acid requirement at

position 3 and Lys became permitted at this position. When
Ser was not located at position 6, only 3 amino acids (Ala,
Asn, Gln) were permitted at position 3 to direct efficient
protein N-myristoylation. The amino acid requirements
found in this study were fully consistent with the N-terminal
sequence of 78 N-myristoylated proteins in which N-myr-
istoylation was experimentally verified. These observations
strongly indicate that the combination of amino acids at
position 3, 6 and 7 is a major determinant for protein N-
myristoylation.
Keywords: N-myristoylation motif; N-myristoyltransferase;
protein N-myristoylation; substrate specificity; vertical
scanning mutagenesis.
A number of eukaryotic cellular proteins are found to be
covalently modified with the 14-carbon saturated fatty
acid, myristic acid [1–5]. Many of the N-myristoylated
proteins play key roles in regulating cellular structure and
function. They include proteins involved in a wide variety
of cellular signal transduction pathways. In general,
protein N-myristoylation is the result of cotranslational
addition of myristic acid to a Gly residue at the extreme
N-terminus after removal of the initiating Met. A stable
amide bond links myristic acid irreversibly to proteins.
N-Myristoylation can also occur post-translationally, as in
the case of the pro-apoptotic protein BID and cytoskeletal
actin, where proteolytic cleavage by caspase reveals a
ÔhiddenÕ myristoylation motif [6,7]. N-Myristoylation is
catalyzed by N-myristoyltransferase (NMT), a member of
the GCN5 acetyltransferase (GNAT) superfamily of
proteins [8]. NMT has been purified and cloned from

many organisms [9–12] and its substrate specificities have
been characterized. In general, Ser or Thr is preferred at
position 6, and the N-terminal consensus motif Me-Gly-
X-X-X-Ser/Thr that directs protein N-myristoylation
has been defined [13]. Saccharomyces cerevisiae NMT
(NMT1p) is the best studied of the known NMTs. The
precise substrate specificity of this enzyme has been
characterized using purified enzyme and synthetic peptides
derived from the N-terminal sequences of known
N-myristoylated proteins [1,14,15]. These studies have
produced a set of empiric rules for amino acid require-
ments at distinct positions in the N-myristoylation motif
as follows: (a) the requirement for Gly at position 2 is
absolute; (b) charged residues, aromatics and Pro are not
allowed at position 3; (c) all amino acids are allowed at
positions 4 and 5; (d) Ser, Thr, Ala, Gly, Cys, or Asn are
permitted at position 6; (e) all but Pro are allowed at
position 7 [5]. Thus, it is well accepted that in addition to
Gly at position 2, the amino acids at positions 3, 6, and 7
play an important role in substrate recognition by NMT.
In fact, it was demonstrated that the difference in the
substrate specificity of NMT in different species depends
mainly on the difference in the permitted amino acid
residues in these three positions [16,17]. However, the
Correspondence to T. Utsumi, Department of Biological Chemistry,
Faculty of Agriculture, Yamaguchi University, Yamaguchi 753-8515,
Japan. Fax: + 81 83 933 5820, Tel.: + 81 83 933 5856,
E-mail:
Abbreviations: DMEM, Dulbecco modified Eagle’s medium; DPBS,
Dulbecco’s phosphate-buffered saline; NMT, N-myristoyltransferase;

TNF, tumor necrosis factor.
(Received 1 November 2003, revised 25 December 2003,
accepted 13 January 2004)
Eur. J. Biochem. 271, 863–874 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.03991.x
relative roles of these residues in substrate recognition or
the relationship between the amino acids that reside at
these three positions have not been well characterized so
far.
Proteins destined to become N-myristoylated begin with
the sequence Met-Gly. However, proteins having the Met-
Gly sequence at their N-terminus may also be subjected
to another cotranslational protein modification, N-acety-
lation. In fact, many proteins having an N-terminal Met-
Gly sequence, such as ovalbumin [18], cytochrome c [19],
actin [20], and 20S proteasome a3 subunit [21] have been
found to be N-acetylated. N-Acetyltransferases that cata-
lyze cotranslational protein N-acetylation also have a
restricted number of substrates [22–24]. However, the
differences in the N-terminal sequence requirements for
protein N-myristoylation and protein N-acetylation have
not been fully characterized yet. In a previous report, we
showed that metabolic labeling in an in vitro translation
system is an effective strategy to characterize cotransla-
tional N-terminal protein modifications [25,26]. As the
in vitro translation system using rabbit reticulocyte lysate
contains all the components involved in cotranslational
protein N-myristoylation and N-acetylation [18,20,27], the
use of this system to study cotranslational protein
N-myristoylation seems to be appropriate. Using this
assay system, we demonstrated previously that the amino

acid residue at position 3 strongly affects protein N-
myristoylation, and the amino acid requirements at this
position are significantly affected by the amino acid at
position 6 [25]. These results suggested that the combina-
tion of amino acids at positions 3 and 6 might be a critical
determinant for protein N-myristoylation. In this study, to
examine the effect of the combination of amino acids at
positions 3 and 6 on protein N-myristoylation, sequential
vertical-scanning mutagenesis of the amino acids at
positions 3 and 6 in a model N-terminal sequence was
performed and the susceptibility of these mutants to
protein N-myristoylation was evaluated by metabolic
labeling in an in vitro translation system using rabbit
reticulocyte lysate.
Experimental procedures
Materials
Restriction endonucleases, DNA-modifying enzymes,
RNase inhibitor, and Taq DNA polymerase were pur-
chased from Takara Shuzo (Japan). The mCAP RNA
capping kit and proteinase K were from Stratagene. RNase
was purchased from Boehringer-Mannheim (Germany).
Rabbit reticulocyte lysate was from Promega. [
3
H]leucine,
[
3
H]myristic acid, [
35
S]methionine and Amplify were from
Amersham (UK). The Dye Terminator Cycle Sequencing

kit was from Applied Biosystems. Anti-human TNF
polyclonal Ig was purchased from R & D systems. Pro-
tein G Sepharose was from Pharmacia Biotech. Other
reagents purchased from Wako Pure Chemical, Daiichi
Pure Chemicals, and Seikagaku Kogyo (Japan) were of
analytical or DNA grade.
Plasmid construction
Plasmid pBluescript II SK(+) lacking ApaIandHinDIII
sites was constructed as described previously [28], and
designated pB. Plasmid pBDpro-TNF, which contains a
cDNA coding for the mature domain of TNF, was
constructed as described [28,29]. Plasmid pBMA(9)-TNF
was constructed by utilizing PCR. For this procedure,
pBDpro-TNF served as a template, and two oligonucleo-
tides [MA(9), B1] as primers (Table 1). After digestion with
BamHI and PstI, the amplified product was subcloned into
pB at the BamHI and PstI sites. Plasmids pBMGA(8) and
pBMG6S were constructed by a method similar to that
used to construct pBMA(9)-TNF using two primers
[MGA(8) and MG6S, respectively] as mutagenic primers
(Table 1). The cDNAs coding for MG6X-TNF, in which
Ser at position 6 in MG6S-TNF was replaced with each of
the 19 other amino acids, were constructed by using a
degenerated primer, MG6X, as mutagenic primer. After
digestion with BamHI and PstI, the amplified product was
subcloned into pB at the BamHI and PstI sites. The DNA
Table 1. Nucleotide sequences of oligonucleotides used for the construction of mutant TNF cDNAs. N, A + C + G + T; K, T + G.
Primer Sequence (5¢fi3¢)
MA(9)
ATATGGATCCATGGCTGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC

MGA(8) ATATGGATCCATGGGCGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC
MG6S GCCGGGATCCATGGGCGCAGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC
MG6X GCCGGGATCCATGGGCGCAGCAGCANNKGCAGCAGCAGCAGAC
MG3X ATATGGATCCATGGGCNNKGCAGCAGCGGCAGCAGCAGCAGAC
XHO-TNF13 GCCGCTCGAGCCTGTAGCCCATGTT
6S-XHO AATTCTCGAGTGCTGCTGCTGCCGATGCTGC
6T-XHO AATTCTCGAGTGCTGCTGCTGCCGTTGCTGC
6F-XHO AATTCTCGAGTGCTGCTGCTGCGAATGCTGC
C3K-A7K GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAG
HC-K7A GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAG
MG3K6S GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC
MG3K6S7K GCCGGGATCCATGGGCAAGGCAGCATCTAAGGCAGCAGCAGACAAGCCTGTAGCC
T3 AATTAACCCTCACTAAAGGG
B1 GCCGGGATCCTAGGGCGAATTGGGTACC
864 T. Utsumi et al. (Eur. J. Biochem. 271) Ó FEBS 2004
sequences of the obtained plasmids were determined by the
dideoxynucleotide chain termination method and plasmids
having a distinct triplet codon corresponding to each of the
19 amino acids at position 6 were obtained. The cDNAs
coding for MG3X-TNF, in which the Ala at position 3 in
MGA(8)-TNF was replaced with each of the 19 other
amino acids, were constructed by a method similar to that
used to construct MG6X-TNF using a degenerated primer,
MG3X, as a mutagenic primer. pBG
i1
a-, pBG
i1
a-C3K- and
pBhippocalcin-TNF were constructed as described previ-
ously [25]. The cDNAs coding for MG3X6S-, MG3X6T-

and MG3X6F-TNF, in which the Ala at position 6 in
MG3X-TNF was replaced with Ser, Thr and Phe, respect-
ively, were constructed as follows. pB G
i1
a-D1-12-TNF, in
which the DNA sequence encoding the N-terminal 12
amino acids of the mature domain of TNF was deleted
from pBG
i1
a-TNF, was first generated from pBG
i1
a-TNF
by PCR. For this procedure, pBDpro-TNF served as a
template and two oligonucleotides (XHO-TNF13, B1) as
primers. After digestion with XhoIandPstI, the amplified
product was subcloned into pBG
i1
a-TNF at the XhoIand
PstI sites. DNA fragments coding for the N-terminal
10 residues of MG3X6S-, MG3X6T-, and MG3X6F-TNF
were amplified by PCR. In this case, pBMG3X-TNF
served as a template and two oligonucleotides (T3 plus 6S-
XHO, T3 plus 6T-XHO, or T3 plus 6F-XHO, respectively)
as primers. After digestion with SacIandXhoI, the
amplified product was subcloned into pB G
i1
a-D1-12-
TNF at the SacIandXhoI sites. In these three sets of TNF
mutants, the amino acids at positions 11 and 12 were
changed from Asp-Lys to Leu-Glu because of the insertion

of the Xho I-linker sequence. pBG
i1
a-C3K-A7K-TNF, in
which the Ala at position 7 in pBG
i1
a-C3K-TNF was
replaced with Lys, was generated from pBG
i1
a-C3K-TNF
by PCR. In this case, pBG
i1
a-C3K-TNF served as a
template and two oligonucleotides (C3K-A7K, B1) as
primers. After digestion with BamHI and PstI, the ampli-
fied products were subcloned into pB at the BamHI and
PstI sites. pBhippocalcin-K7A-TNF, pBMG3K6S-TNF,
and pBMG3K6S7K-TNF were constructed by a method
similar to that used to construct pBG
i1
a-C3K-A7K-TNF.
The mutagenic primers used to construct these three
mutants were HC-K7A, MG3K6S, and MG3K6S7K,
respectively (Table 1). The DNA sequences of these
recombinant cDNAs were confirmed by the dideoxynucleo-
tide chain termination method [30].
In vitro
transcription and translation
Methods essentially identical to those described previously
were employed [28]. T3 polymerase was used to obtain
transcripts of these cDNAs subcloned into pB vector. These

transcripts were purified by phenol/chloroform extraction
and ethanol precipitation prior to use. Subsequently, the
translation reaction was carried out using the rabbit
reticulocyte lysate (Promega) in the presence of [
3
H]leucine,
[
35
S]methionine or [
3
H]myristic acid under conditions
recommended by the manufacturer. The mixture (com-
posed of 17.5 lL of rabbit reticulocyte lysate, 0.5 lLof
1m
M
leucine- or methionine-free amino acid mixture, or
1m
M
complete amino acid mixture, 4.0 lLof[
3
H]leucine
(5 lCi), [
35
S]methionine (1 lCi), [
3
H]myristic acid (25 lCi)
or [
3
H]acetyl-CoA (2 lCi) and 3.0 lLofmRNA)was
incubated at 30 °C for 90 min.

Transfection of COS-1 cells and determination
of N-myristoylated proteins
The simian virus 40-transformed African Green monkey
kidney cell line, COS-1, was maintained in Dulbecco
modified Eagle’s medium (DMEM, Gibco BRL) supple-
mented with 10% fetal bovine serum (Gibco BRL). Cells
(2 · 10
5
) were plated onto 35 mm-diameter dishes 1 day
before transfection. The pcDNA3 construct (2 lg; Invitro-
gen) containing mutant TNF cDNA was used to transfect
each plate of COS-1 cells along with 3 lL of LipofectAmine
(2 mgÆmL
)1
; Gibco BRL) in 1 mL of serum-free medium.
After incubation for 5 h at 37 °C, the cells were re-fed with
serum-containing medium and incubated again at 37 °Cfor
24 h. The cells were then washed twice with 1 mL of serum-
free DMEM and incubated for 5 h in 1 mL of DMEM with
2% fetal bovine serum containing [
3
H]myristic acid
(100 lCiÆmL
)1
). Subsequently, the cells were washed three
times with Dulbecco’s phosphate-buffered saline (DPBS)
and collected with cell scrapers, and then lysed with 200 lL
of RIPA buffer [50 m
M
Tris/HCl (pH 7.5), 150 m

M
NaCl,
1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS,
proteinase inhibitors] on ice for 20 min. The cell lysates
were centrifuged at 21 000 g at 4 °Cfor15minina
microcentrifuge (HITACHI-CF15D2) and supernatants
were collected. After immunoprecipitation with anti-TNF
Ig, the samples were analyzed by SDS/PAGE and fluoro-
graphy.
Western blotting
TNF samples immunoprecipitated from in vitro translation
products or total cell lysates of each group of transfected cells
were resolved by 12.5% SDS/PAGE and then transferred
to an Immobilon-P transfer membrane (Millipore). After
blocking with nonfat milk, the membrane was probed with a
specific goat anti-hTNF Ig as described previously [31].
Immunoreactive proteins were specifically detected by incu-
bation with horseradish peroxidase-conjugated anti-goat
IgG (Santa Cruz). The membrane was developed with ECL
Western blotting reagent (Amersham Corp.) and exposed to
an X-ray film (Kodak). Quantitative analysis of immuno-
reactive proteins was carried out by scanning the X-ray film
using an imaging densitometer (Bio-Rad GS-700).
Immunoprecipitation
Samples containing TNF mutants were immunoprecipit-
ated with a specific goat anti-hTNF polyclonal Ig (R & D
systems) as described [28].
SDS/PAGE and fluorography
Samples were denatured by boiling for 3 min in SDS/
sample buffer and then analyzed by SDS/PAGE on a

12.5% gel. Thereafter, the gel was fixed and soaked in
Amplify
TM
(Amersham) for 30 min. The gel was dried
under vacuum and exposed to X-ray film (Kodak) for an
appropriate period. Quantitative analysis of the labeled
Ó FEBS 2004 Analysis of the N-myristoylation consensus motif (Eur. J. Biochem. 271) 865
proteins was carried out by scanning the fluorogram using
an imaging densitometer (Bio-Rad GS-700).
Results
Effect of the amino acid residue at position 6
in the N-myristoylation consensus motif on the efficiency
of the cotranslational N-myristoylation reaction
To determine the amino-terminal sequence requirements for
protein N-myristoylation, the relative roles of amino acids
in the N-myristoylation consensus motif, especially those
at positions 3 and 6, in protein N-myristoylation were
evaluated by metabolic labeling of model substrate proteins
in an in vitro translation system. In this case, to avoid the
effects of amino acids at other positions in the N-terminal
region on protein N-myristoylation, MA(9)-TNF, a TNF
mutant in which 9 amino acids following the initiating Met
were changed to Ala, was used as the starting sequence to
evaluate the roles of the amino acids at distinct positions in
protein N-myristoylation (Fig. 1).
As shown in Fig. 2A (lane 2), translation of an mRNA
coding for MA(9)-TNF in the presence of [
3
H]leucine gave
rise to two translation products; one was the major product

with an expected molecular mass (17 kDa) and the other
was a fainter band with a molecular mass  2kDalarger
than expected. No incorporation of [
3
H]myristic acid was
detected in these translation products, as shown in Fig. 2A
(lane 10). [
35
S]Met labeling of this mutant revealed that
[
35
S]Met was specifically incorporated into the upper of the
two bands detected with [
3
H]Leu (lane 6). As there is no Met
residue in the mature domain of TNF, this result indicates
that the upper band corresponds to the protein species
retaining the initiating Met residue and the lower band to
the one lacking this residue. When Ala at position 2 was
changed to Gly, the obtained mutant [MGA(8)-TNF] was
efficiently N-myristoylated, as shown in lanes 3 and 11.
Fig. 1. Schematic representation of generation of MA(9)-, MGA(8)-,
and MG6S-TNF. cDNA coding for Dpro-TNF, which contains the
mature domain of TNF, was first generated from pro-TNF cDNA by
deleting the nucleotide sequence encoding the propeptide region of
pro-TNF. Subsequently, cDNAs of MA(9)-, MGA(8)-, and MG6S-
TNF were generated from Dpro-TNF cDNA by site-directed muta-
genesis.
Fig. 2. MGA(8)-TNF with an N-terminal sequence MGAAAAAAAA
is N-myristoylated. The mRNAs encoding G

i1
a-, MA(9)-, MGA(8)-,
and MG6S-TNF were translated in vitro in the presence of [
3
H]leucine,
[
35
S]methionine or [
3
H]myristic acid using rabbit reticulocyte lysate.
Following immunoprecipitation with anti-TNF Ig, the labeled trans-
lation products were analyzed by SDS/PAGE and fluorography (A).
The cDNAs encoding G
i1
a-, MA(9)-, MGA(8)-, and MG6S-TNF
were transfected into COS-1 cells, and their expression and N-myris-
toylation were evaluated by Western blotting analysis and [
3
H]myristic
acid-labeling, respectively (B).
866 T. Utsumi et al. (Eur. J. Biochem. 271) Ó FEBS 2004
The levels of incorporation of [
3
H]Leu and [
3
H]myristic
acid into the lower band of the expressed MGA(8)-TNF
were comparable with those into G
i1
a-TNF [32], in which

the N-terminal 10 residues of the G
i1
a protein were linked to
the N-terminus of the mature domain of TNF (lanes 1, 3,
9 and 11). These results revealed that MGA(8)-TNF is
efficiently N-myristoylated, similarly to a protein having a
natural N-myristoylation motif. When Ala at position 6
in MGA(8)-TNF was changed to Ser, a similar level of
[
3
H]myristic acid incorporation was observed with the
obtained mutant (MG6S-TNF), as shown in lanes 4 and 12.
The results obtained with MGA(8)- and MG6S-TNF
clearly indicate that Ser at position 6 is not critical for
protein N-myristoylation. When these four mutants were
expressed in COS-1 cells and their susceptibility to protein
N-myristoylation was evaluated by in vivo metabolic
labeling with [
3
H]myristic acid, efficient protein N-myris-
toylation was detected equally with G
i1
a-, MGA(8)- and
MG6S-TNF,asalsoobservedinanin vitro translation
system (Fig. 2B). In this case, the upper bands detected in
the in vitro translation system were not detected in the
Western blotting analysis of the expressed proteins in
COS-1 cells. These results suggest that the incorporation of
[
3

H]myristic acid into the major protein band expressed in
the in vitro translation system fully reflect the in vivo protein
N-myristoylation that occurs in intact cells.
To determine the effect of the amino acid residue at
position 6 in the N-myristoylation consensus motif on
protein N-myristoylation, vertical scanning mutagenesis of
the amino acid at position 6 in MG6S-TNF was performed;
a series of TNF mutants in which the Ser at position 6 in
MG6S-TNF was changed to each of the 19 other amino
acids was generated. Subsequently, the susceptibility of
these mutants to cotranslational protein N-myristoylation
was evaluated by using the in vitro translation system. The
results for the 20 amino acids are arranged according to
their radius of gyration. All of these mutants, except for a
mutant having a Cys residue at position 6, were efficiently
expressed as determined by the incorporation of [
3
H]Leu, as
shown in the upper panels of Fig. 3A. The labeling with
[
3
H]myristic acid revealed that in addition to Ser and Thr,
five other amino acids (Gly, Ala, Leu, Ile and Phe) were
permitted at position 6 to direct efficient protein
N-myristoylation (Fig. 3B). In these mutants, a low level
Fig. 3. Effect of the amino acid residue at position 6 in N-myristoylation consensus motif on the efficiency of cotranslational N-myristoylation reaction.
The mRNAs encoding MG6X-TNF were translated in vitro in the presence of [
3
H]leucine or [
3

H]myristic acid using rabbit reticulocyte lysate.
Following immunoprecipitation with anti-TNF Ig, the labeled translation products were analyzed by SDS/PAGE and fluorography. Results for the
20 amino acids were arranged according to their radius of gyration. Three independent experiments showed similar labeling patterns (A). The
efficiency of protein N-myristoylation ([
3
H]myristic acid incorporation/[
3
H]leucine incorporation) of MG6X-TNF was compared by quantitative
analysis of the fluorograms of [
3
H]myristic acid- and [
3
H]leucine-labeled proteins shown in the lower and upper panels of (A). Relative
N-myristoylation efficiency of each MG6X-TNF was expressed as the percentage of the N-myristoylation efficiency of MG6L-TNF. Results for the
20 amino acids were arranged according to their radius of gyration (B). ND, not determined.
Ó FEBS 2004 Analysis of the N-myristoylation consensus motif (Eur. J. Biochem. 271) 867
of [
3
H]myristic acid incorporation was detected with
mutantshavingPro,Asn,Gln,Glu,His,Met,Tyrand
Trp at this position.
It is generally accepted that Ser or Thr is preferred at
position 6 for protein N-myristoylation. In fact, when the
number of each amino acid residues located at position 6 in
78 N-myristoylated proteins in which N-myristoylation was
experimentally verified listed in a recent report [33] were
counted, 74% (58 of 78) of these proteins had a Ser residue
and 13% (10 of 78) had a Thr residue at position 6 (Fig. 4).
The number of N-myristoylated proteins having other
amino acids at position 6 accounted for only 13% (10 of 78)

of the total N-myristoylated proteins. These observations,
taken together with the fact that five other amino acids
could be permitted at this position in the model substrate
protein, suggest that the presence of Ser or Thr at posit-
ion 6 might affect the amino acid requirements at other
positions, thereby favoring the susceptibility to protein
N-myristoylation.
Effect of the amino acid residue at position 6 in the
N-myristoylation consensus motif on the amino acid
requirement at position 3 for cotranslational protein
N-myristoylation
In a previous report, we demonstrated that the amino acid
at position 3 strongly affected protein N-myristoylation,
and the amino acid requirements at this position were
significantly affected by the amino acid at position 6 [25].
Therefore, we next determined the effect of the amino acid
at position 6 on the amino acid requirements at position 3
for protein N-myristoylation by vertical scanning muta-
genesis. We first determined the effect of the amino acid
residue at position 3 in MGA(8)-TNF on protein N-myr-
istoylation. A series of TNF mutants (MG3X6A-TNF) in
which Ala at position 3 in MGA(8)-TNF was changed to 19
other amino acids were generated and their susceptibility to
cotranslational protein N-myristoylation was evaluated in
the in vitro translation system. The results revealed that the
amino acid at position 3 in MGA(8)-TNF strongly affected
protein N-myristoylation and only three amino acids (Ala,
Asn and Gln) could direct efficient protein N-myristoyla-
tion, as shown in Fig. 5B. In these mutants, a low level of
[

3
H]myristic acid incorporation was detected with mutants
having Ser, Cys, Val or Ile at this position. Metabolic
labelingofthesamesetofmutantswith[
3
H]acetyl CoA
revealed that efficient protein N-acetylation was detected in
mutants having Ser, Thr, Asp, Glu or Met at position 3, as
shown in Fig. 5C. These results indicate that the experi-
mental results obtained by metabolic labeling with [
3
H]my-
ristic acid in the in vitro translation system do not reflect a
simple enzyme reaction mediated by NMT, but do reflect
the result of the overall reaction involving a set of
cotranslational N-terminal modifications.
When the Ala at position 6 in MG3X6 A-TNF was
changed to Ser to generate MG3X6S-TNF, a dramatic
change in the amino acid requirement at position 3 was
Fig. 4. Amino acid residues at position 6 in naturally occurring
N-myristoylation motif. The numbers of each amino acid residue
located at position 6 in 78 N-myristoylated proteins in which
N-myristoylation was experimentally verified listed in a recent report
[33] were counted and arranged according to their radius of gyration.
Fig. 5. Effect of the amino acid residue at position 3 on the protein N-myristoylation and N-acetylation of MG3X6A-TNF. The mRNAs encoding
MG3X6A-TNF were translated in vitro in the presence of [
3
H]leucine (A), [
3
H]myristic acid (B) or [

3
H]acetyl CoA (C) using rabbit reticulocyte
lysate. Following immunoprecipitation with anti-TNF Ig, the labeled translation products were analyzed by SDS/PAGE and fluorography. Results
for the 20 amino acids were arranged according to their radius of gyration.
868 T. Utsumi et al. (Eur. J. Biochem. 271) Ó FEBS 2004
observed: 11 amino acids (Gly, Ala, Ser, Cys, Thr, Val, Asn,
Leu, Ile, Gln, His) were permitted at position 3 to direct
efficient protein N-myristoylation, as shown in Fig. 6A.
Alowlevelof[
3
H]myristic acid incorporation was also
detected with mutants having Pro, Asp, Glu and Met at this
position. To determine whether the remarkable change in
the amino acid requirement at position 3 was specific for
Ser or not, the Ala at position 6 in MG3X6 A-TNF was
changed to other amino acids, and their susceptibility to
protein N-myristoylation was evaluated. In this case, we
chose Thr and Phe to further analyze the effect of the amino
acid residue at position 6 on the amino acid requirement at
position 3 because of the presence of these amino acids at
position 6 in naturally observed N-myristoylated proteins
(Fig. 4). The results revealed that amino acid requirements
at position 3 very similar to those of MG3X6A-TNF were
observed with both of these two series of mutants
(MG3X6T- and MG3X6F-TNF) as shown in Fig. 6B,C.
In these mutants, a low level of [
3
H]myristic acid incorpor-
ation was detected with several amino acids: Ser, Thr, Val,
Ile in MG3X6T-TNF and Thr, Val, Ile in MG3X6F-TNF.

Thus, it was concluded from these observations that the
combination of amino acids at positions 3 and 6 constitutes
a major determinant for the susceptibility to protein
N-myristoylation. When Ser was located at position 6, 11
aminoacids(Gly,Ala,Ser,Cys,Thr,Val,Asn,Leu,Ile,
Gln, His) were permitted at position 3 to direct protein N-
myristoylation. When Ser was not located at position 6,
only 3 amino acids (Ala, Asn, Gln) were permitted at
position 3 to direct efficient protein N-myristoylation.
The presence of a Lys residue at position 7
in the N-myristoylation consensus motif affects the
amino acid requirement at position 3 and Lys becomes
permitted at this position
We next determined whether the effect of the amino acid at
position 6 on the amino acid requirements at position 3
found in the model substrate proteins were applicable to
naturally N-myristoylated proteins or not. The numbers of
each amino acid residue located at position 3 in 74 naturally
N-myristoylated proteins having Ala, Ser, Thr or Phe at
position 6 listed in a recent report [33] were counted and are
summarized in Fig. 7. As shown in the figure, 95 per cent
(70 out of 74) of these proteins had amino acid residues
at position 3 that were consistent with the amino acid
requirements at position 3 for protein N-myristoylation
found in this study. All of the proteins in which the amino
Fig. 6. Effect of the amino acid residue at position 6 in N-myristoylation consensus motif on the amino acid requirements at position 3 for cotrans-
lational protein N-myristoylation. The mRNAs encoding MG3X6S-, MG3X6T-, and MG3X6F-TNF were translated in vitro in the presence of
[
3
H]leucine or [

3
H]myristic acid using rabbit reticulocyte lysate. Following immunoprecipitation with anti-TNF Ig, the labeled translation products
were analyzed by SDS/PAGE and fluorography. Results for the 20 amino acids were arranged according to their radius of gyration. A, B and C
show results with MG3X6S-, MG3X6T-, and MG3X6F-TNF, respectively.
Ó FEBS 2004 Analysis of the N-myristoylation consensus motif (Eur. J. Biochem. 271) 869
acid at position 3 is inconsistent with our present results
have a Lys residue at this position. These observations
suggest that an N-myristoylation motif having a Lys residue
at position 3 might have other specific structural determi-
nants that permit the Lys residue at position 3 while still
directing protein N-myristoylation. When the N-terminal
sequences of five N-myristoylated proteins having a Lys
residue at position 3 listed in a recent review [4] were
compared, a striking similarity was observed; the amino
acid at position 7 was in all cases Lys (Table 2).
It was speculated from these observations that the specific
determinant that permits the Lys residue at position 3 might
be the Lys residue at position 7. To test this possibility, the
effect of a Lys residue at position 7 on the amino acid
requirement at position 3 was evaluated by using several
TNF mutants.
When the Cys residue at position 3 in G
i1
a-TNF, which
has a natural N-myristoylation motif at the N-terminus, was
changed to Lys, N-myristoylation was significantly reduced,
as shown in Fig. 8A lanes 1 and 2. However, when the Ala
residue at position 7 of this mutant (G
i1
a-C3K-TNF) was

changed to Lys, efficient N-myristoylation was observed
with the obtained mutant (G
i1
a-C3K-A7K-TNF), as shown
in lane 3. In contrast, when the Lys residue at position 7 in
hippocalcin-TNF, which has Lys residues at positions 3 and
7, was replaced with Ala, N-myristoylation was completely
inhibited, as shown in lanes 4 and 5. These results clearly
suggest that the specific determinant that permits the Lys
residue at position 3 is the Lys residue at position 7.
To further confirm this idea, the effect of the Lys residue
at position 7 on the amino acid requirement at position 3
was evaluated by using MG6S-TNF as a model substrate.
When the Ala residue at position 3 in MG6S-TNF was
changed to Lys, N-myristoylation was completely inhibited,
as shown in Fig. 8B lanes 1, 2, 4 and 5. However, when the
Ala residue at position 7 of this mutant (MG3K6S-TNF)
was changed to Lys, efficient N-myristoylation was
observed with the obtained mutant (MG3K6S-7K-TNF),
as shown in lanes 3 and 6. These results strongly support the
idea that the specific determinant that permits the Lys
residue at position 3 is the Lys residue at position 7.
Discussion
Protein N-myristoylation is a cotranslational protein modi-
fication catalyzed by an enzyme, N-myristoyl transferase
(NMT). NMT is a member of the GCN5 acetyltransferase
(GNAT) superfamily. All family members catalyze the
transfer of an acyl group from CoA to a primary amino
group. NMT can be distinguished from other GNAT family
members on the basis of the remarkable diversity of its

protein substrates. For example, it was reported recently
that the Arabidopsis thaliana genome encodes 437 known
or putative NMT substrates, accounting for 1.7% of all
proteins [17].
S. cerevisiae Nmt1p is the best studied of the known
NMTs. The X-ray structure of a binary complex of Nmt1p
with bound myristoyl-CoA has been determined [34]. A
structure of a ternary complex of Nmt1p with a bound
Fig. 7. The combination of the amino acid residues at position 3 and 6 in
naturally occurring N-myristoylation motif. The numbers of each amino
acid residue located at position 3 in 74 naturally N-myristoylated
proteins having Ala, Ser, Thr or Phe at position 6 listed in recent report
[33] were counted and arranged according to their radius of gyration.
A, B, C and D show results with N-myristoylated proteins having Ala,
Ser, Thr and Phe at position 6, respectively. Filled bars, amino acid
residue consistent with the amino acid requirements at position 3
found in this study; striped bars, amino acid residue inconsistent with
the amino acid requirements at position 3 found in this study.
Table 2. N-terminal sequence of N-myristoylated proteins having Lys
residue at position 3. Aminoacidsatpositions3,6and7areinboldtype.
Protein N-terminal sequence
Ca
2+
binding/EF hand proteins
Aplycalcin
(M)GKRASKLKPEEVEEL
Hippocalcin (M)GKQNSKLRPEMLQDL
Neurocalcin (M)GKQNSKLRPEVMQDL
Rem-1 (M)GKQNSKLRPEVLQDL
Visinin-like protein 3 (M)GKQNSKLRPEVLQDL

ADP-ribosylation factor
Arf-6
(M)GKVLSKIFGNKEMRI
870 T. Utsumi et al. (Eur. J. Biochem. 271) Ó FEBS 2004
nonhydrolyzable myristoyl-CoA analogue [S-(2-oxo)penta-
decyl-CoA] and an octapeptide substrate has also been
defined [34]. The Nmt1p fold consists of a saddle-shaped
b-sheet flanked by a helices. There is pseudo-2-fold
symmetry. The N-terminal half forms the myristoyl-CoA-
binding site. The C-terminal half forms the bulk of the
peptide-binding site. Each half has a fold similar to the core
structure of GNAT superfamily members [8].
Proteins destined to become N-myristoylated begin with
the sequence Met-Gly. The initiating Met is removed
cotranslationally by methionine aminopeptidase and then
myristic acid is linked to Gly-2 via an amide bond by NMT.
However, not all proteins with an N-terminal glycine are
N-myristoylated and the ability to be recognized by NMT
depends on the downstream amino acid sequence. In
addition, proteins with an N-terminal glycine may also be
subjected to another cotranslational modification, N-acety-
lation.
The precise substrate specificity of S. cerevisiae Nmt1p
has been characterized mainly by using purified enzyme and
synthetic peptides derived from the N-terminal sequences
of known N-myristoylated proteins [1,14,15]. Some amino
acid preferences have been observed at distinct positions
downstream of the N-terminal glycine [1,13,16]. In general,
Ser or Thr is preferred at position 6, and an N-terminal
consensus motif such as Met-Gly-X-X-X-Ser/Thr- [13] has

been defined. In addition to the preference for Ser/Thr
residues at position 6, positively charged residues (Lys or
Arg) are known to be preferred at position 7 [1,16]. Amino
acid preference was also observed at position 3: charged
residues, aromatic residues and Pro are not allowed at this
position [5]. These amino acid preferences were confirmed
by recent studies on the NMT1p structure as determined by
X-ray crystallography [34,35]. In these studies, the structure
of a ternary complex of Nmt1p with a bound nonhydro-
lyzable myristoyl-CoA analogue [S-(2-oxo)pentadecyl-CoA]
and an Arf2p-derived octapeptide substrate, GLYASKLA,
has been defined to 2.5 A
˚
resolution. The determined
structure allows identification of specific residues within
NMT that account for the amino acid preference at
positions 3, 6 and 7 of the peptide substrate. Ser6 (Ser5 in
peptide GLYASKLA), which is greatly preferred in
N-myristoylated proteins, is H-bonded to the side chain of
His221 in NMT1p, as well as the backbone amides of
Asp417 and Gly418 in NMT1p. Lys7 (Lys6 in peptide
GLYASKLA), also preferred in N-myristoylated proteins,
is H-bonded to the side chains of Asp417 and Gly418 in
NMT. As for Leu3 (Leu2 in peptide GLYASKLA), it was
shown that contacts between the side chain of Leu3 and
pantetheine of myristoyl-CoA complete formation of the
Fig. 8. The presence of a Lys residue at position 7 affects the amino acid requirement at position 3 and allows Lys to occur at this position. mRNAs
encoding G
i1
a-, G

i1
a-C3K-, G
i1
a-C3K-A7K-, Hippocalcin-, Hippocalcin-K7A-, MG6S-, MG3K6S-, MG3K6S-7K-TNF were translated in vitro in
thepresenceof[
3
H]leucine or [
3
H]myristic acid using rabbit reticulocyte lysate. Following immunoprecipitation with anti-TNF Ig, the labeled
translation products were analyzed by SDS/PAGE and fluorography. (A) Results with G
i1
a-, G
i1
a-C3K-, G
i1
a-C3K-A7K-, Hippocalcin-,
Hippocalcin-K7A-TNF. (B) Results with MG6S-, MG3K6S-, MG3K6S-7K-TNF.
Ó FEBS 2004 Analysis of the N-myristoylation consensus motif (Eur. J. Biochem. 271) 871
peptide-binding site and at the same time generate a 90°
bend in the peptide backbone, turning it away from
myristoyl-CoA and toward a peptide-binding groove. Thus,
the amino acid at position 3 is important for positioning the
substrate peptide in the peptide-binding site. The residues
described above in NMT1p that interact with GLYASKLA
are highly conserved in NMTs derived from other species.
These results indicate that in addition to the Gly at position
2, the amino acids at positions 3, 6, and 7 in the substrate
protein play important roles in substrate recognition by
NMT. These findings were further confirmed by an Ala-
scanning mutagenesis study designed to define the extent to

which residues at positions 2, 3, 5, and 6 of GLYASKLA
contribute to proper placement of the N-terminal Gly in
the active site [35]. In these experiments, a panel of
GLYASKLA derivatives with single Ala substitutions at
these positions was produced and presteady-state kinetic
analysis was performed. The results revealed that Ala
substitution for Leu2, Ser5, or Lys6 produced a 12–18-fold
reduction in the burst rate. Based on these results, it was
postulated that differences in the efficiency of N-myristoy-
lation of various cellular proteins may arise in part because
of differences in the presentation of Gly2 dictated by
interactions among the residues at positions 3, 6, and 7 of the
substrate and elements in the enzyme’s peptide-binding site.
Thus, it is well established that in addition to the Gly
at position 2, amino acids at positions 3, 6, and 7 play
important roles in substrate recognition by NMT. However,
the relative role of these residues in substrate recognition,
the relationship between amino acids that reside in these
three distinct positions, or favorable amino acid combina-
tions in these positions are not yet well characterized.
In a previous report, we showed that metabolic labeling
in an in vitro translation system is an effective strategy to
characterize the N-terminal sequence requirements for
cotranslational protein N-myristoylation. Using this assay
system, we demonstrated that the amino acid residue at
position 3 strongly affects protein N-myristoylation, and the
amino acid requirements at this position were significantly
affected by the amino acid at position 6 [25]. These results
suggest that the combination of amino acids at positions
3 and 6 might be a critical determinant for protein N-

myristoylation.
In the present study, to examine the effect of the
combination of amino acids at positions 3 and 6 on protein
N-myristoylation, sequential vertical-scanning mutagenesis
of the amino acids at positions 3 and 6 in a model substrate
protein having a sequence MGAAAAAAAA at its
N-terminus was performed and the susceptibility of these
mutants to protein N-myristoylation was evaluated by
metabolic labeling in an in vitro translation system using
rabbit reticulocyte lysate. The results revealed that the
combination of amino acids at positions 3 and 6 strongly
affected the susceptibility of the protein to protein
N-myristoylation. When Ser was located at position 6, 11
aminoacids(Gly,Ala,Ser,Cys,Thr,Val,Asn,Leu,Ile,
Gln, His) were permitted at position 3 to direct efficient
protein N-myristoylation. In contrast, when Ala, Thr or Phe
was located at position 6, only 3 amino acids (Ala, Asn,
Gln) were permitted at position 3 to direct efficient
modification. These results clearly indicate that the amino
acid residues permitted at position 3 are affected by the
amino acid residue reside at position 6. The fact that the
increase in the number of permitted amino acid residues at
position 3 in response to varying the amino acid at position
6 was specific for the Ser residue well explains the fact that
Ser-6 is frequently observed in the naturally observed
N-myristoylated proteins. The mechanism by which the
Ser6 of the substrate affects the amino acid residue
permitted at position 3 is not clear. It is possible to speculate
that this phenomenon is mediated by the specific interaction
between Ser6 of the substrate and elements in the enzyme’s

peptide-binding site. This specific interaction probably
induces the changes in the structure of the peptide-binding
site that cause the alterations in the permitted amino acid at
position 3. Unfortunately, the only reported structural
information about interactions between an NMT and its
peptide substrates comes from the ternary structure with
bound Arf2p-derived GLYASKLA, which has a Ser residue
at position 6. Therefore, if we could obtain the X-ray
structure of NMT bound to a peptide which does not have a
Ser residue at position 6, it might be possible to elucidate the
mechanism by which the Ser at position 6 significantly
affects the amino acid residue permitted at position 3.
In addition to the combination of amino acids at
positions 3 and 6, it was demonstrated that the combination
of amino acids at positions 3 and 7 also affects the
susceptibility of the protein to protein N-myristoylation. In
this case, the presence of Lys at position 7 was found to
affect the amino acid requirement at position 3, and allowed
Lys to occur at this position. This finding demonstrates
again that the specific interaction between an amino acid at
a distinct position in the substrate protein and elements in
the enzyme’s peptide-binding site will induce changes in the
structure of the peptide-binding site that cause an alteration
in the permitted amino acid at an other position. In the
present study, we focused our attention on the effect of
amino acid residue at positions 6 and 7 of substrate protein
on the amino acid requirement at position 3 for protein N-
myristoylation, and did not study the effect of amino acids
at other positions. Recent studies revealed that, for complete
substrate protein, at least the N-terminal 17 residues of the

substrate protein experience amino acid type variability
restrictions for protein N-myristoylation [33]. Therefore, it
might be possible that the amino acids located beyond
position 7 would also affect the amino acid requirement at
position 3. Further studies are required to fully characterize
the favorable combinations of amino acids at distinct
positions in the substrate protein.
It is very important to determine whether the restrictions
on the amino acid combinations at positions 3, 6 and 7 in
the substrate protein for protein N-myristoylation found in
this study are applicable to NMTs derived from different
species. As described previously, the residues in NMT1p
that interact with the amino acids at positions 2, 5 and 6 in
the Arf2p-derived peptide GLYASKLA are highly con-
served in NMTs derived from other species. Therefore,
favorable combinations of amino acids at positions 3, 6 and
7 in substrate protein for protein N-myristoylation might be
similar in many of the NMTs in different species. In fact, the
amino acid requirements found in this study were fully
consistent with the N-terminal sequence of 78 N-myristo-
ylated proteins derived from various species in which
N-myristoylation was experimentally verified.
872 T. Utsumi et al. (Eur. J. Biochem. 271) Ó FEBS 2004
It is well known that differences in the amino acid
requirements for protein N-myristoylation are observed in
different species. The difference in the substrate specificity of
NMT in different species has been attributed mainly to the
difference in the permitted amino acid residues at positions
3, 6, and 7. For example, for the amino acid at position 6,
amino acid residues Leu, Ile, and Phe are known not to be

permitted for S. cerevisiae NMT1p [5], but were found to be
permitted for rabbit NMT (Fig. 3). For the amino acid at
position 3, His is not permitted for S. cerevisiae NMT1p [5],
but was permitted for rabbit NMT (Fig. 5A). Therefore,
it seems likely that the restrictions on the amino acid
combinations at positions 3, 6 and 7 are partly different for
each NMT derived from different species. In order to clarify
the difference in the favorable amino acid combinations at
positions 3, 6 and 7 in different species, experiments similar
to those in the present study should be performed on each of
the NMT species.
Thus, the present study revealed that in addition to the
permitted amino acids at positions 3, 6, and 7 in the
N-terminal sequence, the amino acid combinations in these
positions were major determinants for the susceptibility of
the protein to protein N-myristoylation. For postgenomic
studies, reliable tools for the prediction of co- and post-
translational modifications would be valuable for functional
assignments of functionally unknown proteins. In fact, a
sophisticated program for automated prediction of protein
N-myristoylation from the substrate protein sequence has
been developed recently and is available via public access
web-server [36]. However, as for the amino acid require-
ments at distinct positions in the N-terminal sequence, only
the permitted amino acids in each position have been taken
into consideration in the prediction program. This might
lead to the failure in the accurate prediction of the
N-myristoylated proteins. In fact, we have recently revealed
that the C-terminal 15 kDa fragment of cytoskeletal actin is
post-translationally N-myristoylated upon caspase-medi-

ated cleavage during apoptosis [7]. In this case, however, the
N-terminal 17 amino acid sequence of this fragment was not
predicted to be N-myristoylated by the prediction program.
The amino acids at positions 3 and 6 of this fragment are
Gln and Thr, respectively, and are in agreement with the
favorable amino acid combinations at these positions found
in this study. These observations indicated that the reli-
ability of the prediction program might be significantly
improved by the consideration of the amino acid combina-
tions at positions 3, 6 and 7 in the N-terminal sequence.
Acknowledgements
Part of this work was supported by a Grant-in-Aid for Scientific
Research (No. 12660080, no. 15580080) from the Ministry of
Education, Science and Culture of Japan.
References
1. Towler, D.A., Gordon, J.I., Adams, S.P. & Glaser, L. (1988) The
biology and enzymology of eukaryotic protein acylation. Annu.
Rev. Biochem. 57, 69–99.
2. Spiegel, A.M., Backlund, P.S., Butrynski, J.E., Jones, T.L.Z. &
Simonds, W.F. (1991) The G protein connection: molecular basis
of membrane association. Trends Biochem. Sci. 16, 338–341.
3. Boutin, J.A. (1997) Myristoylation. Cell Signal 9, 15–35.
4. Resh, M.D. (1999) Fatty acylation of proteins: new insights into
membrane targeting of myristoylated and palmitoylated proteins.
Biochem. Biophys. Acta 1451, 1–16.
5. Farazi, T.A., Waksman, G. & Gordon, J.I. (2001) The biology
and enzymology of protein N-myristoylation. J. Biol. Chem. 276,
39501–39504.
6. Zha, J., Weiler, S., Oh, K J., Wei, M.C. & Korsmeyer, S.J. (2000)
Posttranslational N-myristoylation of BID as a molecular switch

for targeting mitochondria and apoptosis. Science 290, 1761–1765.
7. Utsumi, T., Sakurai, N., Nakano, K. & Ishisaka, R. (2003)
C-terminal 15 kDa fragment of cytoskeletal actin is post-
translationally N-myristoylated upon caspase-mediated cleavage
andtargetedtomitochondria.FEBS Lett. 539, 37–44.
8. Dyda, F., Klein, D.C. & Hickman, A.B. (2000) GCN5-related
N-acetyltransferases: a structural overview. Annu. Rev. Biophys.
Biomol. Struct. 29, 81–103.
9. Towler, D.A., Adams, S.P., Eubanks, S.R., Towery, D.S., Jack-
son-Machelski, E., Glaser, L. & Gordon, J.I. (1987) Purification
and characterization of yeast myristoyl CoA: protein N-myr-
istoyltransferase. Proc. Natl Acad. Sci. USA 84, 2708–2712.
10. Duronio, R.J., Reed, S.I. & Gordon, J.I. (1992) Mutations of
human myristoyl-CoA: protein N-myristoyltransferase cause
temperature-sensitive myristic acid auxotrophy in Saccharomyces
cerevisiae. Proc.NatlAcad.Sci.USA89, 4129–4133.
11. Lodge, J.K., Johnson, R.L., Weinberg, R.A. & Gordon, J.I.
(1994) Comparison of myristoyl-CoA: protein N-myristoyl-
transferases from three pathogenic fungi: Cryptococcus neofor-
mans, Histoplasma capsulatum,andCandida albicans. J. Biol.
Chem. 269, 2996–3009.
12. Giang, D.K. & Cravatt, B.F. (1998) A second mammalian
N-myristoyltransferase. J. Biol. Chem. 273, 6595–6598.
13. Johnson, D.R., Bhatnagar, R.S., Knoll, L.J. & Gordon, J.I. (1994)
Genetic and biochemical studies of protein N-myristoylation.
Annu. Rev. Biochem. 63, 869–914.
14. Towler, D.A., Adams, S.P., Eubanks, S.R., Towery, D.S., Jack-
son-Machelski, E., Glaser, L. & Gordon, J.I. (1988) Myristoyl
CoA: protein N-myristoyltransferase activities from rat liver and
yeast possess overlapping yet distinct peptide substrate specifi-

cities. J. Biol. Chem. 263, 1784–1790.
15. Rocque, W.J., McWherter, C.A., Wood, D.C. & Gordon, J.I.
(1993) A comparative analysis of the kinetic mechanism and
peptide substrate specificity of human and Saccharomyces cerevi-
siae myristoyl-CoA: protein N-myristoyltransferase. J. Biol.
Chem. 268, 9964–9971.
16. McWherter, C.A., Rocque, W.J., Zupec, M.E., Freeman, S.K.,
Brown, D.L., Devadas, B., Getman, D.P., Sikorski, J.A. &
Gordon, J.I. (1997) Scanning alanine mutagenesis and de-
peptidization of a Candida albicans myristoyl-CoA: protein
N-myristoyltransferase octapeptide substrate reveals three
elements critical for molecular recognition. J. Biol. Chem. 272,
11874–11880.
17. Boisson, B., Giglione, C. & Meinnel, T. (2003) Unexpected protein
families including cell defense components feature in the N-myr-
istoylome of a higher eukaryote. J. Biol. Chem. 278, 43418–43429.
18. Palmiter, R.D., Gagnon, J. & Walsh, K.A. (1978) Ovalbumin: a
secreted protein without a transient hydrophobic leader sequence.
Proc.NatlAcad.Sci.USA75, 94–98.
19. Dailey, T.A. & Dailey, H.A. (1996) Human protoporphyrinogen
oxidase: expression, purification, and characterization of the
cloned enzyme. Protein Sci. 5, 98–105.
20. Mayer, A., Siegel, N.R., Schwartz, A.L. & Ciechanover, A. (1989)
Degradation of proteins with acetylated amino termini by the
ubiquitin system. Science 244, 1480–1483.
21. Kimura, Y., Takaoka, M., Tanaka, S., Sassa, H., Tanaka, K.,
Polevoda, B., Sherman, F. & Hirano, H. (2000) N (alpha)-acety-
Ó FEBS 2004 Analysis of the N-myristoylation consensus motif (Eur. J. Biochem. 271) 873
lation and proteolytic activity of the yeast 20 S proteasome. J. Biol.
Chem. 275, 4635–4639.

22. Lee,F.J.,Lin,L.W.&Smith,J.A.(1990)Modelpeptidesreveal
specificity of N alpha-acetyltransferase from Saccharomyces cere-
visiae. J. Biol. Chem. 265, 11576–11580.
23. Bradshaw, R., Brickey, W. & Walker, K. (1998) N-terminal pro-
cessing: the methionine aminopeptidase and N alpha-acetyl-
transferase families. Trends Biochem. Sci. 23, 263–267.
24. Polevoda, B. & Sherman, F. (2003) N-Terminal acetyltransferases
and sequence requirements for N-terminal acetylation. J. Mol.
Biol. 325, 595–622.
25. Utsumi, T., Sato, M., Nakano, K., Takemura, D., Iwata, H. &
Ishisaka, R. (2001) Amino acid residue penultimate to the amino-
terminal Gly residue strongly affects two cotranslational protein
modifications, N-myristoylation and N-acetylation. J. Biol. Chem.
276, 10505–10513.
26. Umigai, N., Sato, Y., Mizutani, A., Utsumi, T., Sakaguchi, M. &
Uozumi, N. (2003) Topogenesis of two transmembrane type K
+
channels, Kir 2.1 and KcsA. J. Biol. Chem. 278, 40373–40384.
27. Deichaite, I., Casson, L.P., Ling, H.P. & Resh, M.D. (1988)
In vitro synthesis of pp60v-src: myristoylation in a cell-free system.
Mol. Cell. Biol. 8, 4295–4301.
28. Utsumi, T., Akimaru, K., Kawabata, Z., Levitan, A., Tokunaga,
T., Tang, P., Ide, A., Hung, M C. & Klostergaad, J. (1995)
Human pro-tumor necrosis factor: molecular determinants of
membrane translocation, sorting, and maturation. Mol. Cell. Biol.
15, 6389–6405.
29. Utsumi, T., Kuranami, J., Tou, E., Ide, A., Akimaru, K., Hung,
M.C. & Klostergaard, J. (1996) In vitro synthesis of an
N-myristoylated fusion protein that binds to the liposomal sur-
face. Arch. Biochem. Biophys. 326, 179–184.

30. Sanger, F., Nicklen, S. & Coulson, A.R. (1977) DNA sequencing
with chain-terminating inhibitors. Proc. Natl Acad. Sci. USA 74,
5463–5467.
31. Utsumi, T., Levitan, A., Hung, M C. & Klostergaad, J. (1993)
Effects of truncation of human pro-tumor necrosis factor trans-
membrane domain on cellular targeting. J. Biol. Chem. 268,
9511–9516.
32. Utsumi, T., Tou, E., Takemura, D., Ishisaka, R., Yabuki, M. &
Iwata, H. (1998) Met-Gly-Cys motif from G-protein alpha sub-
unit cannot direct palmitoylation when fused to heterologous
protein. Arch. Biochem. Biophys. 349, 216–224.
33. Maurer-Stroh, S., Eisenhaber, B. & Eisenhaber, F. (2002)
N-terminal N-myristoylation of proteins: refinement of the
sequence motif and its taxon-specific differences. J. Mol. Biol. 317,
523–540.
34. Farazi, T.A., Waksman, G. & Gordon, J.I. (2001) Structures of
Saccharomyces cerevisiae N-myristoyltransferase with bound
myristoylCoA and peptide provide insights about substrate
recognition and catalysis. Biochemistry 40, 6335–6343.
35. Farazi, T.A., Manchester, J.K., Waksman, G. & Gordon, J.I.
(2001) Pre-steady-state kinetic studies of Saccharomyces cerevisiae
myristoyl-CoA: protein N-myristoyltransferase mutants identify
residues involved in catalysis. Biochemistry 40, 9177–9186.
36. Maurer-Stroh, S., Eisenhaber, B. & Eisenhaber, F. (2002)
N-terminal N-myristoylation of proteins: prediction of subs-
trate proteins from amino acid sequence. J. Mol. Biol. 317,
541–557.
874 T. Utsumi et al. (Eur. J. Biochem. 271) Ó FEBS 2004