Báo cáo Y học: The trans-sialidase from the African trypanosome Trypanosoma brucei potx

The
trans
-sialidase from the African trypanosome
Trypanosoma brucei
Georgina Montagna
1
, M. Laura Cremona
1
, Gasto
´
n Paris
1
, M. Fernanda Amaya
2
, Alejandro Buschiazzo
2
,
Pedro M. Alzari
2
and Alberto C. C. Frasch
1
1
Instituto de Investigaciones Biotecnolo
´
gicas – Instituto Tecnolo
´
gico de Chascomu
´
s, Consejo Nacional de Investigaciones
Cientı
´

ficas y Te
´
cnicas, Universidad Nacional de General San Martı
´
n, Provincia de Buenos Aires, Argentina;
2
Unite
´
de Biochimie Structurale, CNRS URA 2185, Institut Pasteur, Paris, France
Trypanosoma brucei is the cause of the diseases known as
sleeping sickness in humans (T. brucei ssp. gambiense and
ssp. rhodesiense) and ngana in domestic animals (T. brucei
brucei) in Africa. Procyclic trypomastigotes, the tsetse vector
stage, express a surface-bound trans-sialidase that transfers
sialic acid to the glycosylphosphatidylinositol anchor of
procyclin, a surface glycoprotein covering the parasite sur-
face. Trans-sialidase is a unique enzyme expressed by a few
trypanosomatids that allows them to scavenge sialic acid
from sialylated compounds present in the infected host. The
only enzyme extensively characterized is that of the Ameri-
can trypanosome T. cruzi (TcTS). In this work we identified
and characterized the gene encoding the trans-sialidase from
T. brucei brucei (TbTS). TbTS genes are present at a small
copy number, at variance with American trypanosomes
where a large gene family is present. The recombinant TbTS
protein has both sialidase and trans-sialidase activity, but it is
about 10 times more efficient in transferring than in hydro-
lysing sialic acid. Its N-terminus contains a region of 372
amino acids that is 45% identical to the catalytic domain of
TcTS and contains the relevant residues required for cata-

lysis. The enzymatic activity of mutants at key positions
involved in the transfer reaction revealed that the catalytic
sites of TcTS and TbTS are likely to be similar, but are not
identical. As in the case of TcTS and TrSA, the substitution
of a conserved tryptophanyl residue changed the substrate
specificity rendering a mutant protein capable of hydrolysing
both a-(2,3) and a-(2,6)-linked sialoconjugates.
Keywords: trans-sialidase; sialidase; T. brucei; procyclic
trypomastigotes.
African trypanosomiasis has re-emerged as a major health
threat, with an epidemic resulting in more than 100 000 new
infections per year. With 300 000 cases officially reported,
human trypanosomiasis, or sleeping sickness caused by
Trypanosoma brucei ssp. gambiense and ssp. rhodesiense,has
now returned to the epidemic levels of the 1930s in many
historic foci across Africa. T. brucei ssp. brucei causes the
Ôngana diseaseÕ in domestic animals, which can reduce food
production as much as 50%. The parasite, which lives and
multiplies in the blood of the infected host, eludes the
immune system by consecutively expressing structurally
different forms of variant surface glycoproteins (VSG) [1].
The VSG coat from the bloodstream form is replaced by the
invariant procyclin surface coat of the procyclic insect stage
when entering the tsetse insect vector (Glossina sp.) These
procyclins are a small family of very similar acid repetitive
proteins [2,3] that might protect procyclic cells from
digestion by the digestive enzymes in the fly [4].
Unable to synthesize sialic acids, trypanosomes use a
specific enzyme, the trans-sialidase, to scavenge the mono-
saccharide from host glycoconjugates and to sialylate

acceptor molecules present on the surface of parasite plasma
membrane [5]. Indeed, the presence of trans-sialidase
activity is unique to a few trypanosomes, being absent in
all other cell types tested so far. Trans-sialidase is a modified
sialidase that instead of hydrolysing sialic acid, transfers the
monosaccharide to another sugar moiety. The only trans-
sialidase extensively studied is the one from Trypanosoma
cruzi (TcTS). The enzyme is involved in sequestering sialic
acid from sialoglycoconjugates present in the blood and
other tissues in the infected vertebrate host. The sialic acid is
transferred to terminal galactoses present in mucins, highly
O-glycosylated proteins that cover the parasite surface [5].
Sialylated mucins have been suggested to be involved in
invasion of the mammalian host cells and in protection
against complement lysis [6–8].
In T. cruzi and T. rangeli (arelatedAmericanparasite
which only displays sialidase activity), trypanosomal
sialidases are encoded by a multigenic family [9,10]. In
T. cruzi, there are about 140 genes, half of them encoding
proteins that display enzymatic activity. The other mem-
bers code for proteins lacking activity due to a mutation
Correspondence to Instituto de Investigaciones Biotecnolo
´
gicas,
Universidad Nacional de General San Martı
´
n, INTI,
Avemida. Gral Paz s/n, Edificio 24, Casilla de Correo 30,
1650 San Martı
´

n, Pcia de Buenos Aires, Argentina.
Fax: + 54 11 4752 9639, Tel.: + 54 11 4580 7255,
E-mail:
Abbreviations:TrSA,T. rangeli sialidase; TcTS, T. cruzi
trans-sialidase; TbTS, T. brucei trans-sialidase; VSG,
variant surface glycoproteins; IMAC, iminodiacetic
acid metal affinity chromatography; MUNen5Ac, 2¢-(4-methylum-
belliferyl)-a-
D
-N-acetylneuraminic acid; 3¢SL, sialyl-a-(2,3)-lactose;
6¢SL, sialyl-a-(2,6)-lactose; GSS, Genome Sequence Survey.
(Received 10 January 2002, revised 26 April 2002,
accepted 30 April 2001)
Eur. J. Biochem. 269, 2941–2950 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.02968.x
Y342H [11]. The overall structure of the TcTS comprises
an N-terminal globular region of 642 amino acids carrying
the catalytic activity (see below), followed by a C-terminal
extension of tandemly repeated sequences named SAPA
(shed acute phase antigen) that are not required for the
enzymatic activity. SAPA is highly antigenic and is
involved in the stabilization of the enzymatic activity once
released in the blood of the infected host [12]. Members in
the sialidase family of T. rangeli (TrSA) are about 70%
identicaltoTcTS[13],andsomeofthemalsolack
enzymatic activity.
The crystal structures of several microbial sialidases
have been determined. They share a similar catalytic
domain that displays a typical six-bladed b propeller
topology originally observed in influenza virus sialidase
[14]. Some sialidases are multidomain proteins and include

one or more noncatalytic domains, which may be involved
in carbohydrate recognition, as for the enzymes from
Vibrio cholerae [15] and Micromonospora viridifaciens [16].
The three-dimensional structure of TrSA [17] showed that
trypanosomal enzymes fold into two distinct structural
domains: the b propeller catalytic domain and a tightly
associated C-terminal domain with the characteristic
b barrel topology of plant lectins. These crystallographic
studies also showed that they share a similar active site
architecture, where several amino-acid residues critical for
enzyme function, are strictly conserved. In T. cruzi and
T. rangeli, a conserved tryptophan residue (W313) was
recently shown to be implicated in the binding of the
substrate and to be determinant for the specificity for
a-(2,3) linkages [18]. Other residues in the surrounding of
the active site differ when the structures of sialidase and
trans-sialidase are compared. In particular, two residues
from TcTS, Y119 and P284, were found to be critical for
the transfer reaction and were proposed to modulate the
substrate-binding cleft, providing trans-sialidase with the
capacity for transferring the monosaccharide.
We report here the first gene coding for a trans-sialidase
belonging to African trypanosomes. The deduced trans-
sialidase protein sequence is only 38% similar to the trans-
sialidase of T. cruzi, but conserves all the amino-acid
residues that are relevant for the enzymatic activity. Single
point mutation at critical positions, revealed distinct
features between trans-sialidase active sites in American
and African trypanosomes.
EXPERIMENTAL PROCEDURES

Trypanosomes
Procyclic forms of T. brucei brucei stock EATRO427 were
cultivated axenically in SDM-79 as described previously
[19]. The strain was kindly provided by F. R. Opperdoes
(Christian de Duve Institute of Cellular Pathology, Brussels,
Belgium).
Nucleic acid isolation
Total DNA from culture procyclic forms was isolated using
a conventional proteinase K/phenol/chloroform method as
described previously [20]. Total RNA was purified using
TRIzol reagent following manufacturer’s instructions (Life
Technologies Inc.).
Southern blot analysis
Total DNA was digested with the indicated restriction
enzymes and 2.5 lg of the sample per line was electro-
phoresed in 0.8% agarose gel and transferred for Southern
blot on Zeta-Probe nylon membranes (Bio-Rad) as des-
cribed previously [20].
PCR radiolabeling of probes was performed by substi-
tuting the nonradioactive dCTP by 30 lCi of [a-
32
P]dCTP
in a 30-cycle primer extension reaction after optimization of
thetemplateandMgCl
2
concentration. The TbTS probe
was made with oligonucleotide FRIP (5¢-ATAAGG
TAGAGCGCACTGTGCA-3¢) using clone TbTS digested
with EcoRV as template. Probe TbTS-like was made from
clone pGEM-TbTS-like using oligonucleotide (5¢-CTT

GCTAGCCTCTGCAGCCGACAT-3¢). The filters were
hybridized with the probes described using hybridization
solution containing 0.5
M
NaH
2
PO
4
,7%SDS,1m
M
EDTA and 1% BSA, at 62 °C.
Cloning of
trans
-sialidase genes
PCR was carried out using Vent DNA Polymerase (New
England Biolabs) on 100 ng of parasite DNA. PCR
primers contained restriction enzymes sites to facilitate the
subsequent cloning steps in the expression vector. For
TbTS the primers were as follows: AminoMet (5¢-AT
GGAGGAACTCCACCAACAAAT-3¢, forward) and
STOP (5¢-TAT
AGATCTTCAAATCGCCAACACATA
CAT-3¢, reverse, underlined is the BglII restriction site).
For TbTS-like: TbTSIIamino (5¢-CTT
GCTAGCATG
CGCGTTGTATACCAG-3¢, forward, underlined is the
NheI restriction site) and TbTSIIStop (5¢-AG
AGATCT
AGAACGCGTGGTCTGC-3¢, reverse, underlined is the
BglII restriction site). Primer sequences for TbTS were

obtained from Genome Sequence Survey (GSS) AQ661000
for AminoMet and AQ656761 for STOP. Primers for
TbTS-like were obtained from a BAC clone: AC009463,
which contains the complete ORF. The PCR products
were cloned on pGEM-T Easy vector following the
A-tailing procedure. The clones were called pGEM-TbTS
and pGEM-TbTSlike. These clones were used as template
for automated (AbiPrism) or manual (dideoxy-chain
termination method with Sequenase-USB) sequencing or
for subcloning in the expression vector.
Cloning of TbTS 5¢ UTR
First strand cDNA was prepared with the Superscript II
system using an internal primer (5¢-TGAAAATCAACAG
CAGTCTC-3¢) that binds to position 58–40 of TbTS ORF.
RT-PCR was carried out with the primers for T. brucei
mini-exon as forward (5¢-AACGCTATTATTAGAACA
GTTTCTGTACT-3¢) and the one used for first strand
synthesis as reverse, using Vent DNA polymerase. The
product was cloned into pGEM-T Easy vector after
A-tailing and sequenced using the dideoxy-chain termin-
ation method with Sequenase (USB).
Site-directed mutagenesis
Site directed point mutagenesis was performed using the
QuikChange Site-directed mutagenesis kit (Stratagene),
2942 G. Montagna et al. (Eur. J. Biochem. 269) Ó FEBS 2002
according to the manufacturer’s instructions. All clones
were sequenced to confirm mutation of target sites.
Expression of
trans
-sialidase genes in bacteria

and protein purification
The plasmid containing the complete ORF of the TbTS
(pGEM-TbTS) was cut with EcoRI and the DNA fragment
corresponding to TbTS gene was ligated into the expression
vector pTrcHisC (Invitrogen). The His-tag encoded in the
plasmid vector was used to purify the recombinant protein.
A TbTS construct starting at the codon for leucine 28 was
obtained by PCR on the pGEM-TbTS plasmid using the
followings primers: LTSK (5¢-TAT
GCTAGCTTGACT
TCCAAGGCTGCGG-3¢, forward, underlined is the NheI
restriction site) and STOP (see above). After digestion with
the corresponding restriction enzymes, the fragment was
ligated to pTrcHisC vector. A similar procedure was carried
out for TbTS-like gene, but the PCR reaction was
performed using pGEM-TbTS-like as template and the
followings primers: TbTSIILCS (5¢-CTT
GCTAGCCTC
TGCAGCCGACAT-3¢, forward, underlined is the NheI
restriction site) and TbTSIIcarboxi (5¢-TAG
AGATCTTA
CATAAATAGGGAATA-3¢, reverse, underlined is the
BglII restriction site). The constructs were introduced in
E. coli BL21 (DE3) pLysS cells by the calcium chloride
method. Overnight cultures were diluted 1 : 50 in Terrific
Broth and grown at 37 °CuptoD
600
0.8–1.0, with constant
agitation at 250 r.p.m. Bacteria were induced to over
express recombinant protein by adding 0.5 m

M
isopropyl
thio-b-
D
-galactoside (Sigma) and induction was maintained
at 18 °C for 12–16 h. Cells were harvested, washed with
NaCl/Tris (20 m
M
Tris/HCl pH 7.6 and 50 m
M
NaCl) and
frozen ()80 °C) until needed. After thawing, lysis was
carried out in the presence of 20 m
M
Tris/HCl pH 7.6,
30 m
M
NaCl,0.5%TritonX-100,1m
M
phenyl-
methylsulfonyl fluoride, 100 lgÆmL
)1
DNAse I. Superna-
tants were centrifuged at 21 000 g for 30 min and subjected
to iminodiacetic acid metal affinity chromatography
(IMAC) (HiTrap Chelating, Amersham Pharmacia Biotech
AB) Ni
2+
-charged equilibrated in 20 m
M

Pipes pH 6.9 and
0.5
M
NaCl (buffer IMAC). The column was washed with
30 m
M
imidazole in buffer IMAC. Elution was achieved
using a linear gradient 30–250 m
M
imidazole in buffer
IMAC. The activity peak was pooled, dialyzed against
20 m
M
Bistris pH 7.4 and further purified by FPLC anion
exchange (Mono Q) equilibrated with the same buffer. The
protein was eluted by applying a linear gradient of
0–250 m
M
trisodium citrate. Purified proteins were analysed
by SDS/PAGE under reducing conditions, stained with
Coomasie Blue R250, and quantitated with Kodak 1
D
3.0
software using purified BSA as standard.
Enzyme activity assays
Enzyme activity assays were carried out using the purified
proteins as described in the previous section. Neuraminidase
activity was determined by measuring the fluorescence of
4-methylumbelliferone released by the hydrolysis of
0.2 m

M
2¢-(4-methylumbelliferyl)-a-
D
-N-acetylneuraminic
acid (MUNen5Ac, Sigma). The assay was performed in
50 lLin20m
M
Pipes pH 6.9. After incubation at 35 °C,
the reaction was stopped by dilution in 0.2
M
sodium
carbonate pH 10, and fluorescence was measured with a
DYNAQuant
TM
200 fluorometer (Hoefer Pharmacia Inc).
Trans-sialidase activity was measured in 20 m
M
Pipes
pH 6.9, using 1 m
M
Neu5Ac-a-(2–3) lactose as sialic acid
donor and 12 l
M
[
D
-glucose-1-
14
C]lactose (55 mCiÆmmol
)1
)

(Amersham) as acceptor, in 30 lL final volume at 35 °C.
The reaction was stopped by dilution, and sialyl-[
14
C]lactose
was quantitated with a b-scintillation counter as described
previously [21]. Suitable modifications were made to the
standard reaction to obtain the kinetic constants.
MUNen5Ac is an unspecific substrate and it does not allow
a distinction between hydrolysis of a-(2,3)- and a-(2,6)-
linked sialic acid. Therefore, in order to determine the
substrate specificity of wild-type and mutant proteins,
sialidase activity was measured using sialyl-a-(2,3)-lactose
(3¢SL) or sialyl-a-(2,6)-lactose (6¢SL) as substrates. Quanti-
tation of 3¢SL and 6¢SL hydrolysis was carried out by the
thiobarbituric method [22]. Predefined quantities of wild-
type or mutant proteins were incubated with 0.5 m
M
of
either 3¢SL or 6¢SL and 50 m
M
Hepes pH 7.0, in a final
volume of 20 lLfor30minat35°C. The enzymatic
reactions were stopped by adding 15 lLof25m
M
NaIO
4
solution prepared in 125 m
M
sulfuric acid solution. The
mixtures were vortexed and allowed to react in a water bath

at 37 °C for 30 min. Samples were then neutralized with
13 lL of sodium arsenite 2% w/v in HCl (0.5 N) by slow
addition of the reactive. Tubes were gently vortexed to
complete the reduction reaction. After the total disappear-
ance of yellow colour (5 min) 152 lL of thiobarbituric acid
(36 m
M
, pH 9.0) were added and then incubated in a boiling
water bath for 15 min Samples were then cooled in an ice-
water bath for 5 min, followed by room-temperature colour
stabilization. The samples were centrifuged, and 20 lLwere
separated by high-performance liquid chromatography
through a C
18
reverse phase column (Pharmacia Biotech)
using 2 : 3 : 5 water/methanol/buffer (buffer: 0.2% phos-
phoric acid; 0.23
M
sodium perchlorate). Absorbance was
measured at 549 nm. A sialic acid calibration curve was
previously set, and absorbance values were always read in
the linear range.
RESULTS
The
T. brucei trans
-sialidase primary sequence
conserves most of the structurally relevant amino-acid
residues of bacterial and protozoan sialidases
BLAST
searches were performed using sequences corres-

ponding to the catalytic domain of TcTS (L26499, a
member of family I of T. cruzi trans-sialidase/sialidase
superfamily [23]) on the T. brucei Genome Project Database
(Sanger Centre). The search identified six GSSs with a
BLAST
E value between 2.6 · 10
)36
and 0.73. When assembled,
these fragments built up an open reading frame of 2316 bp.
Because various sialidase amino-acid motifs such as FRIP
and Asp box motifs were conserved in the deduced
sequence, this open reading frame might code for a T. brucei
sialidase-related protein. These data were used to design
oligonucleotides for the amplification by PCR on genomic
DNA to clone the gene coding for the complete TbTS.
Eleven genes from independent PCRs were sequenced and
organized into eight different groups according to their
nucleotide sequence (Fig. 1). The differences among genes
Ó FEBS 2002 The trans-sialidase of African trypanosomes (Eur. J. Biochem. 269) 2943
seem not to be randomly distributed, but rather, localized at
nine positions. Combinations of mutations at these nine
positions generated eight genes having from one to five
differences. Five out of the nine differences are in the first
and second codon positions, giving rise to a high proportion
of nonconservative mutations. Most of the differences
(seven out of nine) are located in the catalytic domain (see
below), but they are placed at positions irrelevant for the
enzymatic activity because the corresponding recombinant
proteins displayed both sialidase and trans-sialidase activity
(see next section). The deduced primary structure of the

protein coded by these genes showed that TbTS is organized
into three putative regions (Fig. 2). An N-terminal region of
100 amino acids, which is absent in TcTS, a middle region of
372 amino acids, which is 45% identical to the catalytic
domain of the T. cruzi enzyme and a C-terminal region of
298 amino acids followed by an hydrophobic region likely
to correspond to a GPI-anchor signal. TbTS is probably
anchored by GPI to the surface membrane since native
procyclic trans-sialidase can be released from the parasite by
treatment with phospholipase D [24]. The 298 amino acids
in the C-terminal domain are 30% identical to the TcTS
lectin-like domain. TbTS does not have a repetitive domain
at the C-terminus that is homologous to the T. cruzi SAPA
domain.
The catalytic region revealed the conservation of most of
the structurally relevant residues displayed in bacterial and
protozoan sialidases and trans-sialidases (Fig. 2), such as an
arginine triad that binds to the carboxylate group common
to all the sialic acid derivatives (R133, R346, R431), a
glutamic acid (E473) that stabilizes one of the arginine side
chains, a negatively charged group (D157) proposed as a
possible proton donor in the hydrolytic reaction and two
essential residues at the bottom of the site (E331, Y457),
which are well positioned to stabilize a putative sialosyl
cation intermediate [25]. This tyrosine residue was found to
be a determinant for the catalytic activity of TcTS [11]
The comparison of the crystal structure of TrSA with the
homologous model of TcTS reveals a few amino acid
changes close to the substrate-binding cleft that might
modulate the sialyltransferase activity [17]. Most of these

critical substitutions observed at the periphery of the cleft in
TcTS are conserved in the deduced primary sequence of
TbTS, including an aromatic residue (Y120 in TcTS) that
was found to have a crucial role in the transfer reaction [17].
TbTS also conserves an exposed aromatic side chain (W400)
that favours, in the case of microbial sialidases and trans-
sialidases, the high specificity for sialyl-a-(2,3) substrates
[18]. The TbTS genes present partially conserved the
subterminal VTVxNVfLYNR motif (VIVRNVLLYHR
in T. brucei) that in the case of T. cruzi, defines the
trypanosome trans-sialidase/sialidase superfamily of surface
proteins [26]. It has been recently shown that this sequence is
involved in host cell binding during T. cruzi infection
process [27].
Expression and properties of
T. brucei
recombinant
trans-sialidase
The entire ORF starting at the codon for the first
methionine was identified by sequencing the 5¢ UTR of
TbTS mRNA. A construct expressed from the codon for
this first methionine produced a protein of approximately
84.4 kDa that lacked sialidase and trans-sialidase activities
(data not shown). An analysis of the putative start of the
mature protein N-terminus using the
IPSORT
program
(Human Genome Center, Institute of Medical Sciences,
University of Tokio), predicted the existence of a signal
peptide that ends just before leucine 28. The insert was then

designed to have this amino acid at position +1. The new
construct, which includes an N-terminal extension of 10
amino acids expressing a His-tag, codes for a 745 amino-
acidproteinwithapredictedmolecularmassof81.4kDa
and displaying both sialidase and trans-sialidase activity
(data not shown). All further work was performed with this
protein. To perform kinetic studies, the protein was purified
Fig. 2. Comparison of protein structure and sequence between TbTS and
TcTS. (A) Primary structure of TbTS and TcTS. The positions of the
FRIP, Asp boxes and TcTS superfamily motifs are underlined.
(B) Amino-acid sequence of the conserved region of the catalytic do-
main of TbTS and TcTS. The FRIP and the Asp boxes are underlined.
The identity in amino acids between the two primary sequences are
indicated with vertical bars and the boxes highlight the residues involved
in the catalytic centre of the sialidases of known crystal structure.
Fig. 1. Differences among TbTS clones. Eleven clones of TbTS were
sequenced and analysed. They could be classified in eight distinct
groups with differences in only nine positions. The nucleotide changes
in the triplet sequence are indicated (uppercase). The mutations that
cause amino-acid changes are boxed.
2944 G. Montagna et al. (Eur. J. Biochem. 269) Ó FEBS 2002
through passage on a iminodiacetic acid metal affinity
column followed by FPLC anionic exchange (see Experi-
mental procedures for details). After the anionic exchange
column, the protein was > 95% pure (Fig. 3). MUNen5Ac
was used as substrate to assay for sialidase activity, and a
mix of Neu5Ac-a-(2,3) and Neu5Ac-a-(2,6)-lactose as sialic
acid donor and lactose as acceptor for the trans-sialidase
activity (Fig. 3). The affinity for sialyl-lactose as substrate of
TbTS (2.27 m

M
) and TcTS (4.3 m
M
) were similar, as it
was the turnover of both enzymes (apparent V
max
for
sialyl-lactose is 51 161 nmolÆmin
)1
Æmg
)1
for TbTS and
32 692 nmolÆmin
)1
Æmg
)1
) for TcTS (Fig. 3; [18]). As in the
case of T. cruzi trans-sialidase [18], TbTS behaves as a very
efficient sialyl-transferase: in excess of both the donor and
acceptor substrates, the enzyme is 11.1 times more efficient
in transferring than hydrolysing donor sialic acid, as can be
concluded by comparing the V
max
of the hydrolysis and
transference activities (Fig. 3). We have also measured the
trans-sialidase-sialidase activity ratio in the native T. brucei
brucei enzyme from procyclic forms, as described under
Experimental procedures. This ratio was 8.9. Thus, there is a
good agreement between values obtained with the recom-
binant and native enzymes.

Point mutations at critical amino-acid residues
revealed features of the catalytic site of African
trypanosomes
trans
-sialidase
Based on the crystal structure of TrSA [17], mutants of
TbTS at key positions involved in substrate binding and
specificity were constructed and characterized. These
mutants include (see Fig. 4A) the exposed aromatic side
chain that favours the sialyl-a-(2,3) substrate specificity
(W400 in TbTS mature protein), a tyrosine residue sugges-
ted to be part of a second carbohydrate-binding site in the
catalytic cleft (Y191 in TbTS), a proline residue that was
found to increase the sialidase activity in TrSA (P371 in
TbTS) and a tyrosine residue that is well positioned to
stabilize a putative sialosyl cation intermediate (Y430 in
TbTS) [17].
The mutant proteins were produced and purified with the
same criteria described for the wild-type in the previous
section. As shown in Fig. 4B, mutations at positions 371
and 430 of TbTS completely abolished both sialidase and
II
AB
I
1/v (nmol sialic acid
-1
.min.mg) x 10
-3
1/S (mM
-1

)
5.0
4.0
3.0
2.0
1.0
0
510152025
Km: 1.2mM
Vmax: 4582 nmol.
min
-1
.mg
-1
2.5
2.0
1.5
1.0
0.5
0 2.0 4.0
6.0
1/v (nmol sialic acid
-1
.min.mg) × 10
-3
1/S (mM
-1
)
Km: 2.27 mM
Vmax: 51161 nmol.

min
-1
.mg
-1
78
0
10
20
Elution (mL)
250
0
Citrate (mM)
kDa
78 91011
66
97.4
45
Absorbance 280 nm
91011
Fractions
Fractions
Fig. 3. Purification of recombinant TbTS pro-
tein. (A) TbTS protein was purified by anion-
exchange chromatography (Mono Q) after
IMAC chelating column. The elution profile
of Mono Q is shown. Fractions were collected
and analysed by SDS/PAGE as indicated in
Experimental procedures. (B) Lineweaver–
Burk plots of sialidase and trans-sialidase
activities. I, the sialidase activity was measured

varying the concentrations of MUNen5Ac as
sialic acid donor (see Experimental proce-
dures). II, the trans-sialidase activity was
measured using sialyl-a-(2,3)-lactose and lac-
tose as the sialic acid donor and acceptor
substrates, respectively. The apparent con-
stants were obtained using lactose fixed con-
centration of 2 m
M
and varying the
concentration of the sialyl lactose according to
the experiment. Data are the mean of three
independent experiments.
Catalytic domain
Lectin-like
domain
TcTS
TbTS
1
642
119 283
312
342
YTWY
372
1
73
743
191
Y

371
400
430
TWY
461
TbTS wild type 8074.33 ± 691.52 (100) 100 933.8 ± 60.78 (100) 100
TbTS Y430-H
0000
TbTS T371-Q
0000
TbTS Y191-S
0 0.6 0 12.8
TbTS W400-A
00 0104.29 ± 8.3 (11.2)
trans-sialidase activity TcTS
a
b
TcTSsialidase activity
A
B
Fig. 4. Site-directed mutagenesis on TbTS. (A) Relative positions of
the site-directed mutagenesis on TbTS refer to the relevant amino acids
for trans-sialidase activity on TcTS. (B) Recombinant proteins were
expressed and purified as indicated in Experimental procedures.
Sialidase activity was measured using MUNen5Ac as substrate and
trans-sialidase activity was measured using sialyl-a-(2,3)-lactose and
lactose as the sialic acid donor and acceptor, respectively. Activities are
expressed as nmol sialic acid per min per mg (free sialic acid for sia-
lidase activity; amount of sialic acid transferred to lactose for trans-
sialidase acitivity). The percentage of activity referred to wild-type

controls is indicated in parenthesis. The values are the mean and
standard deviation of three independent determinations. The per-
centage of trans-sialidase (
a
) and sialidase (
b
) activity of TcTS referred
to wild-type controls.
Ó FEBS 2002 The trans-sialidase of African trypanosomes (Eur. J. Biochem. 269) 2945
trans-sialidase activities, as in TcTS. The change of the
aromatic side chain (W400 A) that in the case of TrSA and
TcTS lost the capability of hydrolysing MUNen5Ac [18],
retained 11.6% of the sialidase activity when MUNen5Ac is
used as substrate (Fig. 4B). The mutation at Y191S
suppressed both activities, at variance with the American
trypanosome trans-sialidase, where the substitution of Y120
practically abolishes the sialyltransferase activity while
preserving some of the sialidase activity [17,18]. The
differences observed in the effect of the mutations at these
positions could arise from distinct organizations of the
catalytic sites of both trans-sialidases.
The trans-sialylation activity of TbTS W400A was lost as
in TcTS W312A mutant (Fig. 4 and [18]), thus indicating
that the transfer, but not the hydrolysis reaction requires a
precise orientation of the bound substrate in both enzymes.
The exposed tryptophan residue in TcTS and TrSA
determined the high specificity of these enzymes towards
sialyl-a-(2,3) substrates [18], which could be explained by
unfavourable interactions of this aromatic side-chain with
sialyl-a-(2,6)-linked oligosaccharides. To test if this is also

the case of TbTS, the mutant protein W400A was obtained
and assayed for activity using sialyl-a-(2,3)-lactose (3¢SL)
and sialyl-a-(2,6)-lactose (6¢SL). The mutated enzyme was
now capable of hydrolysing the a-(2,6) regioisomer, losing
the strict specificity of the wild-type enzyme for the sialyl-
a-(2,3) substrate (Fig. 5).
The active sites of the
T. brucei
and
T. cruzi trans
-sialidases are highly conserved
As expected from their similar function and common
evolutionary origin, critical active site residues are largely
conserved in all trypanosomal sialidases and trans-siali-
dases. The 3D structure of the T. rangeli sialidase bound to
2,3-didehydro-2-deoxy-N-acetylneuraminic acid (Neu2-
en5Ac, a sialidase inhibitor) [17] showed 33 amino acids
that are positioned close to the inhibitor. They have at least
one atom at less than 7 A
˚
from Neu2en5Ac. Among these
positions, 26 amino acids (79%) are conserved between
TcTS and TbTS, 24 (73%) are conserved between TbTS
and TrSA, and 22 (67%) are conserved between TcTS and
TrSA. These relative similarities differ significantly from
those found when comparing the entire catalytic domains
(Fig. 4), thus revealing a functional constraint on the
evolution of trans-sialidases.
All amino-acid residues that have been found to be
important for the function in other viral and bacterial

sialidases, are also conserved in the three trypanosomal
enzymes(showninblueinFig.6):theargininetriad(R36,
R246 and R315, TrSA numbering) that binds the carboxy-
late group of sialic acid; the aspartic acid residue (D60) that
could serve as the proton donor in the reaction; and two
residues (E231, Y343) that probably serve to stabilize the
transition state intermediate. Other amino-acid residues
conserved in the active site of the three trypanosomal
enzymes (but not necessarily in other sialidases) include R54
and D97, whose side chains make hydrogen bonding
interactions with the bound inhibitor; W121, L(I)177 and
Q196, all of which are part of the pocket that binds the
N-acetyl group of sialic acid; D248 and E358, whose
carboxylate groups make hydrogen bonds with two arginine
side-chains of the triad; and W313 and Y365, are both
favourably positioned to interact with the substrate.
Of particular interest are seven positions that are
invariant in the two trans-sialidases (T. brucei and T. cruzi),
but differ in TrSA (shown in red in Fig. 6), suggesting that
they could be important for transglycosylation activity. Two
of these have been previously shown to be critical for trans-
sialidase activity, namely TrSA S120 and Q284, substituted,
respectively, by tyrosine and proline residues in the two
trans-sialidases [17,18,28]. The presence of a tyrosine residue
at position 120 was shown to be critical for TcTS activity
[17], probably because this aromatic side-chain residue is
involved in substrate binding. Also, the conservation of a
sequence PGS at positions 284–286 of both trans-sialidases
(substituted by the sequence QDC in TrSA, see Fig. 6)
confirm previous findings of Smith & Eichinger [28], who

studied the role of these residues using exchange mutagen-
Fig. 5. Activity of 3¢SL and 6¢SL hydrolysis of the amino-acid substi-
tution W400-A on TbTS. Sialidase activity of TbTS W400A mutant
protein was measured using sialyl-a-(2,3)-lactose (3¢SL) and sialyl-
a-(2,6)-lactose (6¢SL) as sialic acid donor substrates as described in
Experimental procedures.
Fig. 6. Amino-acid positions close to the inhibitor Neu2en5Ac (shown in
yellow) in the crystal structure of TrSA-Neu2en5Ac complex [17].
Amino-acid side-chains shown in blue are strictly conserved in
microbial sialidases, those shown in green are invariant in three
trypanosomal enzymes (TrSA, TcTS and TbTS), and those shown in
redareconservedinthetwotrypanosomaltrans-sialidases, but differ in
TrSA, and could be important for transglycosylation (see text).
2946 G. Montagna et al. (Eur. J. Biochem. 269) Ó FEBS 2002
esis between TrSA and TcTS. Along similar lines, Paris
et al. [18] demonstrated that the substitution Q284-P in
TrSA increased significantly the hydrolytic activity of the
enzyme. The three other positions in the neighbourhood of
the active site that differ between trypanosomal sialidase
and trans-sialidase are M96, F114 and V180 in TrSA,
substituted by valine, tyrosine and alanine residues in the
trans-sialidases, respectively (Fig. 6). Although it is difficult
to assess the functional role of these substitutions in the
absence of a crystal structure for trans-sialidase, they could
contribute to modulation of specific protein–sialic acid
interactions, which are important for the transfer reaction to
occur.
Genomic organization of TbTS genes
Southern blot analysis of total DNA from T. brucei brucei
strain probed with the catalytic region of the genes showed

that TbTS genes are present in a small copy number (Fig. 7),
a situation that is different from American trypanosomes
where the trans-sialidase family genes comprises at least 140
members. Regarding the results obtained with enzymes that
cut at least once on each gene unit (BssHII, EcoRV and
HindIII, Fig. 7A, panel I), a minimum of two trans-
sialidase-related genes can be estimated from the Southern
blot analysis. It is likely that the TbTS genes are organized in
tandem, as previous evidence from cloning and sequencing
(see Fig. 1) suggested that several copies may exist.
A
BLAST
search on the T. brucei Genome Project
Database using the fragment corresponding to the putative
catalytic domain of TbTS identified a BAC clone with a
BLAST
E value of 6 · 10
)45
that showed 30% similarity with
TbTS. We decided then to analyse the presence of
TS-related genes on the genome of T. brucei,becausein
American trypanosomes these genes are abundantly repre-
sented in the parasite genome [5]. We designed primers
based on the sequence of the BAC clone and performed a
PCR on genomic DNA. These PCR resulted in a gene of
2109 bp that was called TbTS-like. The deduced primary
sequence showed a partial conservation of the typical
sialidase motifs (FRIP and Asp box), and the absence of the
residues shown to be important for activity in the three-
dimensional structure of bacterial and protozoan sialidases

and trans-sialidases (data not shown). Southern blot
analysis with a probe corresponding to the central part of
this gene (Fig. 7B) demonstrated that it is present in
one copy in T. brucei (Fig. 7A, panel II). We analysed
TbTS-like gene with the
IPSORT
program to subcloning and
tested its product for enzymatic activity. As expected, the
new construct coded for a protein of 703 amino acids
that displayed no sialidase/trans-sialidase activity when
expressed in bacteria (Fig. 7B).
DISCUSSION
We are describing for the first time the gene coding for an
active trans-sialidase of the African trypanosome Trypan-
osoma brucei brucei. Both sialidase and trans-sialidase
activities are mediated by the same protein, encoded by
the gene identified here. The trans-sialidase in African
trypanosomes is expressed in the procyclic form, the stage of
the parasite that replicates in the tsetse fly midgut. Procyclic
forms are characterized by the synthesis of a surface coat
composed of procyclins (otherwise known as procyclic acid
repetitive protein). Each cell is covered by approximately six
million procyclin molecules [29] that are attached to the
surface membrane by GPI anchors [4]. It has been shown
that isolated de-sialylated procyclin can be sialylated by
culture-purified trans-sialidase [30]. The unusual GPI
anchor of procyclin was known to contain five sialic acid
molecules on its structure, but it might be sialylated in
regions other than the GPI anchor, because the number of
sialic acid residues is about 10 per procyclin molecule [31].

The function of procyclins is unknown, although they
contribute to the establishment of strong infections in the fly
vector. Parasites that have no surface procyclin because of a
defect in GPI synthesis are less efficient at establishing
infection in flies [32]. Impairment of this process offers a
possibility for controlling vector parasitemia (see below).
Extensive work has been carried out on the molecu-
larbiology, biochemistry and structure of the surface
EcoRI
KpnI
SacII
BssHII
EcoRV
HindIII
EcoRI
KpnI
SacII
BssHII
EcoRV
9.4
23.1
6.6
4.4
kpb
A
I
II
2.3
2.0
SxDxGxTW

FRIP
VIVxNVLLYNR
1
100 472 770
TbTS
LTIxNAMLYNR
5/5 4/5 4/5
2/5 2/5 3/5
YRSP
683
1
TbTS like
B
30% similarity
TbTs probe
TbTs like
p
robe
Fig. 7. Southern blot analysis of TbTS and TbTS-like. (A) Genomic
DNA of T. brucei digested with the indicated restriction enzymes,
hybridized with a TbTS probe (I) and TbTS-like probe (II). The filter
was washed at 65 °Cin0.1 · NaCl/Cit, 0.1% SDS. As controls, maize
DNA digested with EcoR1 and T. cruzi DNA digested with PstIwere
used. (B) Schematic representation of primary sequence of TbTS and
TbTS-like. Catalytic (open box) and lectin-like domains (shaded box)
are shown. The differences in FRIP, Asp boxes and trans-sialidase
superfamily motifs are also indicated. Dark bars indicate the position
of the region used as probe for Southern blot analysis.
Ó FEBS 2002 The trans-sialidase of African trypanosomes (Eur. J. Biochem. 269) 2947
trans-sialidase of American trypanosome T. cruzi (reviewed

in [5]), the agent of Chagas’ disease. Both American and
African trans-sialidases are developmentally regulated sur-
face glycoproteins [24,34]. They share a number of features
that are unusual for the rest of microbial sialidases, such as a
neutral optimum pH (6.9 for T. brucei,7.2forT. cruzi), the
independence of divalent cations, a relative resistance
towards the natural sialidase inhibitor Neu2en5Ac and the
same substrate specificity [24,33]. In spite of not being
closely related in their overall primary structure, TbTS
conserves most of the amino acids relevant for the catalytic
site of American trans-sialidase. The identity increases up to
45% in the region corresponding to the catalytic domain,
but TbTS contains an extra region of 100 amino acids
towards its N-terminal end. In its C-terminal region, the
identity falls to 30% relative to the lectin-like domain of
American trans-sialidase. The trans-sialidasegeneproducts
of T. cruzi and T. brucei have a significant degree of
structural and biochemical similarity to the sialidases found
in bacteria and viruses (Fig. 8). The comparison of inferred
gene trees with species trees made by alignment of the
nucleotide and predicted amino-acid sequences of sialidases
and trans-sialidase suggested that the genes encoding the
T. cruzi trans-sialidase of mammalian forms might be
derived from genes expressed in the insect forms of the
genus Trypanosoma [35]. It was recently demonstrated by
analysis of DNA sequences from 62 different species of this
genus that there is evidence for a common ancestor for
T. cruzi and T. brucei around 100 million years ago [36], an
ancestor that could have carried the primitive trans-sialidase
gene.

The identity in the catalytic region of the two enzymes led
us to investigate whether the same architecture of the active
site is likely to be shared by both enzymes. There is growing
evidence suggesting the existence of distinct donor- and
acceptor-binding sites to account for the sialyl-transferase
activity of T. cruzi enzyme, supported by recent crystallo-
graphic data of enzyme–substrate analog complexes. An
inhibitor contacting residue (Y119) and a shallow depres-
sion (formed by P283, Y248 and W312) are favourably
positioned in the T. cruzi enzyme to be involved in binding
the acceptor molecule. P284 has been shown to be one of the
essential amino-acid residues for trans-sialylation, as a
TrSA-TcTS chimerical molecule displaying only sialidase
activity was able to trans-sialylate after mutation of Q284 to
a proline residue [28]. The mutation of the homologous
residue, P371Q, seems to induce the same effect on the
structure of the active site of African trans-sialidase.
Our previous results on the T. cruzi enzyme indicate a
crucial role for Y119 in binding the acceptor carbohydrate,
since the single substitution YfiS strongly affects the
transfer/hydrolysis ratio towards a more efficient hydrolase,
while the inverse substitution in TrSA retains a significant
sialidase activity [17]. The substitution of the homologous
residue in TbTS, Y191, causes a dramatic effect on this
enzyme, abolishing both sialidase and trans-sialidase activ-
ities. Many microbial sialidases, such as the enzymes from
Vibrio cholerae and influenza virus can cleave a-(2,3), a-(2,6)
and even a-(2,8)-linked sialic acid conjugates [14,37]. Both
trypanosome sialidase and trans-sialidases, as well as
Salmonella typhimurium (StSA) [25] and Macrobdella decora

[38] sialidases, display a high specificity for a-(2,3)-linked
sialic acid conjugates. We have demonstrated that a
conserved tryptophan residue in American trypanosome
sialidase and trans-sialidase is directly involved in the
binding of sialic acid donor substrates, as the single point
mutant W fi A allowed a looser accommodation of the
donor substrate, broadening their substrate specificity [18].
On the other hand, a significant decrease of hydrolytic
activity against the fluorogenic substrate MUNen5Ac was
shown in the case of T. cruzi: hydrolysis was undetectable in
the TcTS mutant. In TbTS mutant, the activity falls 10-fold
relative to the activity of the wild-type towards this
substrate.
It has been shown recently that the lectin-like domain of a
trans-sialidase-related protein is involved in host cell binding
activity during the T. cruzi cell invasion process [27,39]. The
binding site to cytokeratin 18 colocalizes with the trans-
sialidase/sialidase superfamily motif (VTVxNVfLYNR)
[27]. Because this motif is conserved in TbTS, it is possible
that a cell binding activity in the lectin-like domain of TbTS
could play a role in T. brucei infection in tsetse flies.
Efforts to develop inhibitors based on the structure are
currently being made for the trans-sialidase of American
trypomastigoteTcTS
procyclic form TbTS
StSA
SxDxGxTW
FRIP
Trypanosoma
epimastigoteTrSA

bacteria
catalytic domain
lectin-like
domain
lectin-like
domain (wing-2)
lectin-like
domain (wing-1)
VcSA
44 %
43 %
27%
23 %
31 %
33 %
Fig. 8. Structural similarity between sialidases and trans-sialidases of different origins. Comparison of the primary structures of the different domains
(catalytic in light grey bars, lectin-like in black bars) of sialidases and trans-sialidases from trypanosomes (TrSA, T. rangeli sialidase GenBank
accession number U83180; TcTS, T. cruzi trans-sialidase, L26499; TbTS, T. brucei trans-sialidase, AF310232) and sialidases of bacterial origin
(StSA, Salmonella typhimurium sialidase, M55342; VcNA, Vibrio cholerae neuraminidase, M83562). Numbers indicate the percentage of identity.
The developmental stage where the proteins are present, in the case of Trypanosoma species, is indicated on the left. The consensus Asp-box
sequence and FRIP motif are shown with vertical bars.
2948 G. Montagna et al. (Eur. J. Biochem. 269) Ó FEBS 2002
trypanosomes as new alternatives for chemotherapy. These
compounds are needed urgently, because the available drugs
are only effective in 50% of the acute infections and their
usefulness for parasitological cure in chronic infections is
controversial [40,41]. Since the first years of the 20th
century, human and animal trypanosomiasis have been
recognized as a cause of morbidity and mortality through-
out sub-Saharan Africa and a major constraint on the use of

livestock. There has been extensive international collabor-
ation and considerable expenditure on mechanisms to
control the disease and its vector [42]. Given the limited
range and effectiveness of the drugs available as resistance
has emerged, modulating tsetse vector infection appears to
be an important strategy in reducing the incidence of this
disease. Major advances being made by molecular biologi-
cal and genomic research will eventually lead to the
development of new approaches to control disease trans-
mission by insect vectors. Although not demonstrated here,
trans-sialidase might have a relevant function for the
survival of T. brucei inthetsetsevector.Infact,thesame
enzymatic activity has a relevant function for the survival of
T. cruzi. Furthermore, the gene encoding this enzyme might
have been generated millions of years ago and have been
conserved, probably as a result of its important function.
Further work will demonstrate if TbTS is indeed an
essential enzyme for the parasite. If so, treatment of cows
with a putative inhibitor could be used to prevent infection
in the tsetse fly and its dissemination. A similar approach to
that proposed by vaccination in Plasmodium infections, the
so-called transmission blocking malaria vaccines [43].
ACKNOWLEDGEMENTS
We would like to thank Graciela Gotz for revising the manuscript. This
work was supported by grants from the World Bank/UNDP/WHO
Special Program for Research and Training in Tropical Diseases
(TDR), ECOS-SeCyT (France-Argentina), the Human Frontiers
Science Program, the Institut Pasteur and the Agencia Nacional de
Promocio
´

nCientı
´
fica y Tecnolo
´
gica, Argentina. The research from
ACCF was supported in part by an International Research Scholars
Grant from the Howard Hughes Medical Institute and a fellowship
from the John Simon Guggenheim Memorial Foundation.
REFERENCES
1. Borst, P. & Ulbert, S. (2001) Control of VSG gene expression sites.
Mol. Biochem. Parasitol. 114, 17–27.
2. Mowatt, M.R., Wisdom, G.S. & Clayton, C.E. (1989) Variation of
tandem repeats in the developmentally regulated procyclic acidic
repetitive proteins of Trypanosoma brucei. Mol. Cell. Biol. 9, 1332–
1335.
3. Roditi, I., Schwarz, H., Pearson, T.W., Beecroft, R.P., Liu, M.K.,
Richardson, J.P., Buhring, H.J., Pleiss, J., Bulow, R., Williams,
R.O.& et al. (1989) Procyclin gene expression and loss of the
variant surface glycoprotein during differentiation of Trypanoso-
ma brucei. J. Cell. Biol. 108, 737–746.
4. Ferguson, M.A., Murray, P., Rutherford, H. & McConville, M.J.
(1993) A simple purification of procyclic acidic repetitive protein
and demonstration of a sialylated glycosyl-phosphatidylinositol
membrane anchor. Biochem. J. 291, 51–55.
5. Frasch, A.C. (2000) Functional diversity in the trans-sialidase and
mucin families in Trypanosoma cruzi. Parasitol. Today 16,
282–286.
6. Tomlinson, S. & Raper, J. (1998) Natural immunity to trypano-
somes. Parasitol. Today 14, 354–359.
7. Schenkman, S., Jiang, M.S., Hart, G.W. & Nussenzweig, V. (1991)

A novel cell surface trans-sialidase of Trypanosoma cruzi generates
a stage-specific epitope required for invasion of mammalian cells.
Cell 65, 1117–1125.
8. Schenkman, S. & Eichinger, D. (1993) Trypanosoma cruzi trans-
sialidase and cell invasion. Parasitol. Today 9, 218–225.
9. Buschiazzo,A.,Campetella,O.&Frasch,A.C.(1997)Trypano-
soma rangeli sialidase: cloning, expression and similarity to T. cruzi
trans-sialidase. Glycobiology 7, 1167–1173.
10. Cremona, M.L., Campetella, O., Sanchez, D.O. & Frasch, A.C.
(1999) Enzymically inactive members of the trans-sialidase family
from Trypanosoma cruzi display beta-galactose binding activity.
Glycobiology 9, 581–587.
11. Cremona, M.L., Sanchez, D.O., Frasch, A.C. & Campetella, O.
(1995) A single tyrosine differentiates active and inactive Trypa-
nosoma cruzi trans-sialidases. Gene 160, 123–128.
12. Buscaglia, C.A., Alfonso, J., Campetella, O. & Frasch, A.C. (1999)
Tandem amino acid repeats from Trypanosoma cruzi shed anti-
gens increase the half-life of proteins in blood. Blood 93, 2025–
2032.
13. Buschiazzo, A., Cremona, M.L., Campetella, O., Frasch, A.C. &
Sanchez, D.O. (1993) Sequence of a Trypanosoma rangeli gene
closely related to Trypanosoma cruzi trans-sialidase. Mol. Bio-
chem. Parasitol. 62, 115–116.
14. Colman, P.M., Varghese, J.N. & Laver, W.G. (1983) Structure of
the catalytic and antigenic sites in influenza virus neuraminidase.
Nature 303, 41–44.
15. Crennell, S., Garman, E., Laver, G., Vimr, E. & Taylor, G. (1994)
Crystal structure of Vibrio cholerae neuraminidase reveals dual
lectin- like domains in addition to the catalytic domain. Structure
2, 535–544.

16. Gaskell, A., Crennell, S. & Taylor, G. (1995) The three domains of
a bacterial sialidase: a beta-propeller, an immunoglobulin module
and a galactose-binding jelly-roll. Structure 3, 1197–1205.
17. Buschiazzo, A., Tavares, G.A., Campetella, O., Spinelli, S.,
Cremona, M.L., Paris, G., Amaya, M.F., Frasch, A.C. & Alzari,
P.M. (2000) Structural basis of sialyltransferase activity in trypa-
nosomal sialidases. EMBO J. 19, 16–24.
18. Paris, G., Cremona, M.L., Amaya, M.F., Buschiazzo, A.,
Giambiagi, S., Frasch, A.C. & Alzari, P.M. (2001) Probing
molecular function of trypanosomal sialidases: single point
mutations can change substrate specificity and increase hydrolytic
activity. Glycobiology 11, 305–311.
19. Brun, R. & Schonenberger, M. (1979) Cultivation and in vitro
cloning or procyclic culture forms of Trypanosoma brucei.asemi-
defined medium. Acta Trop. 36, 289–292.
20. Sambrook, J., Fritsch, E.F. & Maniatis, T. (1989) Molecular
Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor
Laboratory, Cold Spring Harbor, NY.
21. Buschiazzo, A., Frasch, A.C. & Campetella, O. (1996) Medium
scale production and purification to homogeneity of a
recombinant trans-sialidase from Trypanosoma cruzi. Cell. Mol.
Biol. (Noisy-le-Grand) 42, 703–710.
22. Romero, E.L., Pardo, M.F., Porro, S. & Alonso, S. (1997) Sialic
acid measurement by a modified Aminoff method: a time-saving
reduction in 2-thiobarbituric acid concentration. J. Biochem.
Biophys. Methods 35, 129–134.
23. Campetella, O., Sa
´
nchez,D.,Cazzulo,J.J.&Frasch,A.C.C.
(1992) A superfamily of Trypanosoma cruzi surface antigens.

Parasitol. Today 8, 378–381.
24. Engstler, M., Reuter, G. & Schauer, R. (1992) Purification and
characterization of a novel sialidase found in procyclic culture
forms of Trypanosoma brucei. Mol. Biochem. Parasitol. 54, 21–30.
25. Crennell, S.J., Garman, E.F., Laver, W.G., Vimr, E.R. & Taylor,
G.L. (1993) Crystal structure of a bacterial sialidase (from
Salmonella typhimurium LT2) shows the same fold as an influenza
virus neuraminidase. Proc. Natl Acad. Sci. USA 90, 9852–9856.
Ó FEBS 2002 The trans-sialidase of African trypanosomes (Eur. J. Biochem. 269) 2949
26. Cross, G.A. & Takle, G.B. (1993) The surface trans-sialidase
family of Trypanosoma cruzi. Annu. Rev. Microbiol. 47, 385–411.
27. Magdesian, M.H., Giordano, R., Ulrich, H., Juliano, M.A.,
Juliano, M., Schumacher, R.I., Colli, W. & Alves, M.J.M. (2001)
Infection by Trypanosoma cruzi. Identification of a parasite ligand
and its host cell receptor. J. Biol. Chem. 276, 19382–19389.
28. Smith, L.E. & Eichinger, D. (1997) Directed mutagenesis of the
Trypanosoma cruzi trans-sialidase enzyme identifies two domains
involved in its sialyltransferase activity. Glycobiology 7, 445–451.
29. Pays, E. & Nolan, D.P. (1998) Expression and function of surface
proteins in Trypanosoma brucei. Mol. Biochem. Parasitol. 91, 3–36.
30. Engstler, M., Reuter, G. & Schauer, R. (1993) The devel-
opmentally regulated trans-sialidase from Trypanosoma brucei
sialylates the procyclic acidic repetitive protein. Mol. Biochem.
Parasitol. 61, 1–13.
31. Pontes de Carvalho, L.C., Tomlinson, S., Vandekerckhove, F.,
Bienen, E.J., Clarkson, A.B., Jiang, M.S., Hart, G.W. &
Nussenzweig, V. (1993) Characterization of a novel trans-sialidase
of Trypanosoma brucei procyclic trypomastigotes and identifica-
tion of procyclin as the main sialic acid acceptor. J. Exp. Med. 177,
465–474.

32. Nagamune, K., Nozaki, T., Maeda, Y., Ohishi, K., Fukuma, T.,
Hara,T.,Schwarz,R.T.,Sutterlin,C.,Brun,R.,Riezman,H.&
Kinoshita, T. (2000) Critical roles of glycosylphosphatidylinositol
for Trypanosoma brucei. Proc. Natl Acad. Sci. USA 97, 10336–
10341.
33. Ferrero-Garcia, M.A., Trombetta, S.E., Sanchez, D.O., Reglero,
A., Frasch, A.C. & Parodi, A.J. (1993) The action of Trypanosoma
cruzi trans-sialidase on glycolipids and glycoproteins. Eur. J.
Biochem. 213, 765–771.
34. Affranchino, J.L., Pollevick, G.D. & Frasch, A.C. (1991) The
expression of the major shed Trypanosoma cruzi antigen results
from the developmentally-regulated transcription of a small gene
family. FEBS Lett. 280, 316–320.
35. Briones, M.R., Egima, C.M., Eichinger, D. & Schenkman, S.
(1995) Trans sialidase genes expressed in mammalian forms of
Trypanosoma cruzi evolved from ancestor genes expressed in insect
forms of the parasite. J. Mol. Evol. 41, 120–131.
36. Gibson, W. (2001) Sex and evolution in trypanosomes. Int. J.
Parasitol. 31, 643–647.
37. Taylor, G., Vimr, E., Garman, E. & Laver, G. (1992) Purification,
crystallization and preliminary crystallographic study of neur-
aminidase from Vibrio cholerae and Salmonella typhimurium LT2.
J. Mol. Biol. 226, 1287–1290.
38. Luo, Y., Li, S.C., Chou, M.Y., Li, Y.T. & Luo, M. (1998) The
crystal structure of an intramolecular trans-sialidase with a NeuAc
alpha2 fi 3Gal specificity. Structure 6, 521–530.
39. Villalta, F., Smith, C.M., Ruiz-Ruano, A. & Lima, M.F. (2001) A
ligand that Trypanosoma cruzi uses to bind to mammalian cells to
initiate infection. FEBS Lett. 505, 383–388.
40. Keiser, J., Stich, A. & Burri, C. (2001) New drugs for the treatment

of human African trypanosomiasis: research and development.
Trends Parasitol. 17, 42–49.
41. Geerts, S., Holmes, P.H., Eisler, M.C. & Diall, O. (2001) African
bovine trypanosomiasis: the problem of drug resistance. Trends
Parasitol. 17, 25–28.
42. Allsopp, R. (2001) Options for vector control against trypano-
somiasis in Africa. Trends Parasitol. 17, 15–19.
43. Carter, R. (2001) Transmission blocking malaria vaccines. Vaccine
19, 2309–2314.
2950 G. Montagna et al. (Eur. J. Biochem. 269) Ó FEBS 2002