prins and in situ pcr protocols

1
Oligonucleotide PRINS DNA Synthesis
John R. Gosden and Diane Lawson
1. Introduction
The technique for labeling chromosomes by annealing an oligonucleotide DNA
primer to the denatured DNA of chromosome preparations on glass slides and
extending it enzymatically in
situ
with the incorporation of labeled nucleotides
was fust described by Koch et al. in 1989 (I). Since then, the technique has been
greatly improved in reliability, sensitivity, and resolution, and now provides a
viable, rapid alternative to conventional fluorescence
in situ
hybridization
(FISH) for many investigations, particularly the identification of chromosome
aneuploidy in metastatic tissues and antenatal diagnosis and the analysis of the
human chromosome complement of somatic hybrid cell lines (Zd).
2. Materials
2.1. Primed In Situ Syf7thesis
1. Twin-Frost glass slides and 22 x 40 mm coverslips: The slides must be cleaned
by soaking in ethanol to which a few drops of HCl have been added, followed by
polishing with a clean piece of muslin, before the cells are deposited on the slide.
Coverslips must be cleaned in the same way before use.
2. PRINS buffer (10): 500 mM KCl, 100 mil4 Tris-HCl, pH 8.3, 15 mA4 MgC12,
0.1% BSA.
3. 2’-Deoxyadenosine 5’-triphosphate (dATP): 100-W solution (Pharmacia
Biotech, St. Albans, UK), diluted 1: 10 with sterile distilled HzO.
4. 2’-Deoxycytidine 5’-triphosphate (dCTP): 1 00-mM solution (Pharmacia Biotech)
diluted 1: 10 with sterile distilled H20.
5. 2’-Deoxyguanosine S-triphosphate (dGTP): 100~mM solution (Pharmacia
Biotech) diluted 1: 10 with sterile distilled H20.

6. 2’-Deoxythymidine 5’-triphosphate (dTTP): lOO-mJ4 solution (Pharmacia Biotech)
diluted 1: 100 with sterile distilled H,O.
From. Methods fn Molecular Biology, Vol 71 PRINS and In Situ PCR Protocols
Ed&d by. J. R Gosden Humana Press Inc., Totowa, NJ
2
Gosden and Lawson
7. Biotin-16-2’-deoxyuridine-5’-triphosphate (Bio- 16-dUTP) (Boehrmger Mannheim,
Lewes, Sussex, UK).
8. Digoxigenin-1 I-deoxyuridine-5’-triphosphate (Dig-l l-dUTP) (Boehrmger
Mannherm).
9. FluoroRed (Amersham International, plc, Buckinghamshire, England).
10. FluoroGreen (Amersham International).
11. FluoroBlue (Amersham International).
12. Ohgonucleotide primer(s) at 250 ng/pL (see Note 1)
13 Tuq DNA polymerase (Taq [Boehrmger], AmpliTaq [Cetus], or ThermoprimePrus
[Advanced Biotechnologies Ltd., Leatherhead, England]).
14 Rubber cement (vulcanizing solutron) (e.g., Tip-Top, Stahlgruber, DS-8011
Poing, Germany) (see Note 2).
15. Stop buffer (500 mM NaCl, 50 n1J4 EDTA).
16. Flat-bed thermal cycler (see Note 3).
17. Water bath at 65°C
2.2. Detection
1 Dried skimmed milk powder.
2. Avrdin-DCS-fluorescein isothiocyanate (Av-FITC) (Vector Labs, Burlin-
game, CA).
3. Avidin-DCS-Texas red (Av-TR) (Vector Labs).
4. Antrdigoxigenin-fluorescem (anti-DIG-FITC) (Boehrmger Mannhelm).
5. Antrdigoxigenm-rhodamine (anti-DIG-rhodamine) (Boehrmger Mannheim).
6. Propidium iodide (20 pg/mL) (Sigma).
7. 4’,6-Dtamidino-2-phenylmdole 2 HCl (DAPI) (100 pg/mL) (Sigma).

8. VectaShreld (Vector Labs).
9. 20X SSC: 3.OMNaC1, 0.3OMtn-sodmm citrate, pH 7.3.
10. Wash buffer: 4X SSC (diluted from stock 20X SSC), 0.05% Tnton X-100.
11. Blocking buffer: wash buffer with the addition of 5% skimmed mrlk powder.
12. Incubator or water bath at 37’C and water bath at 45°C.
13. Microscope equipped for eprfluorescence (e g., Zeiss Axioskop or Leitz Ortholux
II with Pleomopak filter system)
3. Methods
3.1. Standard PRINS
1. You will need cells or chromosomes, prepared from peripheral blood lym-
phocytes (71, cultured cells (8), or frozen sections (see Speel et al., Chapter 8)
(see Note 5).
2. Oligonucleotide primers are prepared on an Applied Biosystems (Foster City,
CA) Model 38 1A DNA synthesizer according to the manufacturer’s instructions.
Recommendations for some successful chromosome-specific primers are given
in Table 1 (but see Note 4).
3. The reaction mix is made up as follows: For each slide, put 1 pL of each of the
diluted nucleotide triphosphates, plus 1 @L of the selected labeled dUTP (biotin,
PRINS 3
Table 1
Examples of Chromosome-Specific
Oligonucleotides and a Primer for All Human Centromeres
F673 (20-mer)
F60 (30mer)
G33 (19-mer)
168 (17-mer)
D16Z1, Satellite II
D 172 1, alphoid
D9Z 1, Satellite III
CenP-B Box

TTCTTTTCATACCGCATTCT
ATTGCACTTCTTTGAGGAGTACCG
TAGTAA
AATCAACCCGAGTGCAATC
CTTCGTTGGAAACGGGA
digoxigenin, or a fluorochrome), 5 pL 10X PRINS buffer, and 1 pL of the appro-
priate oligonucleotide pruner (see Note 6) mto a microcentrifuge tube, and add
distilled water to 50 PI.,,
4. Mix thoroughly and add 1 U of your chosen DNA polymerase. Mix carefully and
place 40 $ on a clean coverslip.
5. Pick the coverslip up with a slide (this spreads the reaction mix evenly, with the
least risk of introducing air bubbles) and seal with rubber cement
6. Dry the seal (a cold air fan is quick and safe) and transfer the slides to the flat
block of a thermal cycler. A suitable basic program for the Hybaid OmniGeneTM
In Situ, or Hybaid OmniSlideTM is 93”C, 3 min; 60°C 5-10 min; 72”C, 15 min.
7. On completion of the program, remove the seal (it peels off easily by rubbing one
comer) and transfer the slides for 1 min to a Coplin jar containing stop buffer at
65°C. Leave the coverslips in place, unless they come off readily with the seal;
they will in any case fall off in the stop buffer. After 1 min, transfer the slides to
a stain dish containing wash buffer. They may be held in this solution overnight
if convenient (but see Note 7)
3.2. Detection
It is important that the slides do not become dry at any time during this
process. The following steps apply only to slides in which the PRINS reaction
has been labeled with biotin or digoxigenin. Slides in which the reaction used a
fluorochrome-dUTP as the label require no detection step, and are simply
mounted (see step 6).
1. Prepare blocking buffer. The milk powder dissolves rapidly if the solution is
warmed to 45“C for a few seconds.
2. Put 40 pL blockmg buffer on a clean coverslip, shake surplus wash buffer from

the slide, and pick up the coverslip containing blocking buffer. Leave (unsealed)
at room temperature for 5
min.
3. Dissolve reporter (avidin-fluorochrome or antidigoxigenin-fluorochrome) in block-
ing buffer. For Av-FITC or Av-TR, 1:500 is a suitable dilution; anti-DIG FITC
and anti-DIG rhodamine are better at 1: 100 dilution. Make sufficient buffer for a
40 &/slide. Spin in a microcentrifuge for 5 min. This precipitates any aggregates that
may have formed during storage and can cause high and nonspecific background.
4 Go&en and Lawson
4. Remove the cover&p from the slide, shake surplus fluid off both the sltde and
the coverslip, and add 40 pL of reporter solution to the same coverslip. Replace
the slide and incubate in a moist chamber (e g., a sandwich box lmed with damp
filter paper) at 37°C for 30 mm.
5. Warm a reagent bottle containing wash buffer to 45OC in a water bath. Remove
covershps and wash slides 3 x 2 min in 50 mL wash buffer at 45°C.
6. After the final wash, shake off surplus fluid and mount slides in VectaShleld
containing the appropriate counterstain: For slides labeled with rhodamine or
Texas red, this should be DAPI (5 pg/lOO pL VectaShield, i e., 5 pL of DAPI
stock/l00 pL VectaShleld); for slides labeled with FITC, this should be a
propidium iodide/DAPI mixture (3.75 & of each stock/l00 pL VectaShield).
Use 20-30 pL mountant/slide, blot surplus by covering slide and covershp with a
tissue and pressing gently to expel excess mountant, and seal with rubber cement.
Slides may be stored m the dark at 4°C for several months. If the stain shows
signs of fading, simply peel off the sealant, soak the slide overnight in 4X SSC,
0.05% Triton X-100 (the covershp will fall off at this point), and remount as above
Figure 1 shows some typlcal results.
7. Multiple sequential PRINS reactions may be performed on the same sample in
order to quantify a number of chromosomes. For details of the method, see Chap-
ter 6 and ref. 6
8. The technique may also be combined with FISH. After the stop buffer, the shdes

are passed through an ethanol series (70, 90, 100%) and air-dried before per-
forming a normal FISH procedure, omitting any denaturation of the chromo-
somal DNA. Detection of the PRINS product and the hybridized FISH probe is
then performed simultaneously (9) This provides a rapid method for identifying
the chromosomal target located by the FISH.
4.
Notes
1. Oligonucleotide pnmers can be synthesized on an ABI DNA synthesizer and
used without further purification other than alcohol preclpltatlon and washing. If
this facility is not available, they may be obtained from commercial sources,
but purification steps, such as HPLC, are not needed and only increase the
cost of the product.
2. The requirement for a suitable seal is that it should be reasonably robust, provide
a vapor-tight seal, and be easily and completely removed at the end of the proce-
dure. We have found that Tip-Top fulfills all these parameters and is readily
available from bicycle repair shops.
3. Thermal cyclers with a flat bed for microscope slides are not yet widely avall-
able. Some of the products sold for this purpose are not altogether suitable, since
they are ad hoc modifications of machines designed for PCR in microtubes, with a
plate added to the heated block. Thermal transfer and temperature control m such a
system are rarely satisfactory The procedure can be carried out by transferrmg
slides through a series of water baths at appropriate temperatures, but this too means
that temperature control cannot be precise, and the temperature drop during the
PRINS
Fig. 1. (see color plate number 1 after p. 82) Examples of PRINS reactions with the
primers shown in Table 1. All reactions were labeled with biotin-16-dUTP, and the
label detected with avidin-FITC. Chromosomes were counterstained with a mixture of
DAPI and propidium iodide. (A) Chromosome 16. (B) Chromosome 9. (C) Chromo-
some 17. (D) CenP-B box primer (labels all centromeres).
transfer from water bath to water bath leads to high backgrounds. The most suitable

purpose-built products are the OmniGene In Situ and OmniSlide made by Hybaid
(Teddington, Middlesex, UK), which hold 4 and 20 slides, respectively.
4. As an alternative, complete systems for chromosome identification by PRINS are
becoming available (e.g., Advanced Biotechnologies, Leatherhead, England).
5. Cell suspensions may be stored in fix (methanol:acetic acid [3: 11) at -20°C for
several months. Slides are prepared fresh each week by gently centrifuging the
suspension to precipitate the cells, resuspending in fresh fix, repeating this pro-
cess, and finally resuspending in sufficient fix to give a suitable density and put-
ting one drop on a clean slide, which is allowed to dry at room temperature. The
balance of the suspension may then be diluted suitably with fix and returned
to -2O’C. Using slides more than l-2 wk old can be successful, but may lead to
reduced sensitivity and greater variability.
6. The majority of chromosome-specific alphoid sequences produce adequate sig-
nal with a single primer at a concentration of 250 ng/50 l.tL reaction. In some
Go&en and Lawson
cases, a clearer signal with less background may be produced with paired pnm-
ers, at the same concentration, whereas in others, the concentration of primer
may be reduced, with a concomitant reduction in crossreaction to related chro-
mosomal sequences.
7. Slides that have been labeled directly with fluorochromes may still be held m this
solution overnight if convenient, but should be kept in the dark to prevent bleach-
ing and fading of the label.
References
1. Koch, J E., Kolvraa, S., Petersen, K. B., Gregersen, N., and Bolund, I (1989)
Oligonucleotide-priming methods for the chromosome-specific labelling of alpha
satellite DNA in situ. Chromosoma 98,259-265
2. Gosden, J., Hanratty, D., Starling, J., Fantes, J , Mitchell, A., and Porteous, D.
(199 1) Oligonucleotide primed in situ DNA synthesis (PRINS): a method for chro-
mosome mapping, banding and investigation of sequence organization. Cytogenet
CeEZ Genet. 57, 100-l 04.

3. Gosden, J. and Lawson, D. (1994) Rapid chromosome identification by ohgo-
nucleotide primed in situ DNA synthesis (PRINS). Hum. A401 Genet. 3,93 l-946.
4 Gosden, J and Lawson, D. (1995) Instant PRINS: a rapid method for chromo-
some identification by detecting repeated sequences in situ. Cytogenet Cell Genet.
68,57-60.
5. Hindkjaer, J., Koch, J., Terkelsen, C., Brandt, C. A., Kolvraa, S., and Bolund, L.
(1994) Fast, sensitive multicolour detection of nucleic acids by primed in situ
labelling (PRINS). Cytogenet. Cell Genet. 66, 152-l 54.
6. Speel, E. J. M., Lawson, D., Hopman, A. H. N., and Gosden, J. (1995) Multi-
PRINS: multiple sequential oligonucleotide primed in situ DNA synthesis reac-
tions label specific chromosomes and produce bands. Hum. Genet. 95,29-33.
7. Spowart, G. (1994) Mitotic metaphase chromosome preparation from peripheral
blood for high resolution, in Methods in Molecular Biology, vol 29. Chromosome
Analyszs Protocols (Gosden, J. R., ed.), Humana, Totowa, NJ, pp. l-10.
8. Fletcher, J. (1994) Immortalized cells lines: chromosome preparation and bmd-
ing, in Methods in Molecular Bzology, vol. 29: Chromosome Analyszs Protocols
(Gosden, J. R., ed.), Humana, Totowa, NJ, pp. 51-57.
9. Warburton, P. E., Haaf, T., Gosden, J., Lawson, D , and Willard, H. F. (1996)
Characterization of a chromosome-specific chimpanzee alpha satellite subset:
evolutionary relationship to subsets on human chromosomes. Genomlcs 33,220-228
Chromosome-Specific PRINS
Jean-Paul Charlieu and Franck Pellestor
1. Introduction
The identification of mdlvidual chromosomes IS of great Importance in
cytogenetics, in order to detect aneuploidies or chromosomal rearrangements
associated with genetic diseases. This can be achieved by several techniques
based either on the intrinsic staining properties of the chromosomes in produc-
ing bands (the banding pattern being specific for each pair of chromosomes)
(1)
or the use of a DNA probe to detect specifically a region of the chromo-

some by fluorescence in sztu hybridization (FISH) (2). The use of centromeric
a satellite sequences as FISH probes is very popular because of the specificity
of these sequences. cz Satellite (or alphoid) DNA 1s a family of tandemly
repeated sequences present at the centromere of all human chromosomes (3).
Subfamilies, some of them specific for one or a small group of chromosomes,
can be identified within alphoid DNA both by the periodic distribution of
restriction sites and the nucleotide sequence of the 171-bp basic motif (4).
These chromosome-specific subfamilies can therefore be used as FISH probes.
This approach is limited, however, since the DNA sequences of some subfami-
lies are very close to each other, and crosshybridization can occur between the
centromeric sequences of several pairs of chromosomes. This is the case with
chromosomes 13 and 2 1, for example, which share 99.7% homology in their
alphoid sequences (5,. The development of the primed in situ (PRINS) tech-
nique of labeling DNA (68) introduced a solution to this problem. The PRINS
procedure consists of the use of a small oligonucleotide (usually 18-22 nucle-
otides) from the sequence of interest as a primer. The primer is annealed to the
denatured DNA of a chromosome or cell preparation. An in situ DNA synthe-
sis reaction is performed with the incorporation of a labeled precursor (biotin-
dUTP or digoxygenin-dUTP), using a thermostable DNA polymerase. A single
From Methods m Molecular B/otogy, Vol 71 PRlNS and In S~tu PCR Protocols
Edlted by. J R Gosden Humana Press Inc., Totowa, NJ
7
8
Charlieu and Pellestor
base mismatch between the target and the probe will produce a less stable
hybrid when using a primer than for a long FISH probe. In addition, if the
mismatching nucleotide is located at the 3’-end of the PRINS primer, it will
prevent any elongation by the DNA polymerase.
We have developed several chromosome-specific a-satellite primers for
PRINS, each of them carrying at least a chromosome-specific nucleotide at its

3’-end, and we describe in this chapter the use of two of them for the detection
of human chromosomes 13 and 21. Other primers are available in the literature
(9,ZO) or on request, but we are presenting only the conditions of use for the
two most difficult, differing only at one position.
2. Material
2.1. Slides
1. Chromosome spreads are prepared from peripheral blood usmg standard meth-
ods (fixation in methanol:acetic acrd 3: 1).
2. 20X SSC: 3M NaCl, 0.3M Nas-citrate (can be stored for several months at
room temperature).
3. 70,90, and 100% ethanol.
4. Formamrde (Prolabo, Paris, France): Formamide must be deionized by mixing
with Amberlite resm (Sigma, St. Louis, MO), allowing to stand for at least 1 h,
and then filtering. Deionized formamide is stored at +4”C.
2.2. PRIM Reaction
1. Primers: Synthetic oligonucleotides are used as primers m the PRINS experi-
ments. Their nucleotide sequences are as follows (11):
13A
(chromosome
13): 5’-TGATGTGTGTACCCAGCT-3’
21A (chromosome 21): 5’-TGATGTGTGTACCCAGCC-3’
Precipitate the primers by adding 10 vol of 1-butanol, vortex, and centrifuge for
1 mm at maximum speed in a bench-top microfuge. Dry the pellets under vacuum,
and resuspend in 5 miV Tris-HCl, pH 8.0, to obtain a 50 @4 (50 pmol/pL) solu-
tion. Store small aliquots (50 pL) at -2OT (see Notes 1 and 2).
2. 2’-Deoxyadenosine 5’-triphosphate (dATP) (Boehringer Mannheim, Meylan,
France): Resuspend in Hz0 to obtain a 100-M stock solution (store at -2O’C).
3. 2’-Deoxycytosine 5’-triphosphate (dCTP) (Boehringer Mannheim): Resuspend to
obtain a 100~mM stock solution (-2O’C).
4. 2’-Deoxyguanosine 5’-triphosphate (dGTP) (Boehringer Mannheim): Resuspend

to obtain a 100~mM stock solution (-2OT).
5. 2’-Deoxythymidine 5’-triphosphate (dTTP) (Boehringer Mannheim): Resuspend
to obtain a 100-n&f stock solution (-20°C).
6. Biotin-l&dUTP, 1 mM (Boehringer Mannheim) (-2O’C).
7. Glycerol 87% (Prolabo).
8. Tuq DNA polymerase (Boehringer Mannhetm). Store at -2O’C
9. 10X Taq buffer (provided with the enzyme) (-2O’C).
Chromosome-Specific PRIM
9
10. Stop buffer: 500 n&f NaCl, 50 mM EDTA, pH 8.0 (can be stored at room tem-
perature for several months).
11. Sterile, deionized, double-distilled water.
12. Water bath at 60°C.
13. Water bath at 72°C.
14. 1.5~mL microcentrifuge tubes (sterilized by autoclaving).
15. Coverslips (22 x 40).
16. Thermal cycling machine equipped with a flat block (e.g., Techne PHC3).
2.3. Detection
1. Washing solution: 4X SSC, 0.05% Tween 20.
2. Blocking solution: washing buffer plus 5% nonfat dry milk. Make fresh each time.
3. Fluorescein-avidin DCS (FITC-avidin) (Vector Laboratories, Burlingame, CA).
4. Propidium iodide (PI) (Sigma).
5. Antifade solution Vectashield (Vector Labs).
6. Staining Jars.
7. Microscope equipped for detection of FITC and PI fluorescence
3. Methods
3.1. Slides
1. Store slides prepared according to standard methods at room temperature for 5 d
before use.
2. Just before the PRINS reaction, dehydrate the slides by passage through an etha-

nol series (70,90, 100%) at room temperature, 3 min each step, and air-dry.
3. Denature the chromosomal DNA on the slides by immersing them in 70%
formamide, 2X SSC, at 72°C for 2 min, dehydrating through an ice-cold ethanol
series (70,90, lOO%), and an-drying (see Note 3).
3.2. PRINS Reaction
1. Prepare a 10X dNTPs mix: Dilute the stock solutions (100 r&f) of dATP, dCTP,
dGTP, and dTTP l/l 0 in sterile, distilled water. In a sterile microcentrifuge tube,
mix 10 & of each diluted dATP, dCTP, and dGTP, 0.25 pL of diluted dTTP, 25 pL
of 1 m&f biotin-16 dUTP, and 55 pL of glycerol. Mix well and store at -2O’C.
2. Prepare the PRINS reaction mix in a sterile 1.5~mL microtube by mixing (for
each slide) 4 pL of primer (200 pmol), 5 pL of 10X Tag polymerase buffer, 5 pL
of 10X dNTPs mix (from step l), and 0.5 pL of Taq polymerase (2.5 U), and add
sterile distilled water to a final volume of 50 pL.
3. Preheat the reaction mix at 60°C in a water bath.
4. Place the slide (prepared as in Section 3.1.) and a coverslip on the plate of the
thermal cycler.
5. Set up the program for PRINS: 12 min at the annealing temperature (60°C for
primer 13A, 61°C for primer 21A; see Note 4) and 30 min at 72’C.
6. When starting the program, heat the slide(s) and the coverslip at the anneal-
ing temperature for 5 min. Then put the reaction mix onto the slide and cover
10
Char-lieu and Pellestor
by the coverslip. Incubate the slide at the annealing temperature for a further
7 min; the temperature is automatically raised to 72°C at the beginning of the
elongation step.
7. At the end of the elongation time, transfer the slide to 100 mL of preheated stop
buffer (72°C) for 3 min to stop the PRlNS reaction and to remove the coverslip.
Then transfer the slide to 100 mL of washing solution. The shdes can stay m thus
buffer overnight at 4°C if convenient
3.3. Detection

1. Wash the slides twice for 3 min at room temperature in washing solution, with
gentle agitation.
2. Drain the excess washing solution and apply 100 pL of blocking solution to
each slide
3. Incubate for 10 min at room temperature under a coverslip.
4. Remove the covershp, dram excess fluid, and apply 100 pL of FITC-avldin
diluted to 5 pg/mL in blocking solution to the slide. Cover with a new coverslip
and incubate at 37°C for 30 min in a moist chamber.
5. Remove the coverslip and wash the slide three times (5 mm each) m washmg
solution, at room temperature, with gentle agitation.
6 Drain excess fluid and mount the slide (22 x 40 coverslip) with Vectashleld
antifade solution containing 0.5 l.tglmL propidium iodide.
7 Examine the shde by fluorescence microscopy (Fig. 1).
4. Notes
1. Chromosome-spectfic primers sometimes differ from each other by only one
nucleotide at the 3’-end, as for the primers described here. It is therefore advtsable
to purify the primers by HPLC to avoid contammation by shorter products am+
mg from premature stops during syntheses. Storage of the primers in small aliquots
also prevents degradation of the primers by repeated cycles of freeze-thawing.
2. The concentration of the primers can be determined by using the Beer-Lambert
equation:
c =
A26d%mi
x L
(1)
where C is the concentration (M), A260 is the absorbance at 260 nm, E,,,~~ is the
molar extinction coefficient (M-l), and L is the path length (cm) of the spectro-
photometer cuvet. The molar extinction coefficient for an oligonucleottde can be
determined as follows:
& max = (number of A x 15,200) + (number of C x 7050) +

(number of G x 12,010) + (number of T x 8400) M-l
(2)
3. We describe here formamide denaturation, which gave more consistent results in
our hands, but it is also possible to denature the chromosomes by heating the
slide at 95“C for 3 min as part of the thermal cycle. In this case, omit step 3 of
Section 3.1.) and run the following program on the PCR machine: 95°C for 3 min,
Chromosome-Specific PRINS 11
Fig. 1. PRINS detection of chromosomes 13 (A) and 21 (B). The detection was per-
formed according to the protocol described in the text. The chromosomes were coun-
terstained with propidium iodide. Arrows indicate the chromosome-specific signals.
annealing temperature for 7 min, and 72°C for 30 min. The preheated reaction
mix is added after the initial denaturation step.
4. The annealing temperature was determined empirically for each primer, and those
described here were found to give specific labeling in our hands with our PCR
machine and in our laboratory. However, slight adjustments may be necessary if
these primers are to be used in other laboratories, since each PCR machine may
have a different thermal response curve. The conditions described here must
therefore be taken as indications only, and not as absolute rules. When testing
new PRTNS primers, a good start for the annealing temperature is 5°C under the
empirically determined melting temperature (T’,) of the primer: 4°C x (G + C) +
12 Charlieu and Pellestor
2°C x (A + T). The annealing temperature is then modified according to the sig-
nal and/or the specificity obtained.
References
1, Sumner, A. T. (1994) Chromosome banding and identification: absorption stain-
mg, m Methods in Molecular Bzology, vol. 29, Chromosome Analysis Protocols
(Gosden, J. R., ea.), Humana, Totowa, NJ, pp. 5%81.
2. Lichter, P. and Ried, T. (1994) Molecular analysis of chromosome aberrations: in
situ hybridization, in Methods in Molecular Biology, vol. 29, Chromosome Analy-
szs Protocols (Gosden, 3. R., ed.), Humana, Totowa, NJ, pp. 449-478.

3. Choo, K. H,, Vissel, B., Nagy, A., Earle, E., and Kalitsis, P. (1991) A survey of
the genomic distribution of alpha satellite DNA on all the human chromosomes,
and derivation of a new consensus sequence. Nuclezc Aczds Res. 19, 1179-I 182.
4. Willard, H. F. and Waye, J. S. (1987) Hierarchical order in chromosome-specific
human alpha satellite DNA. Trends Genet. 3, 192-198.
5, Jorgensen, A. L., Bostock, C. J., and Bak, A. L. (1987) Homologous subfamilies
of human alphoid repetitive DNA on different nucleolus organizing chromosomes
Proc. Natl. Acad. Scz. USA 84, 1075-1079.
6. Koch, J. E., Kolvraa, S., Petersen, K. B., Gregersen, N., and Bolund, L. (1989)
Oligonucleotide-priming methods for the chromosome-specific labelling of alpha
satellite DNA in situ. Chromosoma 98,259-265.
7. Gosden, J. and Lawson, D. (1994) Rapid chromosome identification by oligo-
nucleotide-primed in situ DNA synthesis (PRINS). Hum. Mol. Genet. 3,93 l-936.
8. Pellestor, F., Girardet, A., Lefort, G., Andrea, B., and Charlieu, J P. (1995) Rapid
in situ detection of chromosome 2 1 by PRINS technique. Am. J. Med. Genet. 56,
393-397.
9. Pellestor, F., Girardet, A., Andrea, B., Lefort, G., and Charlieu, J P. (1994) The
use of PRINS technique for a rapid in situ detection of chromosomes 13, 16, 18,
21, X and Y. Hum. Genet. 95,12-17.
10. Pellestor, F., Girardet, A., Lefort, G., And&o, B., and Charlieu, J P. (1995)
Selection of chromosome specific primers and their use in simple and double
PRINS technique for rapid in situ identification of human chromosomes.
Cytogenet. Cell. Genet. 70, 138-142
11. Charlieu, J P., Murgue, B., Marcais, B., Bellis, M., and Roizes, G. (1992) Dis-
crimination between alpha satellite DNA sequences from chromosomes 21 and
13 by using polymerase chain reaction, Genomics 14,5 15,5 16.
3
Bright-Field Microscopic Detection
of Oligonucleotide PRINS-Labeled DNA
in Chromosome Preparations

Ernst J. M. Speel, Diane Lawson, Frans C. S. Ramaekers,
John R. Gosden, and Anton H. N. Hopman
1. Introduction
Primed dn situ (PRINS) labeling has become an alternative to in situ
hybridization (ISH) for the localization of nucleic acid sequences m cell (I-4)
and tissue preparations (5; see also Chapter 5). In the PRINS method, an unlabeled
primer (restriction fragment, PCR product, or oligonucleotide) is annealed to
its complementary target sequence in situ. The primer serves as an initiation site
for in situ chain elongation using a thermostable DNA polymerase and labeled
nucleotides, which can be detected directly by fluorescence microscopy, such
as fluorochrome-labeled dNTPs, or indirectly using, e.g., biotin- or digoxi-
genin-dUTP and the application of fluorochrome-conjugated avidin or anti-
body molecules (3,6,7). The detection limit of the PRINS technique appears to
be on the order of low-copy sequences (3,8’.
Recently, multiple-target PRINS approaches were reported using sequential
PRINS reactions with differently modified nucleotides combined with fluores-
cence detection (6,7,9). For the simultaneous identification of more than two
DNA sequences, however, DNA counterstaining or chromosome banding is in
principle not possible, since the available fluorescence colors are utilized for
specific target detection.
Here we describe a bright-field microscopic procedure for the simultaneous
detection of up to three different PRINS-labeled DNA target sequences in con-
trasting colors in both interphase and metaphase cells (Fig. lA,B). DNA
sequences were detected by the precipitates of the horseradish peroxidase-
diaminobenzidine (PO-DAB, brown color), alkaline phosphatase-fast red
From
Methods m Molecular Biology, Vol 71 PRINS and
In Situ
PCR Protocols
Edited by* J. R Gosden Humana Press Inc , Totowa, NJ

13
Speel et al.
Fig. 1. (see color plate number 2 after p. 82) (A) Bright-field detection of chromo-
some 9 and 7 centromeres with biotin/PO-DAB (brown) and digoxigenin/APase-fast
red (red), respectively, in a human lymphocyte metaphase spread after double-target
PRINS, hematoxylin counterstaining and PBS/glycerol (1:9) embedding. (B) Bright-
field detection of chromosome 9,7, and Y centromeres with biotin/PO-DAB (brown),
digoxigenin/APase-fast red (red), and fluorescein/PO-TMB (green), respectively, in a
human lymphocyte metaphase spread after triple-target PRINS, hematoxylin counter-
staining and BSA/formaldehyde embedding.
(APase-fast red, red color), and horseradish peroxidase-tetramethylbenzidine
(PO-TMB, green color). Chromosomes and nuclei were counterstained with
hematoxylin before bright-field microscopical visualization. Such an approach,
which had been first described for ISH (IO), has the advantage that no fluores-
cence microscope with a confocal system or CCD camera for image analysis
and processing is required. Furthermore, no fading of the in situ enzyme pre-
cipitation products occurs since they are permanently localized.
2. Materials
2.1. PRINS DNA Labeling
1. Ultrapure dNTP set (Pharmacia, Uppsala, Sweden): 100 mJ4 solutions of dATP,
dCTP, dGTP, and dTTP.
2. Ultrapure ddNTP set (Pharmacia): 5-W solutions of ddATP, ddCTP, ddGTP,
and ddTTP.
3. Biotin- 16-dUTP, digoxigenin- 1 I-dUTP, and fluorescein- 12-dUTP (Boehringer,
Mannheim, Germany).
4. Oligonucleotide primer (see Table 1) at 250 ng/pL.
5. Tuq DNA polymerase (Boehringer) or AmpliTaq (Perkin Elmer, Chalfont St.
Giles, UK).
6. Klenow DNA polymerase (Boehringer).
7. Formamide (Fluka, Bornem, Belgium).

8. 20X SSC: 3MNaC1, 300 m&I trisodium citrate, pH 7.0.
Bright- Field Microscopic Detection
15
Table 1
Sequences of Oligonucleotide Primers Used in PRINS
Name Human origin Sequence
E528
G33
G35
D600
Chromosome 7 centromere
Chromosome 9 centromere
Chromosome 11 centromere
Chromosome Y centromere
AGCGATTTGAGGACAATTGC
AATCAACCCGAGTGCAATC
GAGGGTTTCAGAGCTGCTC
TCCATTCGATTCCATTTTTTT
CGAGAA
9. 10X Taq buffer: 500 mMKC1, 100 mMTns-HCl, pH 8.3, 15 mMMgC12, 0.1%
bovine serum albumin (BSA) (Sigma, St. Louis, MO).
10. 10X Klenow buffer: 500 mMTris-HCl, pH 7.2,lOO mMMgS04, 100 mMDTT,
1.5 mg/mL BSA.
11. PRINS stop buffer: 500 mMNaC1,50 rnJ4 EDTA, pH 8 0.
12. Washing buffer: 4X SSC (diluted from 20X SSC), 0.05% Triton X-100.
13. Ethanol/37% HCl (100. 1)-cleaned microscope slides and coverslips
14. Rubber cement.
15. Water bath at 65’C.
16. Thermal cycler (Hybaid Ommgene Flatbed) (Hybaid, Teddington, UK).
17. Humid chamber.

18. Incubator at 37°C.
2.2. ~fnzyme Cytochemicel Detection
1. Dried skimmed milk powder.
2. Normal goat serum (NGS).
3. Horseradish peroxidase-conjugated avidin (AvPO) (Dako, Glostrup, Denmark).
4. Mouse antidigoxm (MADig) (Sigma).
5. Alkaline phosphatase-conjugated goat antimouse IgG (GAMAPase) (Dako).
6. Rabbit anti-FITC (RAFITC) (Dako).
7. Horseradish peroxidase-conjugated swine antirabbit IgG (SWARPO) (Dako).
8. Peroxidase (PO) inactivation solution: O.OlN HCI.
9. 30% H202 (Merck, Darmstadt, Germany).
10. Diaminobenzidine (DAB) (Sigma).
11. 3,3’,5,5’-Tetramethylbenzidine (TMB) (Sigma).
12. Dioctyl sodium sulfosuccinate (DSSS) (Sigma).
13. Sodium tungstate (Sigma).
14. Naphthol-ASMX-phosphate (Sigma).
15. Fast red TR (Sigma).
16. Polyvinylalcohol (PVA), mol wt 40,000 (Sigma)
17. Nitro blue tetrazolium salt (NBT) (Boehrmger).
18. 5-Bromo-4-chloro-3-indolyl phosphate (BCIP) (Boehringer).
19. PO-DAB buffer: O.lM imidazole (Merck) in PBS, pH 7.6.
76
Speel et al.
20. PO-TMB buffer: 100 & citrate-phosphate buffer, pH 5.1.
21
APase buffer: 0 2MTns-HCl, pH 8.5, 10 mMMgCl*, 5% PVA.
22. Hematoxylin: Hematoxylin (Solution Gill no. 3) (Slgma):distrlled water (1:4).
23. Immersion oil (Zeiss).
24. BSA (Sigma).
25. Formaldehyde 37% (Merck).

26. Blockmg buffer: 4X SSC (diluted from stock 20X SSC), 0.05% Triton X-100,
5% skimmed milk powder.
27 Washing buffers: 4X SSC, 0.05% Triton X-100; PBS, 0.05% Triton X-100.
28 Incubator at 37’C.
29 Bright-field microscope (Zeiss Axtophot).
30. Kodak Color Gold 100 ASA film.
3 1 Blue and magenta filters
3. Methods
3.7. PRINS DNA Synthesis
1. Metaphase chromosomes are freshly prepared from peripheral blood lympho-
cytes by standard methods, fixed in methanol:acetic acid (3:1), and spread on
acid/alcohol cleaned slides (see Note 1).
2. Slides are passed through an alcohol series (70,90, and lOO%, 2 min each), which
helps m preserving chromosome morphology, and air-dried.
3. Chromosomal DNA 1s denatured m 70% formamide, 2X SSC, pH 7.0, for 2 mm
at 7O”C, followed by dehydration of the slides with 70% ethanol at 4”C, 90 and
100% ethanol, and an-drying.
4 The concentration of the appropriate oligonucleotide resulting in positive signals
needs to be determined by experiment. Generally, 250 rig/slide m 40 pL IS used
for primers of 16-30 bases complementary to repeated sequences.
5. The PRMS reaction mix is made up on ice as follows: Dilute 100 mM dATP,
dGTP, and dCTP 1: 10 with distilled water Dilute 100 mM dTTP 1: 100. Put
together in a microcentrifuge tube: 1 u,L of each of the diluted dNTPs, 1 pL of
either 1 nnl4 biotm- 16-dUTP, digoxigenin-1 1 -dUTP, or fluorescein- 12-dUTP
(see Note 2), 5 $ of 10X
Tuq
buffer, 250 ng of oligonucleotide, 1 U
Taq
poly-
merase, and distilled water to 50 $.

6. Place 40 pL of this mixture under a coverslip on the slide, seal with rubber cement,
an-dry the rubber cement, and transfer to the heating block of the thermal cycler.
7. Each PRINS reaction cycle consists of 5 min at the appropriate annealing tem-
perature (see Note 3) and 15 min at 72°C for
in situ
primer extension.
8. Stop the PRINS reaction by transferring the slides (after removal of the rubber
solution seal) to 50 mL of PRINS stop buffer in a Coplin jar at 65OC for 1 min.
9. For sequential PRINS reactions, it was found essential to prevent free 3’-ends of
the newly synthesized DNA from being used as primers for subsequent reactions.
This can be achieved by incubatmg the slides with Klenow DNA polymerase
together with ddNTPs. The reaction mix is made up as follows: Dilute 5 mM of
all four ddNTPs 1: 10 with distilled water. Put together in a microcentrifuge tube
Bright- Field Microscopic Detection 17
Table 2
Enzyme Cytochemical Detection
Systems That Can Be Used for PRINS-Labeled DNAa
Detection
Label
Biotin
Biotin
HaptenC
Hapten
Hapten
Hapten
Hapten
1 st layer
Avidin-Eb
Avidin-E
Antihapten Ab-E

Moused antihapten Ab
Mouse antihapten Ab
Mouse antihapten Ab
Mouse antihapten Ab
2nd layer
Brotin-labeled
antiavidin Ab
Antimouse Ab-E
Rabbit antimouse
Ab-E
Biotin-labeled
antimouse Ab
Drgoxigenin-labeled
antimouse Ab
3rd layer
Avidm-E
Antirabbit Ab-E
ABC
Anti-digoxigenin
Ab-E
aFurther amplification of PRINS signals may be achieved by combining these detection sys-
tems with peroxrdase-mediated deposition of hapten- or fluorochrome-labeled tyramldes
(1 I, 12)
bAbbreviations. Ab, antibody; ABC, avidin biotmylated enzyme (horseradish peroxidase or
alkaline phosphatase) complex; E, enzyme (horseradish peroxidase or alkaline phosphatase).
CHapten = biotm, digoxtgenm, FITC, or DNP.
dAntihapten antibody ratsed m another species (e.g., rabbit, goat, swine) can also be used as
primary
antibody in PIUNS detection schemes.
2.5 @ of each of the ddNTPs, 5 pL of 10X Klenow buffer, 1 U Klenow DNA

polymerase, and distilled water to 50 @,.
10. Place 40 & of this mixture under a coverslip on the slide, transfer to a humid
chamber, and incubate for 1 h at 37°C in an incubator.
11. Dehydrate the slides as described in step 2 and au-dry before running the next
PRINS reaction with another primer and different reporter.
12. Finally, transfer the slides to washing buffer at
room
temperature and wash
for 5 min.
3.2. Enzyme Cytochemical Detection
1. Place 40 l,tL of blocking buffer under a coverslip on the slide and leave for 5 min
at room temperature to reduce background stammg in the detection procedures.
2. Dilute detection molecules as follows: Dilute avidin conjugates m blocking buffer
and antibody conjugates in PBS, 0.05% Tnton X-100,2% NGS.
3 For single-target detection, incubate the slides for 30 mm at 37’C with the first
detection layer (Table 2), and wash 2 x 5 min m the appropriate washmg buffer
(4X SSC, 0.05% Triton X-100 for avidin, and PBS, 0.05% Triton X- 100 for anti-
body molecules). Repeat this step with the next detection layer until all incuba-
tions are complete.
18
Speel et al.
Table 3
Enzyme Cytochemical Reactions
That Can Be Used for In Situ Nucleic Acid Detectiona
Enzyme Enzyme reagents Embedding Absorption color Reference
POb HZO, + DAB Aqueous/ Brown Graham and
organic Karnovsky,
1966 (13)
PO HZ02 + TMB Organic Green Speel et al.,
1994 (IO)

APase N-ASMX-P + Aqueous Red Speel et al.,
fast red TR
1992 (14)
APase
BCIP + NBT
Aqueous
Blue/purple McGadey,
1970 l1.5)
OOther enzyme reactlons that have been used for in SW nucleic acid detectlon are described
elsewhere
(12,16)
bAbbrevlatlons APase, alkahne phosphatase, BCIP, 5-bromo-4-chloro-3-mdolyl phosphate;
DAB, dlaminobenzldme; N-ASMX-P, naphthol-ASMX-phosphate; NBT, mtro blue tetrazohum,
PO, horseradish peroxldase, TMB, tetramethyl benzldme
4 After the last detection layer, wash samples with PBS for 5 min at room temperature
and visualize the DNA target by an appropriate enzyme reaction (see 5, and Table 3)
5. To detect multiple DNA targets labeled with different haptens, a combmatlon of
enzyme cytochemlcal detection systems is chosen from Table 2. Smce the
enzymes horseradish peroxidase (PO) and alkaline phosphatase (APase) can
generate a number of differently colored precipitates (see Table 3), multiple DNA
targets can be visualized simultaneously by suitable combmattons of enzyme
reactions. If the entire detection procedure uses more than one PO or APase reac-
tion, the first applied enzyme can be inactivated after the first detection reaction
by incubating the sample in O.OlM HCl for 10 min at room temperature. Then,
the next detection system can be applied, followed by the appropriate enzyme
reaction (Note 4).
6. As an example, a protocol for triple-target PRINS is outlined in Table 4 (Note 5).
Protocols for bicolor detection of nucleic acid sequences in situ can be derived
from this protocol or can be found elsewhere (Note 6) (10,17-21).
7.

Visualize the PRINS-labeled DNA targets with one of the following enzyme
reactions (Note 7):
a. PO-DAB reaction: Mix 1 mL 5 mg/mL DAB in PBS, 9 mL PO-DAB buffer,
and 10 & 30% H202 just before use, and overlay each sample with 100 pL
under a coverslip. Incubate the slides for 5-15 min at 37’C, wash 3 x 5 min
with PBS, dehydrate (optionally), and coverslip with an aqueous or organic
mounting medium
b. PO-TMB reaction: Dissolve 100 mg sodium tungstate m 7.5 mL PO-TMB
buffer and adjust the pH of this solution to 5.0-5.5 with 37% HCl. Just before
Bright-Field Microscopic Detection 19
Table 4
Enzyme Cytochemical Detectlon Protocol
for Three Nucleic Acid Sequences
In
Situ, Labeled with PRINS
Using Blotin-, Digoxigenin-, and FITC-Modified Nucleotides, Respectivelya
1.
2.
3.
4.
5.
6.
7.
8.
9.
10
Detection step
Detect biotin with AvP@ (diluted 1:50)
Visualize PO activity in brown (PO-DAB)
as described in Section 3.2., step 7a

Inactivate residual PO activity with
O.OliVHCl
Detect digoxigenm and FITC with
MADig/RAFITC (both diluted 1:2000)
Detect primary antibodies with
GAMAPase/SWARPO (diluted 1:25
and 1:lOO)
Visualize APase activity in red
(APase-fast red) as described in
Section 3 2., step 7c
Visualize PO activity in green
(PO-TMB) as described in Section 3.2.,
step 7b
Counterstam with hematoxylin
Air-dry
Embed in a protein matrixC
Time Temperature
30 min 37°C
5 min 37OC
10 min
30 mm
30 min
Room temperature
37Y!
37°C
5-10 min 37OC
1-2 min 37°C
1s
Room temperature
10 min Room temperature

10 min 37OC
OFor details of detection systems, see Table 2.
bAbbreviations used: APase, alkaline phosphatase; AvPO, PO-conjugated avidm; DAB,
diaminobenzidine; GAMAPase, APase-conlugated goat antrmouse IgG; MADig, mouse
antidigoxin; PO, horseradish peroxtdase; RAFITC, rabbit anti-FITC IgG, SWARPO, PO-conju-
gated swine an&rabbit IgG
cFor details of the protein matrrx, see Section 3.2., step 9.
use, dissolve 20 mg DSSS and 6 mg TMB in 2.5 mL 100% ethanol at 80°C.
Mix both solutions, add 10 pL HzOz, and overlay each sample with 100 pL
under a coverslip. Incubate the slides for l-2 min at 37Y!, wash 3 x 1 min
with ice-cold 0. 1Mphosphate buffer, pH 6.0, dehydrate (optionally), and cov-
erslip with an organic mounting medium or immersion oil.
c. APase-fast red reaction: Mix 4 mL APase buffer, 1 mg naphthol-ASMX-phos-
phate in 250 pL buffer without PVA, and 5 mg fast red TR m 750 Ccs, buffer
without PVA just before use, and overlay each sample with 100 pL under a
coverslip. Incubate the slides for 5-15 min at 37”C, wash 3 x 5 min with PBS,
and coverslip with an aqueous mounting medium (Note 8).
d. Alkaline phosphatase-NBT/BCIP reaction: Dissolve 1.8 mg BCIP in 100 @.,
N,N-dimethylformamide and 3.3 mg NBT in 660 & distilled water and add
20
Speel et al.
subsequently to 9.24 mL APase buffer. Overlay each sample with 100 pL under
a coverslip. Incubate the slides for 15-60 min at 37”C, wash 3 x S min with
PBS, and coverslip with an aqueous mounting medium (Note 8).
8. Aher all enzyme reactions have been performed, counterstain the samples with
hematoxylin, wash 1 x S min m tap water and 1 x 2 min in distilled water, and
air-dry if you wish.
9 Mount single-target PRINS samples in the embedding medium required for the
used enzyme precipitate, as outlined in steps 7a-d and Table 3. Mount mul-
tiple-target PRINS samples m the embedding medmm required for the used

enzyme precipitates, unless they need different mounting. In that case, apply a
protein embedding layer by smearmg 50 pL of a mixture of 40 mg/mL BSA m
distilled water and 4% formaldehyde onto the slides. Air-dry for 10 min at
37°C (Note 9)
10. Examine slides under a bright-field microscope. Microphotographs can be made
usmg blue and magenta filters and Kodak 100 ASA film.
4. Notes
1. Slides should be used within a week of preparation and stored in a vacuum deslc-
cator until use. Cell suspensions can be stored for up to 3 mo at -20°C.
2. In the case of labeling with biotin- 1QdUTP or fluorescem-12-dUTP, a four times
decrease of the concentration of dTTP in the PRINS reaction mix resulted m
significantly stronger labeling of DNA sequences. Under the described standard
conditions, digoxigenin-1 l-dUTP provides the highest sensitivity. However, all
the modified nucleotides are suited for detection of repeated sequences zn sm.
3. The optimum primer annealing temperature is only determined empirically. We
usually try a series from 45 to 7O”C, in 5°C steps.
4. Enzyme inactivation by an incubation with O.OlMHCl has no demonstrably nega-
tive effect on the stability of the synthesized DNA and its incorporated reporters
(blotin, digoxigenin, FITC).
5. If multiple enzyme reactions are utilized, the PO-TMB reaction must always be
performed last, since the resulting precipitate proved to be unstable in aqueous
solutions with a pH above 6.0 (e.g., distilled water and PBS).
6. In case of enzyme activity detection after application of a PO and APase conju-
gate, the APase reaction must always be performed first to prevent inactivation
of APase during the PO reaction.
7. It is recommended to follow every enzyme reaction under the microscope to
ensure discrete localization of the in sztu signals.
8. Do not dehydrate the slides after the APase reaction, since the precipitate dis-
solves (partially) in organic solvents. Optionally, you may air-dry the slides after
rinsing in distilled water.

9. Embedding in a protein layer is essential to prevent dissolving of the enzyme
reaction product in an aqueous or organic mounting medium, or in immersion oil.
In this way, it ensures stabilization of the enzyme precipitates and, in addition,
optimal visualization of color contrast.
Bright- Field Microscopic Detection 21
References
1. Bains, M. A., Agarwal, R., Pringle, J. H., Hutchinson, R. M., and Lauder, I. (1993)
Flow cytometric quantitation of sequence-specific mRNA in hemapoietic cell sus-
pensions by pnmer-induced in situ (PRINS) fluorescent nucleotide labeling. Exp.
Ceil Res 208,321-326
2. Koch, J., Mogensen, J., Pedersen, S., Fischer, H., Hmdkjmr, S., Kolvraa, S., and
Bolund, L. (1992) Fast one-step procedure for the detection of nucleic acids in
situ by primer-induced sequence-specific labelmg with fluorescein-12-dUTP.
Cytogenet. Cell Genet. 60, l-3.
3. Gosden, J. and Lawson, D. (1994) Rapid chromosome identificatron by oligo-
nucleotide-primed in s~tu DNA synthesis (PRINS). Hum Mol. Genet 3,93 l-936.
4. Pellestor, F., Girardet, A., Lefort, G., And&o, B., and Charlieu, J. P. (1995) PRINS
as a method for rapid chromosomal labeling of human spermatozoa. Mel Reprod.
Dev. 40,333-337.
5. Speel, E. J. M., Lawson, D., Ramaekers, F. C. S., Gosden, J. R., and Hopman, A.
H. N. (1996) Raprd brightfield detection of oligonucleotide primed in situ (PRINS)
labeled DNA m chromosome preparations and frozen tissue sections. Bio-
techniques 20,226234.
6. Hindkjmr, J., Koch, J , Terkelsen, C., Brandt, C. A., Kolvraa, S., and Bolund, L.
(1994) Fast, sensitive multicolor detection of nucleic acids in situ by primed in
situ labeling (PRINS). Cytogenet. Cell Genet. 66, 152-154.
7. Speel, E. J. M., Lawson, D., Hopman, A. H. N., and Gosden, J. (1995) Multi-
PRINS: multiple sequential oligonucleotide primed in situ DNA synthesis reac-
tions label specific chromosomes and produce bands. Hum. Genet. 95,2!3-33.
8 Abbo, S., Dunford, R. P., Miller, T. E., Reader, S. M., and King, I. P. (1993)

Primer-mediated in s&u detection of the B-hordem gene cluster on barley chro-
mosome 1H Proc. Natl. Acad. Scz. USA 90, 11,821-l 1,824.
9. Volpi, E. V. and Baldini, A. (1993) MultiPRINS. a method for multicolor primed
m situ labeling. Chromosome Res. 1,257-260.
10. Speel, E. J. M , Jansen, M. P. H. M., Ramaekers, F. C. S., and Hopman, A. H N. (1994)
A novel triple-color detection procedure for brightfield microscopy, combinmg in situ
hybridization with immunocytochemistry. J. Histochem Cytochem 42,1299-1307.
11. Bobrow, M. N., Harris, T. D., Shaughnessy, K. J., and Litt, G. J. (1989) Catalyzed
reporter deposition, a novel method of signal amplification Amplrfication to
immunoassays J Immunol Methods 125,279-285.
12. Speel, E. J. M., Ramaekers, F. C. S., and Hopman, A. H. N. (1995) Cytochemical
detection systems form situ hybridization, and the combination wtth immunocy-
tochemistry. Histomchem. J. 27,833-858.
13. Graham, R. C. and Karnovsky, M. J. (1966) The early stages of absorption of
injected horseradish peroxidase in the proximal tissues of mouse kidney with struc-
tural cytochemistry by a new technique. J. Histochem. Cytochem. 14,291-302.
14. Speel, E J. M., Schutte, B., Wiegant, J., Ramaekers, F. C. S., and Hopman, A. H. N.
(1992) A novel fluorescence detection method for m situ hybndtzation, based on
the alkaline phosphatase-fast red reaction. J. Histochem. Cytochem. 40,1299-1308.
22 Speel et al.
15. McGadey, J. (1970) A tetrazolium method for non-specific alkaline phosphatase.
Histochemistry 23, 180-l 84.
16. Speel, E. J. M., Kamps, M., Bonnet, J., Ramaekers, F. C. S., and Hopman, A. H. N.
(1993) Multicolour preparations for in situ hybridization using precipitating
enzyme cytochemistry in combination with reflection contrast microscopy.
Histochemistry 100,357-366.
17. Hopman, A. H. N., Wiegant, J., Raap, A. K., Landegent, J. E., Van der Ploeg, M.,
and Van Duijn, P. (1986) B&color detection of two target DNAs by non-radioac-
tive in situ hybridization. Histochemistry 85, l-4.
18. Emmerich, P., Loos, P., Jauch, A., Hopman, A. H. N., Wlegant, J., Higgins, M. J.,

White, B. N., Van der Ploeg, M., Cremer, C., and Cremer, T. (1989) Double in
situ hybridization in combination with digital image analysis: a new approach to
study interphase chromosome topography. Exp. Cell Res 181, 126-140
19. Herrington, C. S., Burns, J., Graham, A. K., Bhatt, B., and McGee, J. 0’. D (1989)
Interphase cytogenetics using biotin and digoxygenin labeled probes II: simulta-
neous differential detection of human and papilloma virus nucleic acids in indi-
vidual nuclei. J. Clin. Pathol. 42,601-606.
20. Mullink, H., Walboomers, J. M. M., Raap, A. K., and Meyer, C. J L. M. (1989)
Two color DNA in situ hybridization for the detection of two viral genomes using
non-radioactive probes. Histochemrstry 91, 195-198
21. Kerstens, H. M. J., Poddighe, P. J., and Hanselaar, A. G. J M. (1994) Double-
target m situ hybridization in brightfield microscopy. J. Histochem. Cytochem 42,
1071-1077.
Analysis of Sperm Aneuploidy by PRINS
Franck Pellestor and Jean-Paul Charlieu
1.
Introduction
The estimation of aneuploidy rate in human gametes is a subject of interest
and research because nondisjunctions make a major contribution to the chro-
mosomal abnormalities found in humans. Numerous questions remain concern-
ing the occurrence and the etiology of such aneuploidy in gametes.
Since human sperm is easier to obtain than mature human oocytes, most of the
studies have focused on male gametes. In the last decade, direct information on
the chromosomal constitution of human sperm has been obtained thanks to the
introduction of the in vitro human sperm-hamster egg fertilization system,
which allows the karyotyping of human sperm complements (I,2). This new
experimental system has provided a direct method to investigate several points
(distribution of nondisjunction, sex ratio, paternal age effect, relationship to
infertility) and to determinate the meiotic segregation of chromosomal rear-
rangements (3,4). The method is time-consuming, labor-intensive, and of little

profit in terms of sperm karyotypes obtained. Recently, several laboratories
have adapted the interphase fluorescence in situ hybridization (FISH) tech-
nique to sperm in order to assess directly the incidence of disomy in human
gametes (5,6). Aneuploidy has thus been estimated for several chromosomes
usmg centromeric repeat probes. However, the use of centromeric probes pre-
sents some limitations because several human chromosomes share high levels
of homology in their a-satellite DNA sequences, resulting in crosshybridiza-
tion in FISH reactions (7). The most striking example concerns chromosomes
13 and 21 for which this homology reaches 99.3% (8). In addition, the FISH
analysis of spermatozoa is hampered by the fact that the DNA in sperm heads
is highly condensed and of difficult access.
From: Methods fn Molecular Biology, Vol 71: PRINS and In Situ PCR Protocols
Edited by J. R Gosden Humana Press Inc , Totowa, NJ
23
24
Pellestor and Charlieu
The primed
in situ
(PRINS) technique provides an alternative approach for
direct chromosomal detection, Because of the high complementarity between
the oligonucleotide primer and its genomic target, PRINS appears to be more
efficient than FISH for discriminating between a-satellite DNA sequences. The
limitation of the PRINS method for the analysis of nondisjunction in human
sperm was initially that only one chromosome could be labeled. Thus, the dis-
tinction between diploidy and disomy could not be done by PRINS (9). The
recent introduction of multicolor PRlNS protocols has allowed us to overcome
this problem (10, II). We have adapted our protocol to human sperm. The effi-
ciency of the method has also been improved by the use of a new sperm
pretreatment protocol that permits the simultaneous decondensation and dena-
turation of sperm nuclei. In PRINS, the decondensation of the sperm head is a

less limiting factor than in FISH (where the probes are 200-500 bases long)
because of the small size of the oligonucleotide primers (18-30 nucleotides).
This facilitates their penetration into sperm nuclei and their access to the
genomic sequences, resulting in a more homogeneous and more rapid labeling
of sperm nuclei (Fig. 1).
2. Materials
2.7. Preparation of Sperm Samples
1.
Phosphate-buffered saline (PBS) (Gibco BRL,, Eragny, France).
2. Methanol, 99% (Prolabo, Paris, France).
3. Ethanol, 99% (Prolabo).
4. Glacial acetic acid (Prolabo).
5. 3MNaOH.
6. Clean microscope glass slides.
2.2. Dual-Color PRINS Reaction
1, 2’-Deoxyadenosine S-triphosphate (dATP) 100 mkf (Boehringer Mannheim,
Meylan, France).
2. 2’-Deoxycytosine 5’-triphosphate (dCTP) 100 mM(Boehringer Mannheim).
3. 2’-Deoxyguanosine 5’-triphosphate (dGTP) 100 n&f (Boehringer Mannheim)
4. 2’-Deoxythymidine 5’-triphosphate (dTTP) 100 & (Boehringer Mannhelm).
5. Labeled dUTP (1 n&I): Biotin-16-dUTP (Boehringer Mannheim), digoxrgenin-
11 -dUTP (Boehringer Mannheim), fluorescein- 12-dUTP (Boehringer Mannheim),
and tetramethylrhodamine-6-dUTP (Boehringer Mannheim).
6. 2’.3’-Dideoxy-adenosine-5’kphosphate (ddATP) 10 mM (Boehringer Mannhelm)
7. 2’.3’-Dideoxy-cytrdine-5’kphosphate (ddCTP) 10 mM(Boehringer Mannheim)
8. 2’.3’-Dideoxy-guanosine-5’-triphosphate (ddGTP) 10 mA4 (Boehringer Mannheim).
9. 2’.3’-Dideoxy-thymidine-5’-triphosphate (ddTTP) 10 mM(Boehrmger Mannheim).
10. Taq DNA polymerase (Boehringer Mannheim) (store at -20°C).
Il. 10X Tuq buffer (Boehringer Mannheim) (store at -20°C).
Analysis of Sperm Aneuploidy

25
Fig. 1. (see color plate number 3 after p. 82) Examples of dual-color PRINS labeling
of human sperm nuclei. (A,B) Normal haploid spermatozoa bearing distinctive green
(chromosome 21) and red (chromosome 9) fluorescent spots. (C) PRINS labeling of a
disomic sperm nuclei for chromosome 18. The a satellite DNA of the chromosome 18 is
labeled with biotin and detected with fluorescein-avidin-DCS. The c1 satellite of the
chromosome 12 is labeled with digoxigenin and detected with antidigoxigenin-
rhodamine. The arrow indicates a sperm nucleus showing two distinctive green fluores-
cein spots. (D) A diploid sperm (arrow) observed in a direct labeling PRJNS reaction
performed with fluorescein-12-dUTP and rhodamine-6-dUTP for the detection of chro-
mosomes 13 and 16, respectively. The marked nucleus shows two green and two red
fluorescent signals. This nucleus is larger than normal haploid sperm nuclei.
12. Glycerol, 87% (Prolabo).
13. Stop buffer: 500 mMNaC1,50 mMEDTA, pH 8.0 (store at 4’C).
14. 20X SSC solution: 3MNaCl,0.3Mtrisodium citrate (store at 4°C).
15. Washing buffer: 4X SSC, pH 7.0,0.05% Tween-20 (Boehringer Mannheim).
16. Blocking buffer: Washing buffer plus 5% nonfat dry milk. Make fresh each time.
17. 10X NT buffer: 500 mMTris-HCl, pH 7.2,50 mMMgS04, 0.1 mMdithiothreito1,
1 mg/mL BSA (store at 4’C).
18. Klenow enzyme (Boehringer Mannheim) (store at -2O’C).
19. Oligonucleotide primer at 50 pmol/$ (see Note 1 and Table 1).
20. Deionized, double-distilled water.
2 1. Water bath at 72°C.