Nhân dòng, biểu hiện và nghiên cứu một số tính chất của protease từ HIV 1 tại việt nam


-1




i hc Khoa hc T nhiên
  ngành: ; 62.42.30.15
, 
 2011

Abstract: --
-
mã hóa protease HIV-
--rình

-
HIV--
     
protease HIV-

Keywords: ; ; HIV; Gen mã hóa protease; 
Nam

Content


1.
-

-1 (protease

HIV-1)  thành các  
protease HIV-
Tuy nhiên, 
-1. 
protease l  nâng  
HIV-1/AIDS.
Hin nay, trên th giu công trình nghiên cu sn xut protease HIV-1 (Darke
, 1989; 





, 1989; 





, 1996; 





,
2000; 






, 2003; 





, 2005; 





, 2008)
c t cho thy vic biu hin và thu nhn protease HIV-1 không d dàng do c tính
c t bào, khó tan ca nó. Mt khác, c-1 phân
, Australia 

2
Âu. -
óm HIV-
 .
protease HIV-1 
                  

HIV-

2. Mc tiêu nghiên cu c tài
- Phát hin mt s t bin trong gen mã hóa protease HIV-1  i Vit Nam.

- Thit lp quy trình hiu qu cho vic biu hin gen mã hóa protease HIV-1  vi
khun E. coli và tinh sch protease HIV-1 tái t hp  dng có hot tính.
- Nghiên cu mt s tính cht protease HIV-1 và tìm hiu tác dng ca mt s cht c ch
  tìm kim và phát trin các PI mi có th ng dng u tr bnh nhân
HIV/AIDS.
3. Ni dung nghiên cu c tài
- Tinh sch RNA và tng hp cDNA ca mt s mu HIV-1 t các bnh nhân nhim HIV-
1 ti Vit Nam.
- Nhân bc trình t gen mã hóa protease HIV-1 ca các mu virus phân
l sai khác v trình t gen mã hóa protease HIV-1 ging
bnh nhân nhim HIV-1 so vi trình t ng trên th gii.
- Thit k h thu kin biu hin gen mã hóa cho protease HIV-1
 E. coli.
- Xây dng quy trình tinh sch protease HIV-1 tái t hp.
- Nghiên cu mt s a protease tái t hc.
- Tìm hiu tác dng c ch ca mt s hp cht tng hp và t nhiên lên protease HIV-1
tái t hp.
i c tài
- Công trình nghiên cu có tính h thng t vic nhân bn, nhân dòng và biu hin  E.
coli gen mã hóa protease HIV-1 tái t hp thuc chng CRF01_AE ca Vit Nam; thit
l       tinh sch protease HIV-1 vi hiu sut thu nhn
i các nghiên cu trên th gii.
- u tiên phát hin thy tác dng c ch protease HIV-1 bi axit asiatic, 8-
hydroxyquinoline và menadione.

- -
                 
protease tái t hp khó tan và ch c hiu vi mt s t nhnh.

3

- C-1   
có  HIV/AIDS.

 124 :  - 39
- 16 - 
50 1 trang. 
.  13 107 
3  ). 



7 41 



.

C 
1.1. HIV-

-1 và HIV-2,





1.2. Các nghiê-1
Protease HIV-pol -
               


phân các polypeptide gag, gag-pol và env 
-
 (, 1989; Tie, 2006)
protease HIV-
-
 xut hin các chng virus kháng thuc là mt trong nhng nguyên nhân chính gây tht
bu tr. -

-
 Escherichia coli (E. coli) Saccharomyces cerevisiae 
 -1
(





, 1989; Danley
 , 1989; 





, 1992; 






, 1996; 





,
1997; 





, 2008). Nguyên nhân là do 

. Protease HIV-
 Pro 

4
(





, 1987; Graves , 1988; 






,
1989; 





, 1992; 





, 1994).
-
Australia, Tây Âu 

 các
- (





, 2003; 







, 2005; 





, 2005; 





, 2008)

cho các phân nhóm khác.
-protease HIV-1

(





, 2003; 






, 2009; 






, 2009; 





, 2010)
ngh--

 
công (





, 2007)
-







Gen mã hóa protease HIV--1  


     Invitrogen       
polymerase  New England Biolabs (NEB)  , các vector
 Promega, 

Novagene 
protease HIV-1 và protease HIV-1 tái t Anaspec  
protease HIV- 


2.2.1. 
 theo Sambrook và Russel (2001)
 
 sóng 280 nm

5
2.2.4. 





-1 




-PCR

2.2.6. 



 
-T
2.2.7. -1 trên 8000






(1975)
2.2.8. 



 ,
T4 E.
coli.
2.2.9. 

-1 








-
mono Q-sepharose
2.2.10. 


(SDS-PAGE)
2.2.11. -1 










(Western blotting) -1 

2.2.12. 



-1 s







(1990)
--1


3.1.  -1
--
- 

Gen mã hóa protease HIV-
-F1/HIV-R1 và
-F2/HIV-
-1. 
HIV-F1/HIV-R1 (





, 1996)
HIV-F2/HIV-R2 HIV-F1/HIV-R1  297 bp
mã hóa cho protease HIV -1 (


 94
o

o

C trong 60

o
C trong 30 giây. 1,5  1 
khuôn cho PCR vòng 2.  


53
o
C.

 -  tính
-1 và 24 

cho protease HIV-1.

6

-1
-PCR t  
protease HIV--
nhân

() 

19 

            , JF276388,
JF276389, JF276390, JF276391, HQ890881 và JF276392. so sánh 
-v -1 Stanford
()  HIV-
   G16E, E35D, M36I, R41K, H69K, V82I, L89M, I13V, I15V và

-1 làm c PI). H

-
 G16E, E35D, R41K,
V82I, L89M, I13V, I15V -1 phân nhóm CRF01_AE
 
Hình 3.1. -
-

1: t
2: s  -    -)


3, 4: s-
-1

7
protease
HIV-1-1 phân

ase HIV-
tipranavir/r-

HIV-
3.2. -1 trong E. coli
Gen mã hóa protease HIV-1 HQ317454 trên 
 E. coli. 
-1 phân nhóm CRF01_AE.
3.2.1. 







 -
-E. coli 
-HIV-(Debouck
 , 1987; Graves  , 1988; 




 

, 1989; 





,
1992; 





, 1994). Tuy nhiên, Leuthardt và Roesel (1993) 
công protease HIV- và -3H;
h

 -  E. coli BL21
(DE3) pLysS. Gen mã hóa protease HIV-   
Ndel và Eco E. coli 
-
 -   và   
-0,25 mM 
o
Tris HCl 20 mM pH 7,9, NaCl
 n 
Ni-   
- kháng

protease HIV-1 (hình 3.8             
         -      
-
-1, 
--1 bi
protease HIV--






8

Hình 3.8. SDS-
Ni-agarose

1

     , 2

       
plysS mang pET28a-Prot-agarose; 2B:
      
mang pET28a--Prot
-






 (1992) thì
-

-
3.2.2. 




 -

-
thioredoxin (TRX) trong pE
GTVSFNF) protein gag vào
-
 protease HIV-1 -Pro trên gag-
phóng protease HIV-  rình t mi xuôi HIV-F3 cho PCR vì vc
thit k l




A B

9
A B

Trong mc HIV-R3 có trình t ct gii hn ca Xho
HIV-1 vào pET32a và pET43a ti v u C ca protease s c dung hp vi 6xHis
c b ba kt thúc dch mã. Theo thit k này, nu protease dung hp không có hot
tính t ct ti liên kt Phe-Pro; protease tái t hp to ra s có dng TRX-GTVSFNF-
protease-6xHis trên vector pET32a vi KLPT là 31 kDa và NusA-GTVSFNF-protease-6xHis
trên vector pET43a vi KLPT là 67 kDa. Nu protease tái t hp t ct (ti v trí Phe-Pro), thì
c gii phóng ra dng gn vi 6xHis và có KLPT khong 12 kDa. Vic
ging thi khnh enzyme có hot tính.
Sau khi gen mã hóa protease HIV-         
pET32a-Prot) và pET43a (pET43a- 
E. coli 
LB 

 -HCl 20 mM
C).












Hình 3.14. SDS-BL21 (DE3)
plysS mang pET32a-

BL21 (DE3) plysS mang pET43a-Prot
1A và 5BBL21 (DE3) pLysS mang pET43a-Prot; 2A và 4B
bào BL21 (DE3) pLysS mang pET43a-Prot; 3 A và 1B: t4A
và 2B bào BL21 (DE3) pLysS mang pET32a-Prot; 5A, 3B: 
BL21 (DE3) pLysS mang pET32a-Prot
Kt qu SDS-PAGE và thm tách min dch (hình 3.14) cho thy có s xut hi
protein vi KLPT khon ta t bào E. coli BL21 (DE3) plysS mang
pET32a--
Prot-1. Các

10
-
E. coli

E. coli 
Roesel,

-
 và (Taylor
 , 1992; 





, 1996)
E. coli -
                
protease HIV-1.













Hình 3.15A. SDS-n sc ký
qua ct His-bind ca protease HIV-1 biu hin

trong h thng pET32a-Prot
1: thang chun protein nhum sn; 2: dch hòa ta
t bào BL21 (DE3) pLysS mang pET32a-Prot; 3:
n không gn ct His-bind; n
ra ct His-bind; 5: n ra chit ct His-
bind



Hình 3.16. Hot tính ct tng hp ca
protease HIV  1 tái t hp

(): Proti (Anaspec); ():
Protease HIV-1 tái t hp; (): Protease HIV-
1 tái t hp + pepstatin A, (): Protease HIV  1
tái t h lý nhit 95
o
C, 5 phút
 gel His-
2+

-agarose). -PAGE (hình 3.15A
-  
-  
khác. -1 trong phân
--

11
m tra hot tính ca ch phm protease HIV-1 tái t hc
c tinh sch bng ct His-bind, kt qu c  hình 3.16 cho thy protease HIV-1

c có kh t tng hp (làm gi 
enzyme b c ch bi pepstatin A ging -i và b
mt hot tính xúc tác khi x lý nhit  95
o
C trong 5 phút.
- 
protease
HIV-1 còn . u này buc chúng tôi mt
ln na phn vic ci tin h thng biu hi nâng cao hiu sut biu hin và kh
ch protease HIV-1.
-E. coli BL21
(DE3) RIL
 
            -   
  ch protease HIV-  
Ngoài 
--

protease HIV-
-R4 và HIV--R3 
protease HIV-
HIV-R- GAGTCCTCGAGAGCGTAATCTGGAACATCGTATGGGTA
XhoI HA (Hemagglutinin)
AAAATTTAAAGTGCAGCCAATCTG-
HIV-- GAGTCCTCGAGAGCGTAATCTGGAACATCGTATGGGTA
XhoI HA
TCCCTGAAA ATACAGGTTTTC
TEV
AAAATTTAAAGTGCAGCCAATCTG-
       

-
-Protease-HA-6xHis, Protease-TEV-HA-
    -HA-6xHis, Protease-TEV-HA-    
         -HA-6xHis và Protease-TEV-HA-6xHis có
KLPT 


 

E. coli BL21 (DE3) RI E. coli BL21 (DE3) RIL
mang pET32a-Prot-HA, pET32a-Prot-TEV-HA hay pET43a-Prot-HA, pET43a-Prot-TEV-

12
c nuôi cc cm ng biu hin gen bng IPTG 0,25 mM. Kt qu kim tra
m 

 n gen protease HIV-1 (hình 3.19) cho thy 
--
E. coli mang pET32a-Prot-HA.
y, h thng pET32a biu hin protease HIV-1 t so vi pET43a và vic b sung
thêm trình t 9 axit amin ca HA tu C cn hot tính t ct
cng thng biu hin c Mt khác, khi có thêm trình t
ct ca TEV protease có l nh n hiu qu biu hin ca Prot-TEV-HA trên c hai
h thng pET32a và pET43a.
 các kt qu c va chn dch hòa ta t
bào E. coli BL21 (DE3) RIL mang pET32a-Prot-HA c thu nhn ch phm protease
HIV-1 tinh sch.

Hình 3.19. SDS-             
protease HIV-1 trong h thng vector pET32a và pET43a ci tin
mang pET43a-Prot-TEV-HA; mang pET43a-Prot-TEV-
HA; mang pET43a-Prot-HA; mang pET43a-Prot-HA; 5:
 mang pET32a-Prot-TEV-HA; 7: 
mang pET32a-Prot-TEV-HA; mang pET32a-Prot-HA; 
mang pET32a-Prot-HA


3.2.4. Xây dng quy trình tinh sch protease HIV-1
 u loi b bt các protein không mong muc khi hòa tan các protein
trong ta t bào bm C, ta t bào E. coli mang pET32a-Prot-c ra bng m
Tris-HCl 20 mM pH 7,9 có urea 1M và Triton X-100 1% m B) tinh sch hoàn toàn
protease HIV- dng ci anion mnh mono Q-sepharose mc ni tip
vi ct ái lc His-bind m C n protein không
gn vi gel mono Q-c cho ngay lên ct His-bind; các protein gn vi gel
A B

13
A B
mono Q-c ra chit bm C vi gradient n NaCl 100- 1000 mM; các

protein gn vi gel His-c ra chit bm C có imidazol 250 mM.













Hình 3.23. SDS--
sepharose và His-bind
; E. coli BL21 (DE3) RIL mang pET32a-
Prot-HA; -sepharose; 4-5: 

-
; 6: p-bind; 

 -bind
Kt qu n di (hình 3.23A) cho thy E. coli
BL21 (DE3) RIL mang pET32a-Prot-c loi b nhiu protein không mong mun,
a protease HIV-1, còn có mprotein KLPT khong
gm nét và mt s  protein rt m khác.Tu kin bin tính vi nng
 urea 8M, pH 7,9; protease HIV-1 hoàn toàn không gn gel mono Q-sepharose, nh t
s protein không mong muc gi li  cn không gn vi gel mono Q-
sepharose khi qua ct His-c ra chit bm C có cha imidazol 250 mM ch

cho mt vi KLPT khong 13 kDa trên SDS-c
nhn ra bi kháng th -1 (hình 3.23B). Kt qu phân tích khi
ph MALDI-TOF-TOF (dn liu không nêu  mt ln na khnh protein 13 kDa tinh
sch -1.
Protein HIV-m
C 
n hành  ch phm protease HIV-1 tái t hp sau hm
mn di có SDS và -mercaptoethanol (-m không có SDS và -
n di m có SDS. Kt qu c  hình 3.24 cho
thc  m có SDS và -ME ch phm protease HIV-c ch cho mt
t 13 kDa u kim  không có SDS và -ME thì ch phm
     3 kDa và m    u này chng t s tn ti dng
homodimer trong ch phc. S có mu  không có SDS và
-ME có th m ch n di cha SDS nên mt phn d 
thành t dng dimer, ngoài ra, có th c hch) ca chúng tôi
 làm cho tt c dng monomer chuyn thành dng dimer. Protease HIV-c

14
B
A
hc kim tra hot tính thy phân 
3.25 nh protease HIV-
Tóm lng thành công quy trình tinh sch hoàn toàn protease HIV-1
gn: i) ra ta t m Tris-HCl 20 mM, pH 7,9 có NaCl 100 mM,
urea 1M và Triton X-100 1%; ii) sc ký qua ct mono Q-sepharose và ct His-bind mc ni
tip, ra chit enzyme bám trên ct His-bind bm có cha imidazol 250 mM. Vi quy
trình này ch cn mc hi tính protease HIV-1 nên tit kim thi gian và không làm mt
protease HIV-1 qua các khâu trung gian.
Kt qu tính toán ca chúng tôi cho thy t 100 ml dch nuôi cy t bào E. coli
BL21 (DE3) RIL mang pET32a-Prot-c 1,38 g sinh khi t bào, 23

mg protein tng s trong dch hòa ta t c tinh sch và hi tính thu hc
3,4 mg protease HIV-1 hoàn toàn tinh s


-E. coli  (1992) 
-100 mg
protease HIV-
  -               
protease HIV-














Hình 3.24. SDS-
HIV-
 2:
protease HIV- 3:
protease HIV-

Hình 3.25.   c  t tng hp ca
protease HIV-1 tái t h   ch. ():
Protease HIV-1 tái t hp, (): Protease HIV-1 tái
t hp + pepstatin A, (): Protease HIV  1 tái t
h lý nhit.
3.3. Nghiên cu mt s tính cht ca Protease HIV-1 tái t hp
3.3.1. Nhi t

 bn nhit ca protease HIV-1


B
A

15



Hình 3.26. 


-
Kt qu nh ho protease HIV-1 tái t hp ti các pH khác nhau (hình 3.26A)
cho thy enzyme hong ti thích ti nhi t 35-37
o
C và không th hin hot tính 
20

o
C. Khi x lý protease HIV-1 
i (hình 3.26
70
o
C trong 10 phút. Nhi 37
o
c chn cho các phn ng c t tng hp ca
protease HIV-1 tip theo.
3.3.2. 

-
c ch ra  hình 3.27, protease HIV-1 tái t hp có ho ct tng hp cao
trong vùng pH axit (pH 4  6), cao nht ti pH 4,5; ho gim dn ti vùng pH trung tính, kim
và enzyme hoàn toàn không th hin hot tính   m Na-acetate pH 4,5 nng
 100 mM có EDTA 4 mM, -ME 5 mM, NaCl 0,9 M và CaCl
2
c chn cho các phn
ng ct tip theo ca protease HIV-1.






Hình 3.27. p

-
3.3.3. 
m

, V
max
và K
cat
-
Phi hp k

 -p (hình 3.28) 
p aver-
protease HIV-p có K
m
là 61,3 µM, V
max
là 0,0275 µM/s và K
cat
là 2,86s
-1
.

16







Hình 3.28
protease HIV-


m
, K
cat
protease HIV-1 



 (1990) trên

m

cat
 .
-




 
-
 se HIV-
-
               

3.3.4.  -

 0 :
pepstatin A, indinavir, axit asiatic, curcumin, catechin, epicatechin, -mangostin,  -
mangostin, 8-hydroxyquinoline, menadione      là Na-fluor (NaF) và Zn-
sunfate (ZnSO

4
 protease HIV-
 (





,
1989)
 , 2007); curcumin (





, 2005), -mangostin,
-mangostin (





, 1996), catechin và epicatechin (





, 2007) 

-

HIV- protease (





, 2005)
này (curcumin, axit asiatic, mangostin) 

 (





, 2005; 






, 2008; 






, 2008). Ngoài ra, mangostin, catechin 
,  , , 
 (





, 2008; Lambert , 2003).

17
a chúng tôi (hình 3.29rotease HIV-

50

Pepstatin A, axit asiatic, curcumin, catechin, epicatechin, -mangostin, -mangostin, 8-
-
50

0,4 µM; 18,9 µM; 48,32 µM; 510 µM; 960 µM; 16,82 µM; 16,25 µM; 104 µM; 114,26 µM.
         


4
     
protease HIV-1 2 


  Zn
2+




transcriptase HIV-
50
là 53,(





, 1999) 
(





, 2004). Fluor -ATPase,
enolase, NADH oxidase (





, 1987).

HIV-1  axit asiatic, 8-hydroxyquinoline và menadione.
 -





























D

D

I

H

A
C
B
E
F

G
J
D

18
Hình 3.29. 








protease HIV-. A: Pepstatin A, B: Indinavir, C: Axit asiatic, D:
Curcumin, E: Catechin, F: Epicatechin, G: -Mangostin, H: -
Mangostin, I: 8-Hydroxyquinoline, J: Menadione, K: NaF, L: ZnS0
4

19

K 
1. -1 (297 bp)


H69K, V82I, L89M, I13V, I15V, N83T). 

2. -1 E. coli BL21 (DE3)
thioredoxin và 7 axit amin
-hemagglutinin 
 -
-HCl 20 mM pH 7,9 có NaCl 100 mM, urea 1M và Triton X-100 1%;
mono Q--
His-
3. Protease HIV-
m
= 61,3
µM, V
max
= 0,0275 µM/giây, K
cat
= 2,86 s
-1

o


o
C t
--
ng là 18,9 µM, 104

µM và 114,26 µM.


1.  -

           -    và  



References

I. 
1.  (2007),
 
virus HIV-Tạp chí Công nghệ Sinh học 5, tr. 463-470.
2. , 
8-
UA-Tạp chí Dược học 43, tr. 11-13.

20
3. 


Tạp chí Công nghệ Sinh học 6, tr. 27-34.
4.  
  
   ype CRF01_AE trong E.
coli               
Tạp chí Công nghệ Sinh học 9, tr. 29-36.
II. ng Anh

5. Abecasisa A.B., Deforchea K., Snoecka J., Bachelerb L.T., McKennac P., Carvalhod
A.P., Gomesd P., Camachod R.J. and Vandammea A.M. (2005), "Protease mutation
M89I/V is linked to therapy failure in patients infected with the HIV-1 non-B subtypes C,
F or G", AIDS 19, pp. 1799-1806.
6. Aggarwal B.B., Shishodia S. (2004), "Suppression of the nuclear factor-kappaB activation
pathway by spice-derived phytochemicals: reasoning for seasoning", Ann. N. Y. Acad. Sci.
1030, pp. 434441.
7. Akao Y., Nakagawa Y., Iinuma M., Nozawa Y. (2008), "Anti-cancer effects of xanthones
from pericarps of mangosteen", Int. J. Mol. Sci. 9, pp. 355-370.
8. Alastair J.J., Wood M.D., (1998), "HIV-Protease inhibitors", N. Engl. J. Med. 338, pp.
1281-1292.
9. Anson B.D., Weaver J.G., Ackerman M.J., Akinsete O., Henry K., January C.T., Badley
A.D. (2005), "Blockade of HERG channels by HIV protease inhibitors", Lancet 365, pp.
682-686.
10. Ariyoshi K., Matsuda M., Miura H., Tateishi S., Yamada K., Sugiura W. (2003), "Patterns
of point mutations associated with antiretroviral drug treatment failure in CRF01_AE
(subtype E) infection differ from subtype B infection", JAIDS 33, pp. 336-342.
11. Bandaranayake R.M., Jeyabalan M.P, Kakizawa J., Sugiura W., and Schiffer C.A. (2008),
"Structural analysis of HIV-1 CRF01_AE protease in complex with the substrate p1-p6 ",
J. Virol. 82, pp. 6762-6766.

21
12. Baum E.Z., Bebernitz G.A. and Gluzman Y. (1990), "Isolation of mutants of human
immunodeficiency virus protease based on the toxicity of the enzyme in Escherichia coli",
Proc. Natl. Acad. Sci. U. S. A. 87, pp. 5573-5577.
13. Bradford M.M. (1976), "A dye binding assay for protein", Anal. Biochem. 72, pp. 248-
254.
14. Brik A., Wong C.H. (2003). "HIV-1 protease: mechanism and drug discovery", Org.
Biomol. Chem. 1, pp. 5 - 1 4.
15. Ceccherini-Silberstein F., Erba F., Gago F., Bertoli A., Forbici F., Bellocchi M.C., Gori

C., D'Arrigo R., Marcon L., Balotta C., Antinori A., Monforte A.D., Perno C.F. (2004),
"Identification of the minimal conserved structure of HIV-1 protease in the presence and
absence of drug pressure", AIDS 18, pp. 9-11.
16. Chelur D., Unal O., Scholtyssek M., Strickler J. (2008), "Fusion tags for protein
expression and purification" BioPharm Inter. Supp. 
.
17. Chen H., Xu Z., Yin X., Cen P. (2007), "Cloning and expression of the HIV protein in
Escherichia coli cell-free system", Appl. Microbiol. Biotechnol. 77, pp. 347-354.
18. Chen S.X., Wan M., Loh B.N. (1996), "Mangosteen demonstrates potent inhibitory
activity against HIV-1", Planta Med. 62, pp. 381-382.
19. Cheng Y.S.E., Lo K.H., Hsu H.H., Shao Y.M., Yang W.B., Lin C.H., Wong C.H. (2006),
"Screening for HIV protease inhibitors by protection against activity-mediated
cytotoxicity in Escherichia coli" J. Virol. Methods, 137, pp. 82-87.
20. Cheng Y.S.E., McGowan M.H., Kettner C.A., Schloss J.V., Erickson S., Yin F.H. (1990),
-level synthesis of recombinant HIV-1 protease and the recovery of active enzyme
Gene 87, pp. 243-248.
21. Daar E.S., Little S., Pitt J., Santangelo J., Ho P., Harawa N., Kerndt P., Glorgi J.V, Bai J.,
Gaut P., Richman D.D., Mandel S., Nichols S. (2001), "Diagnosis of primary HIV-1
infection. Los Angeles County Primary HIV Infection Recruitment Network", Ann.
Intern. Med. 134, pp. 25-29.
22. Danley D.E., Geoghegan K.F., Scheld K.C., Lee S.E., Merson J.R., Hawrylik S.J., Rickett
G.A., Atmnirati M.J. and Hobart P.M. (1989), "Crystallizable HIV-l protease derived
from expression of the viral pol gene in Escherichia coli", Biochem. Biophys. Res.
Commun. 165, pp. 1043-1050.

22
23. Darke P.L., Leu C.T., Davis L.J., Heimbach J.C., Diehl R.E., Hill W.S., Dixon R.A.F. and
Siga I.S. (1989), "Human immunodeficiency virus protease bacterial expression and
characterization of the purified aspartic protease", J. Biol. Chem. 264, pp. 2307-2312.
24. Debouck C., Gorniak J.G., Strickler J.E., Meek T.D., Metcalf B.W., Rosenberg M.

   n Escherichia coli exhibit
Proc. Natl. Acad. Sci. U. S.
A. 84, pp. 8903-8906.
25. Dergousova N., Amerik A.U., Volynskaya A.M. and Rumsh L.D. (1996), "HIV-I protease
cloning, expression, and purification", Appl. Microbiol. Biotechnol. 61, pp. 97-107.
26. Feinberg M.B. (1996), "Changing the natural history of HIV disease" Lancet 348, pp.
239-246.
27. Field J., Broek D., MacDonald B., Rodgers L., Wilson I.A., Lerner R.A. and Wigler M.
(1988), "Purification of a RAS-responsive adenylyl cyclase complex from
Saccharomyces cerevisiae by use of an epitope addition method", Mol Cell. Biol. 8, pp.
2159-2165.
28. Galli M., Ridolfo A.L., Adorni F., Gervasoni C., Ravasio L., Corsico L., Gianelli E.,
Piazza M., Vaccarezza M., d'Arminio Monforte A., Moroni M. (2002), "Body habitus
changes and metabolic alterations in protease inhibitor-naive HIV-1-infected patients
treated with two nucleoside reverse transcriptase inhibitors", JAIDS 29, pp. 21-31.
29. Gong Y.F., Robinson B.S., Rose R.E., Deminie C., Spicer T.P., Stock D., Colonno R.J.,
Lin P.F. (2000), "In vitro resistance profile of the human immunodeficiency virus type 1
protease inhibitor BMS-232632", Antimicrob. Agents. Chemother. 44, pp. 2319 2326.
30. Graves M.C., Lim J.J., Hei    -kDa form of human
immunodeficiency virus protease expressed in Escherichia coli is sufficient for enzymatic
Proc. Natl. Acad. Sci. U. S. A. 85, pp. 2449-2453.
31. Greene W.C. (2007), "A history of AIDS: looking back to see ahead", Eur. J. Immunol.
37, pp. 94-102.
32. Guo J.S., Cheng C.L., Koo M.W. (2004 ), "Inhibitory effects of Centella asiatica water
extract and asiaticoside on inducible nitric oxide synthase during gastric ulcer healing in
rats", Planta Med. 70, pp. 1150-1154.
33. Hare B.C., (2006), "Clinical Overview of HIV Disease", HIV Insite Knowledge Base
Chapter- www.hivinsite.ucsf.edu.

23

34. Hilton B.J., Wolkowicz R. (2010), "An assay to monitor HIV-1 protease activity for the
identification of novel inhibitors in T-Cells", PloS. One. 5, pp. 1-7.
35. Hoffmann C., Rockstroh J.K., Kamps B.S. HIV medicine (2007), www. HIV
Medicine.com.
36. Hsu Y.L., Kuo P.L., Lin L.T., Lin C.C. (2005), "Asiatic acid, a triterpene, induces
apoptosis and cell cycle arrest through activation of extracellular signal-regulated kinase
and p38 mitogen-activated protein kinase pathways in human breast cancer cells", J.
Pharmacol. Exp. Ther. 31, pp. 333-344.
37. Ido E., Han H.P., Kezdyll F.J. and Tang J. (1991), "Kinetic studies of human
immunodeficiency virus type 1 protease and its active-site hydrogen bond mutant A28S",
J. Biol. chem. 266, pp. 24359-24366.
38. Ishizaki A., Nguyen H.C., Pham V.T., Nguyen V.T., Kiyofumi S., Kageyama S., Ishigaki
K., Tanuma J., Oka S. and Ichimura H. (2009), "Profile of HIV type 1 infection and
genotypic resistance mutations to antiretroviral drugs in treatment-naive HIV type 1-
infected individuals in Hai Phong, Viet Nam", AIDS. Res. Hum. Retroviruses 25, pp. 175-
182.
39. Jacobsen H., Yasargil K., Winslow D.L., Craig J.C., Kröhn A., Duncan I.B., Mous J.
(1995), "Characterization of HIV type 1 mutants with decreased sensitivity to proteinase
inhibitor Ro 31-8959", Virology 206, pp. 527-534.
40. Jamison J.M., Gilloteaux J., Taper H.S. and Summers J.L. (2001), "Evaluation of the in
vitro and in vivo antitumor activities of vitamin C and K-3 combinations against human
prostate cancer", J. Nutr. 131, pp. 158-160.
41. Johnson V.A., Brun-Vézinet F., Clotet B., Conway B. (2006), "Update of the drug
resistance mutations in HIV-1: Fall 2006. Special contribution - drug resistance
mutations", Top. HIV. Med. 14, pp. 125-130.
42. Johnson V.A., Brun-Vézinet F., Clotet B., Günthard H.F., Kuritzkes D.R., Pillay D.,
Schapiro J.M. and Richman, D.D. (2010), "Special contribution update of the drug
resistance mutations in HIV-1: December 2010", Top. HIV. Med. 18, pp. 156-163.
43. Jullaksorn D., Boonchawalit S., Uttiyoung J., Soonthornsata B., Yowang A., Krathong N.,
Chautrakul S., Ikuta K., Roobsoong A., Anitvittaya S., Sawanpanyalert P. and Kameoka

M. (2010), "Sustained appearance of drug resistanceassociated mutations in HIV-1
CRF01_AE protease and reverse transcriptase derived from protease inhibitor-naive Thai
patients", J. Trop. Med. 41, pp. 347-357.

24
44. Kantor R., Katzenstein D.A., Efron B., Carvalho A.P., Wynhoven B., Cane P., Clarke J.,
Sirivichayakul S., Soares M.A., Snoeck J., Pillay C., Rudich H. et all. (2005), "Impact of
HIV-1 subtype and antiretroviral therapy on protease and reverse transcriptase genotype:
results of a global collaboration", PloS. Med. 2, pp. 0325-0337.
45. Kato K., Kusagawa S., Motomura K., Yang R., Shiino T., Nohtomi K., Sato H.,
Shibamura K., Nguyen T.H., Pham K.C., Pham H.T., Duong C.T., Nguyen C.Q., Bui
D.T., Hoang T.L., Nagal Y. and Takebe Y. (2001), "Closely related HIV-1 CRF01_AE
variant among injecting drug users in northern Vietnam: evidence of HIV spread across
the VietnamChina border". AIDS. Res. Hum. Retroviruses 17, pp. 113123.
46. Kemp D.J., Isaacson J.D., King M.S., Brun S.C., Sylte J., Richards B., Bernstein B., Rode
R., Sun E. (2002), "Pharmacokinetic enhancement of inhibitors of the HIV protease by
coadministration with Ritonavir", Antivir. Ther. 7, pp. 165-174.
47. King N.M., Melnick L., Prabu-Jeyabalan M., Nalivaika E.A., Yang S.S., Gao Y., Nie X.,
Zepp C., Heefner D.L. and Schiffer C.A. (2000), "Lack of synergy for inhibitors targeting
a multi-drug-resistant HIV-1 protease", Protein Sci. 44, pp. 2319-2326.
48. Komai T., Ishikawa Y., Yagi R., Suzuki-Sunagawa H., Nishigaki T., Handa H. (1997),
"Development of HIV-1 protease expression methods using the T7 phage promoter
system", Appl. Microbiol. Biotechnol. 47, pp. 241-245.
49. Kräusslich H.G., Ingraham R.H., Skoog M.T., Wimmer E., Pallai P.V. and Carter C.A.
(1989), "Activity of purified biosynthetic proteinase of human immunodeficiency virus on
natural substrates and synthetic peptides", Proc. Natl. Acad. Sci. U. S. A. 86, pp. 807-811.
50. Laemmli U.K. (1970), "Cleavage of structural proteins during the assembly of the head of
bacteriophage T4", Nature 227, pp. 680-685.
51. Lambert J.D., Yang C.S. (2003), "Mechanisms of cancer prevention by tea constituents",
J. Nutr. 133, pp. 3262S-3267S.

52. Lech W.J., Wang G., Yang Y.L., Chee Y., Dorman K., McCrae D., Lazzeroni L.C.,
Erickson J.W., Sinsheimer J.S., Kaplan A.H. (1996), "In vivo sequence diversity of the
protease of human immunodeficiency virus type 1: presence of protease inhibitor-resistant
J. Virol. 70, pp. 2038-2043.
53. 
poly-histidine-linked HIV-FEBS Lett. 36, pp. 275-280.
54. Liao H., Tee K.K., Hase S., Uenishi R., Li X.Z., Kusagawa S., Pham H.T., Pybus O.G.,
Takebe Y. (2009), "Phylodynamic analysis of the dissemination of HIV-1 CRF01_AE in
Vietnam", Virology 391, pp. 51-56.

25
55. Liu J., Yue. J., Wu S., Yan Y. (2007), "Polymorphisms and drug resistance analysis of
HIV-1 CRF01_AE strains circulating in Fujian Province, China", Arch. Virol. 152, pp.
1799-1805.
56. Louis J.M., Mcdonald R.A., Nashed N.T., Wondraku E.M., Jerina D.M., Oroszilan S.,
  -1 protease using purified wild-type and
mutated fusion proteins expressed at hing level in Escherichia coli”, Eur. J. Biochem.
199, pp. 361-369.
57. Louis J.M., Nashed N.T., Parris K.D., Kimmel 
mechanism of autoprocessing of human immunodeficiency virus type 1 protease from an
analog of the gag-pol prProc. Natl. Acad. Sci. U. S. A. 91, pp. 7970- 7974.
58. Maki K.C., Reeves M.S., Farmer M., Yasunaga K., Matsuo N., Katsuragi Y., Komikado
M., Tokimitsu I., Wilder D., Jones F., Blumberg JB. and Cartwright Y. (2009), "Green tea
catechin consumption enhances exercise-induced abdominal fat loss in overweight and
obese adults", J. Nutr. 139, pp. 264-270.
59. Merrill D.P., Manion D.J., Chou T.V. and Hirsch M.S. (1997), "Antagonism between
Human Immunodeficiency Virus Type 1 Protease Inhibitors Indinavir and Saquinavir in
vitro", J. Infect. Dis. 176, pp. 265-268.
60. Michael N.L., Herman S.A., Kwok S., Dreyer K., Wang J., Christopherson C., Spadoro
J.P., Young K.K., Polonis V., McCutchan F.E., Carr J., Mascola J.R., Jagodzinski L.L.,

Robb M.L. (1999), "Development of calibrated viral load standards for group M subtypes
of human immunodeficiency virus type 1 and performance of an improved amplicor HIV-
1 monitor test with isolates of diverse subtypes", J. Clin. Microbiol. 37, pp. 2557-2563.
61. Mildner A.M., Rothrock D.J., Leone J.W., Bannow C.A., Lull J.M., Reardon I.M.,
Sarcich J.L., Howe W.J., Tomich C.C., Smith C.W., Heinrickson R.L. & Tomasselli A.G.
The HIV-1 protease as enzyme and substrate: mutagenesis of autolysis sites and
generation of a stable of mutant with retained kinetic properties”, Biochemistry 73, pp.
1391-1396.
62. Nakatani K., Yamakuni T., Kondo N., Arakawa T., Oosawa K., Shimura S., Inoue H.,
Ohizumi Y. (2004), "Gamma-mangostin xanthone acts as anti-inflammatory", Mol.
Pharmacol. 66, pp. 667-674.
63. Nashed N.T., Louis J.M., Sayer J.M., Wondrak E.M., Mora P.T., Oroszlan S., Jerina
         -1
Biochem. Biophys. Res. Commun. 163, pp. 1079-1085.